ID: 900996586

View in Genome Browser
Species Human (GRCh38)
Location 1:6126389-6126411
Sequence GGTGGGGCAGGATTCTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 2, 1: 0, 2: 4, 3: 13, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900996586_900996590 -10 Left 900996586 1:6126389-6126411 CCCTGACAGAATCCTGCCCCACC 0: 2
1: 0
2: 4
3: 13
4: 214
Right 900996590 1:6126402-6126424 CTGCCCCACCCTCCGCCTCTGGG 0: 2
1: 1
2: 4
3: 66
4: 619
900996586_900996594 -5 Left 900996586 1:6126389-6126411 CCCTGACAGAATCCTGCCCCACC 0: 2
1: 0
2: 4
3: 13
4: 214
Right 900996594 1:6126407-6126429 CCACCCTCCGCCTCTGGGTATGG 0: 1
1: 2
2: 1
3: 17
4: 163
900996586_900996600 13 Left 900996586 1:6126389-6126411 CCCTGACAGAATCCTGCCCCACC 0: 2
1: 0
2: 4
3: 13
4: 214
Right 900996600 1:6126425-6126447 TATGGGACACCCATCCCTCCTGG 0: 2
1: 0
2: 2
3: 9
4: 109
900996586_900996595 -4 Left 900996586 1:6126389-6126411 CCCTGACAGAATCCTGCCCCACC 0: 2
1: 0
2: 4
3: 13
4: 214
Right 900996595 1:6126408-6126430 CACCCTCCGCCTCTGGGTATGGG 0: 1
1: 1
2: 2
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900996586 Original CRISPR GGTGGGGCAGGATTCTGTCA GGG (reversed) Intronic
900607896 1:3531865-3531887 GGTGGGGCTGAACTCTGACAAGG + Intronic
900996549 1:6126276-6126298 GGTGGGGCAGGATTCTGTTGGGG - Intronic
900996586 1:6126389-6126411 GGTGGGGCAGGATTCTGTCAGGG - Intronic
900996622 1:6126502-6126524 GGTGGGGCAGGATTCTGTCAGGG - Intronic
902583847 1:17426122-17426144 GGAGGGGTAGGTTACTGTCAGGG - Intronic
902869655 1:19306411-19306433 GATGGGGCAGGATTCCCTCCTGG + Intronic
904373229 1:30063956-30063978 TGTGGTGCAGGATGCTGTCCAGG - Intergenic
904888482 1:33760159-33760181 GGTGTGGCAAGAATCAGTCATGG - Intronic
908390725 1:63681196-63681218 AGTGTGCCAGGATTCTGCCATGG + Intergenic
913490299 1:119373610-119373632 GGTGGGGCATGTTTATGTTAAGG - Intronic
915621973 1:157091685-157091707 GGAGGAGGAGGATGCTGTCAGGG - Intergenic
916716889 1:167454438-167454460 TGTGCGGCAAGATTCTGGCAGGG + Intronic
916745829 1:167684174-167684196 GGTGGGGACAGATTCTGTCCAGG - Intronic
918106535 1:181420063-181420085 GGAGGAGCAAGATGCTGTCAGGG - Intronic
920510911 1:206551447-206551469 AGTGTGGCAGGAGTCTGTGAAGG - Intronic
921063893 1:211609282-211609304 GGTGTGGCGGGCTTCAGTCAAGG - Intergenic
923041549 1:230323398-230323420 GGGGGCGCAGGACTCGGTCAAGG - Exonic
1065320372 10:24503441-24503463 GGTTGGGCTGGGTTGTGTCAGGG + Intronic
1065422266 10:25558454-25558476 GGAGGGGCAGGTTTCTTTAAAGG + Intronic
1066642051 10:37564053-37564075 TGTGGGACAGCATACTGTCAAGG - Intergenic
1067726292 10:48773802-48773824 GGTGGGGCCTGTATCTGTCAAGG + Intronic
1068609732 10:59045861-59045883 TTTGGGGGAGGATTCTGTGAAGG - Intergenic
1072728164 10:97827554-97827576 GGGGGGGCAGGGTGCTGGCAAGG - Intergenic
1072848153 10:98855600-98855622 GGTGGGGCAGGAAGCAGTCCTGG + Intronic
1074352760 10:112754338-112754360 GGCTGGGCAGGAGTCAGTCATGG - Intronic
1075618707 10:123910122-123910144 GGTGGGGCTGGGTTCAGTGAGGG - Intronic
1075874486 10:125795134-125795156 AGTGAGGCAGGATTCTGGTAGGG + Intronic
1076890419 10:133280672-133280694 GGTGGGGCAGGTCTGTGTCCTGG - Intronic
1076896452 10:133315123-133315145 GCTGGGGCAGGATCTTCTCAGGG - Intronic
1077108265 11:851134-851156 GGTGGGGCAGGATTCCCACCTGG + Intronic
1077502937 11:2917346-2917368 CCTGGGGCAGGAGGCTGTCATGG + Intronic
1078431142 11:11289709-11289731 GGGTGGGAAGGATTCTGTGAGGG + Intronic
1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG + Intergenic
1081721474 11:45292341-45292363 GGCTGGGCAGGATTCTATGATGG - Intergenic
1082614745 11:55344917-55344939 AGTGGGGCAAGATTGTGCCATGG + Intergenic
1083270384 11:61569316-61569338 CCTGGGTCAGGGTTCTGTCAGGG + Intronic
1083999815 11:66289909-66289931 GGTGGGGCAGGATCCTGCCCCGG + Intergenic
1084091097 11:66879803-66879825 GGGAGGGCAGGTTTCTGTGATGG + Intronic
1084835220 11:71796994-71797016 GGTTGTGCAGGACTCTGTCGTGG - Intronic
1085207755 11:74746941-74746963 TGTCTGGCAGGATTCTGTCTGGG + Intergenic
1088847191 11:113678501-113678523 GATGGGCCAGAATTCTGCCAAGG + Intergenic
1089921029 11:122209740-122209762 GGTGGTGCAGGATATTGCCATGG + Intergenic
1090866234 11:130703379-130703401 GCTGGGGAAGGATTCTCTTAAGG - Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1092407847 12:8233426-8233448 GGTTGTGCGGGACTCTGTCATGG + Intergenic
1092523310 12:9294534-9294556 TGGGGGGCAGGATTATGTCCAGG + Intergenic
1092543984 12:9437365-9437387 TGGGGGGCAGGATTATGTCCAGG - Intergenic
1092898425 12:13036014-13036036 GGGGTGGCAGGAATGTGTCAGGG + Intergenic
1094508965 12:31084685-31084707 TGGGGGGCAGGATTATGTCCAGG + Intronic
1096633841 12:52946173-52946195 GGTGGGGCAGGAATCAGACAAGG + Intronic
1098442812 12:70535958-70535980 GATGGGGCAGAATTCTATCCAGG + Intronic
1103701790 12:122851893-122851915 GCTGGGGCAGGAACCTGGCAAGG - Intronic
1103747038 12:123131973-123131995 TGTGGAGCAGGGTTCTGCCACGG - Intronic
1111245901 13:85540739-85540761 GGATGGGCAGGATTCTAACATGG + Intergenic
1111417510 13:87968293-87968315 GGTGGGGCAGAAGTGTTTCAAGG - Intergenic
1111548021 13:89769461-89769483 TCTCAGGCAGGATTCTGTCATGG - Intergenic
1112263397 13:97899489-97899511 GGTGGAGCTGGATTCTGAAAGGG - Intergenic
1112872548 13:103992868-103992890 GGAGAGGCAGCATTCTGGCATGG - Intergenic
1113548583 13:111174407-111174429 GGGTGGGCAGAAATCTGTCAAGG - Intronic
1115105187 14:29752373-29752395 AGTTGAGCAGCATTCTGTCAGGG - Intronic
1116012510 14:39367365-39367387 GGTGGGGCTGGATTTTGAAATGG + Intronic
1117175104 14:53137890-53137912 GTTGGGGGAGGAAGCTGTCAGGG + Intronic
1118319452 14:64744502-64744524 GGTGGGGCAGGAGGATGTGAGGG + Exonic
1118565198 14:67132000-67132022 AGTGGGGCAGGCTTCTGTGATGG - Intronic
1118633881 14:67729929-67729951 GACAGGGCTGGATTCTGTCATGG - Intronic
1122390027 14:101373781-101373803 GGAGGGTCAGGATTTTGCCACGG + Intergenic
1122431259 14:101647733-101647755 AGTGGGGCAGGGTTCTGGGAGGG + Intergenic
1125457116 15:39871027-39871049 TGTGGGCCAGGATTCTGTCATGG - Intronic
1126846698 15:52766834-52766856 GGGATGGCAGGATTCTGTCCTGG - Intronic
1128212085 15:65909894-65909916 GGTGGGTCAGGATTATTACAGGG - Intronic
1130820854 15:87494114-87494136 GATGGAGAAGGATTCTGTGATGG - Intergenic
1135117671 16:19737397-19737419 AGTGGGGCAGGATACTGTGAAGG - Intronic
1136277344 16:29186849-29186871 GCCGGGGCAAGTTTCTGTCAAGG + Intergenic
1138182973 16:54955351-54955373 AGTGGGGCAGAATTCTCCCATGG - Intergenic
1138509201 16:57498117-57498139 TGTGGGGCAGTGTTCTGTGAGGG + Intergenic
1140150394 16:72357582-72357604 GGAGGAGTAGAATTCTGTCATGG - Intergenic
1140685826 16:77433604-77433626 AGTGGGGCAGGATGGAGTCATGG - Intronic
1141009723 16:80386276-80386298 GGTGTGGAAGGATTCTTTCAGGG + Intergenic
1141850070 16:86639103-86639125 GGTGAGGGAGGATTCTGATATGG + Intergenic
1142081721 16:88152893-88152915 GCCGGGGCAAGTTTCTGTCAAGG + Intergenic
1142266973 16:89068458-89068480 GGTAATGCAGGATTCTGCCAAGG - Intergenic
1142769504 17:2086429-2086451 GATAGGGCAGGAACCTGTCAGGG - Intronic
1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG + Intergenic
1146270218 17:31480214-31480236 AGTGAGGCAGTAATCTGTCAAGG - Intronic
1146791548 17:35753373-35753395 GCTGGGGCTGGCTTCTCTCACGG + Intronic
1148395808 17:47307240-47307262 GGTGTGGCTGGGTTCTGTCTAGG + Intronic
1148620626 17:49032004-49032026 GGTGGGGGGGGGTTCTGTGAAGG + Intronic
1148896787 17:50843529-50843551 GGTGGGGCTGGAGTGTGACAGGG - Intergenic
1151511739 17:74564977-74564999 GTTGCTGCAGGATTCTGTCCCGG - Intergenic
1151604193 17:75125919-75125941 ACTGGGGCAGGAGTCTGCCAAGG - Intronic
1152718618 17:81911604-81911626 GAGGGGGCGGGACTCTGTCAGGG - Intergenic
1154262246 18:12846149-12846171 GGTGGTTCAGGATTCTGACATGG + Intronic
1157934811 18:51861153-51861175 GGTGGGCTAGGATTCAGTCCAGG + Intergenic
1159435290 18:68408584-68408606 GGGGGAGCAGGATGCTTTCAAGG + Intergenic
1159909216 18:74128368-74128390 GGAGGGACAGGGTTCTTTCATGG - Intronic
1160244404 18:77145529-77145551 GGTTTGGCAGGGTTCTCTCATGG + Intergenic
1160827753 19:1088645-1088667 GTGGGGGCCGGATTCTGGCAGGG + Exonic
1161152291 19:2716265-2716287 GGTGGGGCAGACCTCTGTCCGGG + Exonic
1161478343 19:4498483-4498505 GGTGGGCCAGGAGTCTGTTCCGG + Intronic
1161711972 19:5853866-5853888 GGTGGGGGAGGGCTGTGTCACGG - Intergenic
1163530797 19:17847852-17847874 GCTGGGGCAGGGTGCTGCCAGGG - Intronic
1163910847 19:20190889-20190911 GGTGGGACATGTTTGTGTCATGG + Intronic
1163974100 19:20832129-20832151 GGTGGGACATGTTTTTGTCACGG - Intronic
1164480494 19:28607843-28607865 GGTGGAGCAGGATTCTTCCTTGG - Intergenic
1164580280 19:29430509-29430531 GGGGGAGCAGGAGTCTCTCATGG - Intergenic
1164727971 19:30479570-30479592 GGTGGGTCAGGGTGCTGTGAGGG + Intronic
1165252204 19:34548575-34548597 GGTGGGGCAGAATCATGGCATGG - Intergenic
1165268295 19:34679911-34679933 GGTGGGGCAGAATCATGGCATGG + Intronic
1165274498 19:34736158-34736180 GGTGGGGCAGAATCATGGCATGG + Intronic
1166711410 19:44939952-44939974 GGATGGACAGGATTCTGCCAAGG + Intergenic
1167856891 19:52249082-52249104 GGTGGGGCAGGTGTCAGTAAAGG + Intergenic
1168065706 19:53919139-53919161 GGTGGGGCAGCATAATGCCATGG - Intronic
925157010 2:1656688-1656710 GTGGGGGCGGGTTTCTGTCAGGG - Intronic
927526556 2:23746906-23746928 TGTGTGCCAGGTTTCTGTCATGG - Intergenic
932659357 2:73639196-73639218 CCTGTGGCAGGCTTCTGTCAGGG - Intergenic
932913461 2:75829796-75829818 GCTGGGGCAGGAGCCTGTGAAGG + Intergenic
933642895 2:84783183-84783205 GGTGGGGCAGAACTCTGTGGAGG - Intronic
935251547 2:101266265-101266287 GGTGGGGCAGGACTGTTTCTTGG + Intronic
936167139 2:110130741-110130763 TGTGGGGAAGGATTCTTTCTGGG - Intronic
937194786 2:120143625-120143647 AGTGAGGCAGGCTTCTGTCCTGG - Intronic
937231191 2:120399036-120399058 GGCCGGGCAGGGTCCTGTCAAGG - Intergenic
941840344 2:170076157-170076179 GGTGGGGCAGGATCTTGTGTTGG + Intronic
946686686 2:222278272-222278294 GGTGGGGGAGGCTTCTGGCCAGG - Intronic
948212244 2:236203413-236203435 GCTGGGGCATGAGTCTGACATGG + Intronic
948217033 2:236239653-236239675 GATGGGCCAGCATTCTATCACGG + Intronic
1169291642 20:4358320-4358342 GGTGGGGCAGAATGCAGTCAAGG + Intergenic
1169472641 20:5901444-5901466 GGTTGGGCAAGATGCTGTCAGGG + Intergenic
1171209325 20:23304754-23304776 GGGGAGGCGGGATGCTGTCAGGG - Intergenic
1173248827 20:41353952-41353974 GGTGGGGTAGGGGTCTCTCAGGG - Intronic
1174650176 20:52118262-52118284 GGTGGAGGAGGATTCTGTTTGGG + Intronic
1175101635 20:56583391-56583413 GGTGGGGCAGCAACCTGGCAGGG + Intergenic
1176243888 20:64088233-64088255 GGTGGGGCAGGATCCATGCAAGG + Intronic
1178707308 21:34886739-34886761 GGCGGGGCCGGATTCTGGAAAGG - Intronic
1179812036 21:43877948-43877970 GGTGGGGCAGGAGGCGGGCAAGG - Intronic
1180955843 22:19740857-19740879 GGAGGGGCAGGATTGGTTCAGGG - Intergenic
1180993978 22:19955429-19955451 GGGGGACCAGGATTCTGGCAGGG - Intronic
1182926744 22:34132164-34132186 GGAGGGTCAGGTTTTTGTCAGGG - Intergenic
1183033318 22:35121602-35121624 GGTGGGGGAGGATTGGGGCATGG + Intergenic
1183236418 22:36622153-36622175 GGAGGGGCAGGATTCAGACCTGG + Intronic
1183338857 22:37267084-37267106 CGTGGGGCTGGATTCTGGCCGGG - Intergenic
1183451996 22:37901491-37901513 CATGGGGCAGGATCCTGGCAGGG - Intergenic
1184987553 22:48145961-48145983 GGTGGGGGCAGATTCTGCCAAGG - Intergenic
949157599 3:847941-847963 GGTGGAGCAGGATTCTTCCTTGG - Intergenic
949863147 3:8524486-8524508 TGTGGGGCAGGCTTGTGCCAGGG + Intronic
953213654 3:40897996-40898018 GGTGGGGCAGGATTATGTGGAGG + Intergenic
953448253 3:42985757-42985779 GGAGGATCTGGATTCTGTCAAGG + Intronic
953996503 3:47523885-47523907 GGTGGGGCAGGAGGCTGGGAGGG + Intergenic
957335109 3:78818218-78818240 GCTGGGCCAGGCTTCAGTCAAGG - Intronic
959550163 3:107645827-107645849 GATGCAGCAGGATTCTGTGAAGG - Exonic
960582908 3:119295492-119295514 GGTGGGGGAGGATCCTGGCTGGG + Intronic
961465802 3:127080835-127080857 GGTGGAGCAGGATTCTGCGTTGG - Intergenic
961483001 3:127196124-127196146 TGTGGGGCAAGCATCTGTCAAGG + Intronic
961886764 3:130101913-130101935 GGTTGTGCGGGACTCTGTCATGG + Intronic
962273915 3:133998133-133998155 GAAGGGACAGGATTCTGCCATGG - Intronic
967801634 3:193668530-193668552 GGTGAGGAAGGAATCTGTCTGGG - Intronic
968548353 4:1210054-1210076 GGTGGGGCTGGCCTCTGGCAGGG - Intergenic
968995932 4:3945918-3945940 GGTTGTGCAGGACTCTGTCGTGG + Intergenic
969370496 4:6728307-6728329 GGTGGGGCAGGCTCCTCTCCAGG + Intergenic
969602061 4:8182463-8182485 GGTGGAGCTGGATGCTGTCAGGG + Intronic
969657206 4:8505188-8505210 GCTGGAGCAGGCTTCTGTCCGGG + Intergenic
971140496 4:23920256-23920278 GGTGGGACTGTATTCTGCCATGG + Intergenic
971352868 4:25868372-25868394 GGTGGGGCAGGATGCAGACCTGG - Intronic
975272244 4:72449579-72449601 GGATGGGCAGGAGTCTGTCTAGG - Intronic
978170651 4:105665855-105665877 GGTGGGGTAGGATGGTGGCAAGG - Intronic
980342280 4:131566340-131566362 GGTTGGGCAGGATAGTGTCTTGG - Intergenic
985627804 5:999028-999050 GGTGGGGAAGGGCTCTGTCTTGG - Intergenic
986850297 5:11804049-11804071 TGTGGGGCAAGACTCTGACAGGG + Intronic
987228488 5:15868349-15868371 TGTGGGTCAGAATTCTGGCATGG - Intronic
987960686 5:24804398-24804420 GGTGGGGCAAGATTCTCAGAAGG + Intergenic
988581302 5:32471202-32471224 GTTGGGGCAGGATTGTCCCATGG + Intergenic
994929237 5:106159758-106159780 GGCGGGGCAGAATTCTGCCTGGG + Intergenic
997150235 5:131485709-131485731 AGTGGGTCATGATTCTGTCCAGG + Intronic
997356710 5:133267196-133267218 GGAGGTGCAGGATTCTGGTAGGG + Intronic
1001035567 5:168293891-168293913 GGTGGGGAAGCAGTGTGTCAGGG - Intronic
1001257062 5:170192174-170192196 GGAGGAGCAGGTTTCTGGCAAGG + Intergenic
1001583532 5:172817055-172817077 AGTGAGGCAGGATTCAGACAGGG - Intergenic
1001992970 5:176133185-176133207 GGTGGAGCAGGATGCTGACGGGG + Intergenic
1004313551 6:14566441-14566463 GGAGGGGCAGGATTGGGCCAGGG - Intergenic
1004572934 6:16865518-16865540 GGTGGTGAGGGATTCTGTGAAGG - Intergenic
1005453965 6:26001030-26001052 GGAGAGACAGGATTCCGTCAAGG - Intergenic
1006912996 6:37576153-37576175 GGTGGGGCTGGAAGTTGTCAGGG - Intergenic
1007399703 6:41596856-41596878 GGGGGGGCAGCATGCTGTGAAGG + Intronic
1007781244 6:44256278-44256300 GGTGGGCAGGGATTCTGTGAAGG - Intronic
1009754658 6:67921389-67921411 GAAGGGCCAGGATTTTGTCATGG - Intergenic
1009973702 6:70651529-70651551 AGTGGGGCAGGATGTGGTCAGGG - Intergenic
1010122167 6:72388855-72388877 GGTGGGGAAGAGTTCTGTCTTGG + Intronic
1013392053 6:109695442-109695464 GGTGGAGAAGGACTCTGTGATGG + Intronic
1015851225 6:137574668-137574690 GGTGAGCCAGGGTTCTTTCAAGG + Intergenic
1015883389 6:137891869-137891891 GGTGGAGCAAGACTCTGTCTTGG - Intergenic
1017168480 6:151432819-151432841 CCTGGGGCAGGAGTCTGACAAGG + Intronic
1017524744 6:155232651-155232673 AGTGGGTCAGGATTCAGTCCAGG + Intronic
1021103784 7:16614122-16614144 GGGGAGACAGGTTTCTGTCAGGG - Intronic
1023174030 7:37418377-37418399 GGTGCTGCAGGCTGCTGTCAGGG - Intronic
1023396723 7:39758401-39758423 GGTGTGGCTGGCTTCGGTCAGGG + Intergenic
1026940201 7:74283330-74283352 GGAGTGGCAGGACTCAGTCAGGG - Intergenic
1026966280 7:74442076-74442098 GGTGGGGCAGGAATCTGTCCAGG - Intergenic
1028812611 7:95104885-95104907 GGTGAGTCAGGGTTCTGCCAAGG + Intronic
1030104741 7:105977707-105977729 GGAGGGGCCAGATTCTGCCATGG - Intronic
1030783866 7:113636215-113636237 GGTGGGTCAGGATTAAGTCCAGG - Intergenic
1032023334 7:128422045-128422067 GGTAGGGTAGGATTATGTCAAGG - Intergenic
1032422451 7:131793570-131793592 GCTGGGCCAGGATTCTGGCTGGG - Intergenic
1033304638 7:140215426-140215448 GGAGGGGCAGGTTTGTGGCATGG + Intergenic
1035626856 8:1077004-1077026 GGTGGAGGAGGAGTCTGTCCCGG + Intergenic
1036984640 8:13514794-13514816 GCTAAGGCAGGATCCTGTCAAGG + Exonic
1040502072 8:48013862-48013884 GGTGGCACAGTAGTCTGTCAGGG - Intronic
1043155445 8:76772878-76772900 GGTTTGGCAGGTTTTTGTCATGG - Intronic
1046542447 8:115603946-115603968 GGATGGGCAGCAGTCTGTCAAGG - Exonic
1046967628 8:120185095-120185117 GATAGGGCAGGCATCTGTCAGGG + Intronic
1047310834 8:123690481-123690503 GGTGGGGCAGGAAGCAGACAGGG - Intronic
1050968355 9:11837326-11837348 GGTGGGAGATGATTCAGTCATGG - Intergenic
1052357766 9:27523378-27523400 GGTGGTTCTGGATTCTGTAAAGG - Intronic
1055134153 9:72807825-72807847 GGTGGAGCTGAATTCTGGCAGGG + Intronic
1055738418 9:79358591-79358613 GGAGGTGCAGGACTCTGTGATGG - Intergenic
1058204114 9:102081261-102081283 GGTGGGGAAGAATTCTAACAGGG - Intergenic
1059450853 9:114370663-114370685 GGTGAATCAGGATTCTGTGAAGG + Intronic
1060055202 9:120407207-120407229 GAAGGGGCAGGATCCTTTCAGGG - Exonic
1060524705 9:124313946-124313968 GGCGAGGCAGGACTGTGTCAAGG + Exonic
1062236696 9:135513679-135513701 CGTGGGGCAGGCTTCCGTGATGG + Intergenic
1062612187 9:137380323-137380345 GGTGGGGGGGGATACTGGCAGGG - Intronic
1062619641 9:137414307-137414329 AGTGGGGCAGGACTCAGCCACGG - Intronic
1185559143 X:1045276-1045298 GTTGGGGCAGGATCCTGTAAAGG - Intergenic
1187746584 X:22415832-22415854 GGTGGGGCAGGTTTTTGTAGTGG + Intergenic
1188669653 X:32867997-32868019 GCTGGTGCAGGATTCACTCACGG - Intronic
1189465853 X:41277006-41277028 GGTGGGGCAGGGCGCTTTCAGGG - Intergenic
1192427762 X:71092540-71092562 GGTGGGGCAGGCACCTGTCCTGG - Intergenic
1196000710 X:110782408-110782430 GGAGAGGCAGAATTCTGTAAAGG - Intronic
1196125322 X:112092671-112092693 GGTGGGAGATGATTCAGTCATGG + Intergenic
1196470602 X:116020388-116020410 GGTGAGGCAGGATTTATTCATGG + Intergenic
1197036120 X:121876148-121876170 GGTGTGGCAGTATTCTGTCAAGG - Intergenic
1197149192 X:123201869-123201891 GTCGGGGGAGGATTCAGTCAGGG + Intronic
1199099168 X:143778967-143778989 GGAGGGGCAGGGATCTGTCAAGG + Intergenic
1200119754 X:153784678-153784700 GGTGGGGCAGGAGTCCGTGGGGG + Intronic
1200894873 Y:8364661-8364683 GGTGGAGCATGATTTTGTCTGGG - Intergenic