ID: 900995607

View in Genome Browser
Species Human (GRCh38)
Location 1:6121723-6121745
Sequence CCGGCTAAGTCAGAGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900995596_900995607 18 Left 900995596 1:6121682-6121704 CCACTGCAGCCAAGCACCTCCAG 0: 1
1: 0
2: 2
3: 37
4: 315
Right 900995607 1:6121723-6121745 CCGGCTAAGTCAGAGAGGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 113
900995598_900995607 9 Left 900995598 1:6121691-6121713 CCAAGCACCTCCAGGAGAGACAA 0: 1
1: 0
2: 2
3: 31
4: 212
Right 900995607 1:6121723-6121745 CCGGCTAAGTCAGAGAGGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 113
900995601_900995607 -1 Left 900995601 1:6121701-6121723 CCAGGAGAGACAAGCAGGATCCC 0: 1
1: 0
2: 3
3: 22
4: 196
Right 900995607 1:6121723-6121745 CCGGCTAAGTCAGAGAGGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 113
900995600_900995607 2 Left 900995600 1:6121698-6121720 CCTCCAGGAGAGACAAGCAGGAT 0: 1
1: 1
2: 3
3: 37
4: 369
Right 900995607 1:6121723-6121745 CCGGCTAAGTCAGAGAGGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900995607 Original CRISPR CCGGCTAAGTCAGAGAGGCC AGG Intronic
900631779 1:3640340-3640362 CCTGCTGAGTCTGAGAGGCTTGG - Intronic
900995607 1:6121723-6121745 CCGGCTAAGTCAGAGAGGCCAGG + Intronic
901623566 1:10609029-10609051 CAGGTTAAGTGAAAGAGGCCAGG - Intronic
902257185 1:15197473-15197495 CCTCTTCAGTCAGAGAGGCCGGG - Intronic
902301390 1:15505130-15505152 CTGCCTCAGTCAGAGGGGCCTGG - Intronic
902613084 1:17608460-17608482 GTGGCTAAGCCAGAGCGGCCTGG + Intronic
904642977 1:31944553-31944575 CCTGCACAGGCAGAGAGGCCAGG - Intronic
904752032 1:32746972-32746994 GGGGCTAAGTCAGCTAGGCCTGG - Intronic
909483074 1:76146472-76146494 CCGTCAAAGTCAGAGAGGACAGG - Intronic
910760498 1:90727153-90727175 CCCGCAAAGCCGGAGAGGCCGGG - Intergenic
915498670 1:156299356-156299378 CGGGCTAGGTAAGAGAGGCTGGG - Intergenic
917666286 1:177228909-177228931 CCGTCTAACTCAGAGAGGGCAGG + Intronic
918989501 1:191680616-191680638 CAGGCTAAGTGAGAGTGGCATGG + Intergenic
920786604 1:209048495-209048517 CAGTCTGACTCAGAGAGGCCTGG + Intergenic
920817123 1:209345133-209345155 CAGGCAACGTCAGAGAGTCCTGG - Intergenic
921188784 1:212692077-212692099 CAGGCCAAGCCAGAGAGGCAGGG - Intronic
1062937769 10:1400911-1400933 ACGGCTGAGTCAGGGAGGGCCGG + Intronic
1064332145 10:14403922-14403944 CCTGCTTTGTCAGTGAGGCCTGG - Intronic
1066758023 10:38730164-38730186 CCCGCCAAGTCGGACAGGCCTGG + Intergenic
1067153204 10:43753322-43753344 CCAGGTTAGTCTGAGAGGCCAGG + Intergenic
1073639634 10:105238369-105238391 CTGGCTAAGTCAGGCAGGCTGGG + Intronic
1077317999 11:1927820-1927842 ACCACTAAGTCAGGGAGGCCAGG + Intronic
1079666516 11:23113120-23113142 CCCGCTGAGTCACACAGGCCTGG - Intergenic
1081538951 11:44016307-44016329 CCGGCTTAGTCACAGTGGGCAGG + Intergenic
1083260324 11:61518954-61518976 CAGTCTAATTCCGAGAGGCCTGG - Intronic
1083338949 11:61946223-61946245 CGGGGTAAGTCAGCCAGGCCTGG - Intergenic
1085054426 11:73395461-73395483 CCGGCTAAGTGAGAGCAACCTGG + Exonic
1087155381 11:94896711-94896733 CAGGCTAAGTCACATAGACCCGG + Intergenic
1090034841 11:123239929-123239951 CCTGCTAAGTGAGAGACACCCGG - Intergenic
1098112833 12:67141659-67141681 CAGGTGAAGTCAGAGAGACCAGG - Intergenic
1100386548 12:94109387-94109409 CTGGATGACTCAGAGAGGCCTGG - Intergenic
1102534419 12:113570031-113570053 CCGGAGAAGGCAGAGAGGGCCGG + Intergenic
1105451541 13:20504135-20504157 CAGCCTAAGTCAGGGCGGCCTGG + Intronic
1105519628 13:21120568-21120590 CCTTATAAGTCAGAGAGGGCCGG + Intergenic
1113395988 13:109948355-109948377 CCTCCTAAATGAGAGAGGCCAGG + Intergenic
1114010353 14:18359659-18359681 CCGGCTACTTCAAAGAGGACAGG - Intergenic
1120445285 14:84587573-84587595 CCCGCTAAGTCATGCAGGCCTGG + Intergenic
1122550020 14:102544655-102544677 CGGGCGAAATCCGAGAGGCCCGG + Intergenic
1122842549 14:104473413-104473435 CAGGGTCACTCAGAGAGGCCCGG + Intergenic
1127166921 15:56253331-56253353 CATGCTATGTCAGAGAGTCCTGG + Intronic
1132470948 16:102675-102697 CCGGCTAAGTCCGGGAGACTTGG + Intronic
1132757904 16:1494834-1494856 CCGGCTGTGTCAGAGAGGGATGG + Intronic
1133035275 16:3030794-3030816 CCTGCTCAGTCTGGGAGGCCTGG + Exonic
1133853698 16:9529533-9529555 CCGACTAAGGCAGAGTGGCCAGG + Intergenic
1138170985 16:54849517-54849539 GTAGCTAAGTCAGAGTGGCCAGG + Intergenic
1142717697 17:1755897-1755919 CCCTGGAAGTCAGAGAGGCCTGG + Intergenic
1142972814 17:3624112-3624134 TCGGCTGGGGCAGAGAGGCCAGG + Exonic
1144421696 17:15104683-15104705 CAGGCTATGTCAGAGAGCACTGG - Intergenic
1145267174 17:21385510-21385532 CCTGCCCAGTCAGAGCGGCCAGG + Intronic
1147700085 17:42388287-42388309 CCGGCAGAGGCCGAGAGGCCGGG + Exonic
1151186597 17:72369336-72369358 TAGGATAAGTCAGAGAGCCCTGG + Intergenic
1152091447 17:78249837-78249859 CAGGCAGAGTCAGAGGGGCCAGG + Intergenic
1152771928 17:82175321-82175343 CCTGCTCAGCCAGTGAGGCCAGG - Intronic
1157600229 18:48889104-48889126 CTGGCTAGGTCAGAGAACCCAGG - Intergenic
1159077395 18:63696834-63696856 CATGCTGAGTGAGAGAGGCCAGG - Intronic
1161360122 19:3843909-3843931 CAGGCTCAGTGAGAGAAGCCAGG + Intronic
1164727944 19:30479392-30479414 CCAGCTAAATCAGATAAGCCTGG + Intronic
1165786996 19:38467574-38467596 CAGGCAGAGTCAGAGAGGCTAGG - Intronic
927881354 2:26692274-26692296 CAGACTGAGACAGAGAGGCCTGG - Intergenic
928308911 2:30193800-30193822 CCATCCAAGCCAGAGAGGCCAGG - Intergenic
934321338 2:91974605-91974627 CCCGCCAAGTCGGACAGGCCCGG + Intergenic
935990494 2:108714813-108714835 CCCGCTAAGTCACAGAGGTTTGG + Intergenic
937294809 2:120803659-120803681 AAGACCAAGTCAGAGAGGCCAGG - Intronic
937926966 2:127175027-127175049 CCGTCTAAGGCAGAGACGACAGG + Intergenic
947097459 2:226582284-226582306 CAGGCTAGGTCAGAGGGGCCAGG + Intergenic
947478348 2:230472804-230472826 CTGGGTGAGTCAGAGGGGCCAGG - Intronic
948405730 2:237717508-237717530 CCGGCAAAGCAAGAGAGCCCAGG - Intronic
948835394 2:240623896-240623918 CAGGCCACGTCAGGGAGGCCAGG + Intronic
1174646338 20:52089094-52089116 CCTGGTAAGTTAGAGATGCCAGG + Intronic
1176173230 20:63705812-63705834 CTGGCCAAGTCAGAGAGGTCAGG - Intronic
1178311815 21:31536081-31536103 GCGGCACAGGCAGAGAGGCCGGG + Intronic
1179832893 21:44009369-44009391 CCTGCCAAGTAAGAGGGGCCTGG - Intergenic
1180434846 22:15290459-15290481 CCGGCTACTTCAAAGAGGACGGG - Intergenic
1185018019 22:48356994-48357016 CCGGCTAAGTCACTGATGCATGG + Intergenic
949151999 3:780294-780316 CCCTCTAAGCCAGAGAAGCCAGG + Intergenic
949260519 3:2098912-2098934 CCGGCACAGTCCGAGGGGCCCGG - Intronic
950662777 3:14477025-14477047 CAGGCACAGTCAGGGAGGCCAGG + Intronic
951411837 3:22375345-22375367 CCTGCTCAGTCTGAGAGGGCAGG + Intergenic
952954543 3:38549037-38549059 CGGGCTGAGCCAGAGAGGCTGGG + Exonic
955460037 3:59171946-59171968 CCGGCTAAAGCAGAGTAGCCAGG - Intergenic
961435304 3:126912650-126912672 CCGGGGGAGTCAGGGAGGCCTGG - Intronic
974724313 4:65778576-65778598 CAGGCAAAGAGAGAGAGGCCTGG - Intergenic
975607957 4:76174656-76174678 CCGGCAAAGCCAGGGAAGCCAGG + Intronic
981818794 4:148862408-148862430 TCAGCTAAGCAAGAGAGGCCTGG + Intergenic
985953237 5:3239091-3239113 CTGGCTGACTCAGAGATGCCTGG + Intergenic
997529535 5:134573388-134573410 CCGGCTGAGCCAGAGCAGCCAGG - Intronic
1002779931 6:358168-358190 CAGGCTAAGGCAGAAAGGTCCGG - Intergenic
1003371747 6:5534526-5534548 CAGGCTAAGTGAAAGAAGCCAGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007476460 6:42122856-42122878 CCCTCTGAGTCAGACAGGCCTGG - Intronic
1007727746 6:43926883-43926905 CCGCCTGAGTCAGAGAAGCCGGG + Intergenic
1013301511 6:108808911-108808933 TGGGCTCCGTCAGAGAGGCCTGG + Intergenic
1015204462 6:130619005-130619027 CCTGCTAAATCAGGGAGGTCTGG - Intergenic
1018762431 6:166903844-166903866 CCGGCCAGGTCAGAGGTGCCAGG - Intronic
1019656172 7:2197302-2197324 CCGGCTAGATCTGAGAGGACTGG + Intronic
1022505830 7:30908224-30908246 CCTGCTAAGTCAGGAAGTCCTGG + Intergenic
1023751462 7:43377089-43377111 TCGGACAAGTCAGAGATGCCTGG + Intronic
1024300668 7:47885143-47885165 CCAGCCAAGTCTGGGAGGCCTGG + Intronic
1029849200 7:103445536-103445558 CCGGATAAGTCAGAGACCCGGGG + Intronic
1034361594 7:150504307-150504329 CCTGCAGAGTCAGAGAGACCTGG + Intergenic
1037710478 8:21351400-21351422 TCGGCAATGTCAGAGGGGCCAGG - Intergenic
1041143526 8:54847106-54847128 CAGGTCAAGTCAGAGACGCCAGG + Intergenic
1046530250 8:115436309-115436331 CAGTCTCAGTCAGACAGGCCCGG + Intronic
1047745254 8:127840109-127840131 AAGGTGAAGTCAGAGAGGCCGGG + Intergenic
1049324833 8:142016461-142016483 CTGGTGTAGTCAGAGAGGCCTGG - Intergenic
1049359241 8:142204137-142204159 CTGGCGGATTCAGAGAGGCCAGG + Intergenic
1055731044 9:79279612-79279634 CCTCCTAAGTCAGAGAGCACAGG + Intergenic
1057006571 9:91566033-91566055 CCGGGTAAGGCAGAGAAGCATGG - Intronic
1057266073 9:93619098-93619120 CCGCCTGAGCCAGTGAGGCCTGG - Intronic
1058425007 9:104868789-104868811 CCGGCTTGGTCCCAGAGGCCTGG - Intronic
1060151562 9:121292228-121292250 CAGGCAAAGTCAGAGAGGAGGGG + Intronic
1061056748 9:128226881-128226903 CAGGCTAAATCAGAGGTGCCAGG + Intronic
1062127805 9:134873526-134873548 CAGGCCCACTCAGAGAGGCCAGG + Intergenic
1062205556 9:135334923-135334945 GCGGCAAAGTCAGAGTGGCAGGG + Intergenic
1062245520 9:135564023-135564045 CCGGCTGAGGGGGAGAGGCCAGG - Intronic
1062464697 9:136675827-136675849 CCAGCTAAGGCCGTGAGGCCTGG - Intronic
1186626277 X:11297018-11297040 CAGACTGAGTCAGAGTGGCCAGG - Intronic
1186721700 X:12311220-12311242 CCTGCCAAGTCAGATAGCCCTGG - Intronic
1187947552 X:24441238-24441260 TAGGCTAAGTGAAAGAGGCCAGG - Intergenic
1200231301 X:154445075-154445097 CCGGCTCAGACAGTGCGGCCAGG - Intronic