ID: 900996665

View in Genome Browser
Species Human (GRCh38)
Location 1:6126650-6126672
Sequence CCTCCTGCTGCTGCTCATAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900996659_900996665 1 Left 900996659 1:6126626-6126648 CCTTGCCCAGGTTGCGGGCCAGG 0: 1
1: 0
2: 1
3: 27
4: 245
Right 900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG 0: 1
1: 0
2: 1
3: 41
4: 335
900996658_900996665 2 Left 900996658 1:6126625-6126647 CCCTTGCCCAGGTTGCGGGCCAG 0: 1
1: 0
2: 0
3: 14
4: 298
Right 900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG 0: 1
1: 0
2: 1
3: 41
4: 335
900996661_900996665 -4 Left 900996661 1:6126631-6126653 CCCAGGTTGCGGGCCAGGTCCTC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG 0: 1
1: 0
2: 1
3: 41
4: 335
900996654_900996665 22 Left 900996654 1:6126605-6126627 CCTGCTTGCGGATGCGCTTGCCC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG 0: 1
1: 0
2: 1
3: 41
4: 335
900996662_900996665 -5 Left 900996662 1:6126632-6126654 CCAGGTTGCGGGCCAGGTCCTCC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG 0: 1
1: 0
2: 1
3: 41
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900996665 Original CRISPR CCTCCTGCTGCTGCTCATAG TGG Exonic
900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG + Exonic
901604736 1:10450244-10450266 CCTGCTGCTGCTGCTCTCCGGGG + Exonic
903786387 1:25863905-25863927 CCCCCAGCTGCTGCTCGTGGGGG - Intronic
905534399 1:38708956-38708978 GCTGCTGCTGCTGCTCAGCGCGG + Intergenic
906041723 1:42793022-42793044 GCTGCTGCTGCTGCTCTCAGCGG - Intronic
906052713 1:42888034-42888056 CTTCCTGCTGCTGCTGCTCGTGG - Intergenic
906145893 1:43560511-43560533 ACTCCTGCTGCTGCCCACACAGG - Intronic
906237852 1:44222592-44222614 CCTCCTGCTGCTGGTGGTGGTGG - Intronic
906749048 1:48242492-48242514 CCTCCTTCTCCAGCTCAGAGAGG - Exonic
907299889 1:53480314-53480336 CTGAGTGCTGCTGCTCATAGAGG + Intergenic
907462706 1:54614788-54614810 CCTCCTGCGGCAGCTGACAGAGG - Exonic
907476139 1:54706854-54706876 CCTCCTGCTGCTGTCAATGGGGG - Intronic
908041322 1:60116730-60116752 TCTCCTGCTGCTGCACAATGGGG - Intergenic
910193496 1:84618536-84618558 CTCCCTGCTGCTGATCATACTGG + Intergenic
912146704 1:106803090-106803112 ATTACTGCTCCTGCTCATAGGGG + Intergenic
915591486 1:156873603-156873625 CCTCCTGCTGTTGCTCTTTCTGG + Intronic
916661918 1:166930124-166930146 CCTCCAGCTGCTTCTCAGGGTGG - Intronic
917500545 1:175581152-175581174 ACTGCTGCTGCTGCCCACAGTGG + Intronic
917835997 1:178942022-178942044 CCTCCAGCTGTTGCTCATGGTGG - Intergenic
918082450 1:181218030-181218052 TCTGCTGCTGCTCCTCATACAGG - Intergenic
920114576 1:203611148-203611170 CCCCCTGCTGCTTCTCTTAATGG + Intergenic
921049948 1:211504209-211504231 CTTCCTGCTGCCTCTCCTAGAGG - Intergenic
921764428 1:218953500-218953522 CCTCCTGCTGCTGCTGCTGCTGG - Intergenic
922477359 1:225915823-225915845 CCTTCTGCTGCAGCACAGAGAGG - Intronic
922709382 1:227815767-227815789 CCTTCTGCTGCTGCTCCTGGTGG + Exonic
922802981 1:228372474-228372496 CCTCCTGCTGCTCCTCCGACTGG - Exonic
923119693 1:230978731-230978753 CCTGCTGCTGCTGCTGCTGGGGG - Exonic
923400836 1:233614378-233614400 GCTCCAGCTGCTGCTCAGACAGG - Exonic
923557213 1:235010459-235010481 CCTCCTGCTGATGGTCTCAGCGG - Intergenic
923883530 1:238130121-238130143 CCTTGTGCTGCTTCTCCTAGAGG + Intergenic
924271546 1:242338580-242338602 GCTTCTGCTGCTTCTCAGAGTGG + Intronic
924883402 1:248187750-248187772 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883414 1:248187815-248187837 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883426 1:248187880-248187902 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883438 1:248187945-248187967 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883451 1:248188010-248188032 CATCCTGCTTCCGCTCAGAGAGG - Intergenic
924883464 1:248188075-248188097 CATCCTGCTTCCGCTCAGAGAGG - Intergenic
924883478 1:248188141-248188163 CATCCTGCTTCCGCTCAGAGAGG - Intergenic
924883490 1:248188206-248188228 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883502 1:248188271-248188293 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883513 1:248188336-248188358 CCTCCTGCTTCTGCTCAGAGAGG - Intergenic
924883526 1:248188401-248188423 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883538 1:248188466-248188488 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883550 1:248188531-248188553 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883562 1:248188596-248188618 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883574 1:248188661-248188683 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
924883586 1:248188726-248188748 CATCCTGTTTCTGCTCAGAGAGG - Intergenic
924883598 1:248188791-248188813 CATCCTGCTTCTGCTCAGAGAGG - Intergenic
1063018713 10:2104694-2104716 CCTCATCCTGTTGCTCAAAGTGG - Intergenic
1063352999 10:5373747-5373769 GCTCCTGCTGCTGCTCCTGGGGG + Exonic
1063386216 10:5617748-5617770 CCTCCTGCTGCTGTTCTGCGTGG - Intergenic
1064288502 10:14013042-14013064 CCTTCTGCTGGGGCTCATGGTGG - Intronic
1064826683 10:19411316-19411338 GCTGCTGCTGCTGCTGCTAGTGG - Intronic
1064983202 10:21184599-21184621 CCTGCTGCTGCTGCTGCTAGGGG + Intergenic
1066713122 10:38257549-38257571 GCTTCTGCTGCTTCTCAGAGTGG - Intergenic
1067044866 10:42979895-42979917 CCTCATGCTGCTTCTCACACTGG - Intergenic
1067157808 10:43796951-43796973 CTTCCTGCTGCAGCTCACAGGGG + Intergenic
1067712121 10:48657685-48657707 CCTTCTGCTGCTGCTAATGATGG - Intergenic
1067897148 10:50195462-50195484 CCTCTTGCTGCTTTTCATAATGG - Intronic
1067951820 10:50746573-50746595 CCTCTTGCTGCTTTTCATAATGG + Intronic
1070436465 10:76398410-76398432 CCTCCTGTTGCTTTGCATAGAGG + Intronic
1071501626 10:86208210-86208232 CTTCCTGCTGGTGCTCATGCAGG - Intronic
1072255183 10:93614256-93614278 CCTCCTGAAGCTGATTATAGGGG + Intronic
1072414249 10:95233609-95233631 CCACCATCTGCTGCTCATACGGG + Intergenic
1073167947 10:101474442-101474464 ATTCCAGCTGCTGCTCATGGGGG - Intronic
1073428969 10:103473665-103473687 CACCCTGCTGCTGATCATCGCGG - Exonic
1074191997 10:111146192-111146214 CCTCCTGCTGCTGTTCAGGAAGG + Intergenic
1074431283 10:113397094-113397116 CCTCCTGTTCCTTCTCAGAGCGG + Intergenic
1074768315 10:116716661-116716683 TCTTCGGCTGCTGCTCTTAGAGG + Intronic
1074833014 10:117263159-117263181 CCTCCTGCTGGTGCTGACACAGG - Intronic
1075049967 10:119176234-119176256 CCTCCTGTTTCTGTTCATGGCGG - Intronic
1075865331 10:125713973-125713995 CATGCTGCTGGAGCTCATAGTGG - Intergenic
1076555854 10:131321037-131321059 ACCCCTGCTGCTGCTCCGAGGGG + Intergenic
1076890119 10:133279231-133279253 CCTCCTGCTGCTGCTCCAACTGG - Exonic
1077063342 11:627101-627123 GCTGCTGCTGCTGCTCCTCGGGG - Exonic
1077106930 11:846206-846228 CCTGCTGCTGGGGCTCAGAGAGG + Intronic
1077407952 11:2391062-2391084 ACTCCTGCTCCTGCTCCTGGGGG - Intronic
1077798402 11:5514948-5514970 CCTCCAGCTGCTGGCCACAGAGG - Exonic
1078759151 11:14237853-14237875 CCTACTTCTGCTGCTCTTAAGGG - Intronic
1078852301 11:15175903-15175925 CCTGCAGCTGCTGCTCAAACGGG + Exonic
1079076195 11:17386795-17386817 CCTCCCCCTGCTGCTCATCCAGG - Exonic
1079108009 11:17586311-17586333 CATCCTGCTGCTGCTCAGTGAGG - Intronic
1080893285 11:36427893-36427915 CCTGCCACTGCAGCTCATAGTGG + Intronic
1081977586 11:47245521-47245543 CGTTCTGCAGCTGCTCATAACGG + Exonic
1083395868 11:62391509-62391531 CCTCCAGCTCCTGCTCAAAAAGG - Exonic
1083686959 11:64382326-64382348 CCTCCTGCTGCAGCCCAGTGGGG + Intergenic
1084936524 11:72589969-72589991 TCTCCTGCTGCAGCTGAGAGAGG + Exonic
1086964803 11:93016788-93016810 CCTCCTGCTGCTTCACAATGTGG + Intergenic
1087159278 11:94933376-94933398 CAAACTGCTGCTGCTCAGAGTGG + Intergenic
1089528711 11:119113100-119113122 CCTCCTGCCCCTCCTCATACAGG + Intronic
1090067761 11:123518181-123518203 CCTTCTGCTGCTGCACTTAACGG - Intergenic
1090357587 11:126150372-126150394 TCTCCAGCTGCTGCTGGTAGAGG - Intergenic
1090725786 11:129526239-129526261 CCTCTTGCTGCTTTTCCTAGAGG - Intergenic
1090848159 11:130547284-130547306 CCTCCTGTTCCTGCTGATGGTGG + Intergenic
1090896494 11:130980683-130980705 CCTGCTGCTGCTGTTCATGCTGG - Intergenic
1090938389 11:131365668-131365690 CCTCCTCCTCCTCCTCATGGTGG + Intergenic
1091139654 11:133224122-133224144 CCTCCAGCAGCTGCTCATTTTGG + Intronic
1091194492 11:133719729-133719751 CCTGATGCTCCTGCTCACAGGGG + Intergenic
1091406713 12:213861-213883 TCTCCAACTGCTGCTCAGAGGGG - Intronic
1091704912 12:2687206-2687228 CCTCCTGCCCCTGCCCATGGTGG - Intronic
1092201081 12:6583276-6583298 CTTCTTGCTGCTGCTCATAATGG + Exonic
1092764353 12:11839255-11839277 TCTCCTGCTGCTGACCAAAGAGG + Exonic
1094124950 12:27014138-27014160 CCTGCAGCTGCTGGTCGTAGCGG - Exonic
1094454007 12:30611966-30611988 CCTCCTCCTCCTCCTCATCGTGG - Intergenic
1096094494 12:48925368-48925390 GCTGCTGCTGCTGCTCAGTGCGG - Exonic
1096257824 12:50073668-50073690 TGTCCTGCTGCTGCTGATGGTGG - Intronic
1096486485 12:51985414-51985436 CCTCCTTCTCCTGCGCATATGGG - Intronic
1097890359 12:64771610-64771632 CCTCCTTCAGCTGGTCATACAGG - Intergenic
1099213774 12:79828384-79828406 CTTCATGCTGCAGCTCATTGGGG - Exonic
1099977141 12:89557889-89557911 CCTCCCTCTGCTCCTCATGGTGG - Intergenic
1100449923 12:94696059-94696081 CCCCCTGCTGCTGCTCCTCAGGG - Intergenic
1101734771 12:107454686-107454708 CCTCCTGCTGCTGCCCAGGAAGG - Intronic
1101880816 12:108624271-108624293 CCTCCTGTTGCTGATCCTACTGG - Exonic
1103561938 12:121797410-121797432 CCTCCTGCTGCTGTTCCTGCTGG - Intronic
1105070913 12:133234125-133234147 CCGCCTGCTGCTGCTCCTGCTGG + Exonic
1105978529 13:25495155-25495177 CCTCCTGCTGCTGCCCTTCCAGG + Intronic
1107065725 13:36213034-36213056 CCTGCAGCTGCTGCTGATTGTGG - Intronic
1107382835 13:39875701-39875723 CCTCCTGCTGCCGCACAGTGCGG + Intergenic
1108674213 13:52722300-52722322 CCGCCTGCAGCTGCTCCTATGGG + Intronic
1109483241 13:62984615-62984637 CCTCAGGCTGCTGCTCAAGGAGG - Intergenic
1111599911 13:90459491-90459513 CTTCCTCCTGTTGCTCATATGGG - Intergenic
1113414607 13:110118326-110118348 CTTCCTGCTGGAGCTCGTAGGGG + Intergenic
1113981680 13:114281741-114281763 CCTCCTGCTGCTGCGAGTCGCGG - Exonic
1114578066 14:23731189-23731211 CCTCTTTCTGCTGGACATAGGGG + Intergenic
1116904006 14:50387830-50387852 CATCCTGCTTTTGCTAATAGGGG - Intronic
1118258449 14:64225394-64225416 CCTCCTGCTGCTGCTGCTCCTGG + Exonic
1119485177 14:74982163-74982185 CGTCCTGCTGCTTCTCCCAGGGG - Intergenic
1120025599 14:79580754-79580776 TCTCCTGATGCTGTTCAAAGTGG + Intronic
1121562733 14:94886947-94886969 CCTCACGCTGCTGCTCACTGTGG - Intergenic
1121640311 14:95480899-95480921 CCTTCTGCTGCTGCTGAGATGGG - Intergenic
1122325410 14:100878563-100878585 CCTCCTGCTCCTACCCATCGTGG - Intergenic
1124221504 15:27853794-27853816 CCTCCTGCTGCTCTTTAGAGTGG - Intronic
1124746511 15:32345541-32345563 GCCCCTCCTGGTGCTCATAGTGG + Intergenic
1124929122 15:34101785-34101807 CCTGCTGCTGCTGCTGCTATCGG - Exonic
1128474720 15:67987597-67987619 CTTCCTGGTGCAGCTCATACTGG - Intergenic
1128807816 15:70545747-70545769 CCTCCCACTCCTTCTCATAGGGG - Intergenic
1131653192 15:94424532-94424554 CCTCCAGGTGCTTCTCATACAGG + Intronic
1132579167 16:677300-677322 CCTCCTGCAGCTGATGATCGGGG + Exonic
1132615855 16:840812-840834 CCTGCTGCAGCTCCGCATAGGGG + Intergenic
1132627304 16:897593-897615 ACCCCTGCAGCTGCTCACAGGGG - Intronic
1132769128 16:1551317-1551339 CCTCCTGCTGCTGATCCTTCGGG - Intronic
1135269522 16:21057033-21057055 CCTCCTGTTACTCCTCTTAGAGG - Intronic
1136121123 16:28135290-28135312 CCTGGTGCTCCTGCTCACAGAGG - Exonic
1136247829 16:28985453-28985475 GCTCCTGCTGCTGCCCATCCTGG + Exonic
1137036782 16:35575042-35575064 CGTGCTGATGCTGCTGATAGTGG + Intergenic
1137790667 16:51172073-51172095 CGCCCTCCTGCTGCTCATAGTGG - Intergenic
1137981290 16:53072216-53072238 CCTCCAGCTGCTGCTCCTGCAGG + Intronic
1138116899 16:54368150-54368172 ACTGCTGCTGCTGGTTATAGGGG - Intergenic
1138530825 16:57633512-57633534 CCTCGTGCTGCCTCTCCTAGGGG - Intronic
1138789117 16:59881475-59881497 CCTTCTTCTGGTGCTCATCGTGG + Intergenic
1139044769 16:63043353-63043375 ACTCCTACTGCTTTTCATAGTGG + Intergenic
1140354859 16:74296950-74296972 CCCCCTGGTGCTGCTCAGTGTGG + Exonic
1142520333 17:500068-500090 CCACCTGCTGCTGCGGAAAGGGG + Intergenic
1142613394 17:1121507-1121529 CTTCCTGCAGCTGCTCACAGTGG + Intronic
1142613763 17:1123651-1123673 CTTCCTGCAGCTGCTCACAGTGG + Intronic
1142993208 17:3745769-3745791 CCTCCTGCTCATGCCCACAGAGG - Exonic
1143436917 17:6935821-6935843 CTTGCTGCTGCTGCACACAGCGG + Intronic
1144714474 17:17424480-17424502 CCTCCTGCTGCCATTCATGGTGG - Intergenic
1145242908 17:21250068-21250090 CCTCTAGCTGCTGCTCTAAGGGG - Intronic
1145933135 17:28700179-28700201 GGTCCTGCTGCTGCTGCTAGGGG - Exonic
1146476041 17:33163482-33163504 CCTCCTGCCACTGCTGATGGGGG + Intronic
1147267590 17:39244272-39244294 CCTCCTCCTGCTGCTCCTCCTGG + Intergenic
1147381330 17:40057975-40057997 CATCCACCTGCTGCCCATAGTGG - Intronic
1149289803 17:55207030-55207052 CCTCCTGCAACTTCTCACAGTGG + Intergenic
1149344274 17:55718416-55718438 CCTCCAACTGCTGCTTACAGTGG + Intergenic
1149493988 17:57105569-57105591 CCTCCACCTGCTGCTCATCATGG - Exonic
1150588095 17:66536596-66536618 CCCCCTTCTGCAGCTCAGAGGGG - Intronic
1151165814 17:72202846-72202868 CCTGCTGCTGCTGCTGCTGGTGG + Intergenic
1151434990 17:74089636-74089658 CCTCCAGCTGCTCCTCTTAGGGG + Intergenic
1151562530 17:74878258-74878280 CCTCCTGCTGCTGCTGGTCCAGG - Exonic
1151563433 17:74883287-74883309 GCACGTGCTGCTGCTCAGAGCGG - Intronic
1151975680 17:77482516-77482538 CCTCCAGCGGCTCCTCAGAGGGG + Intronic
1152060256 17:78067874-78067896 CCTCCTCCTGCAGCTCCTGGGGG + Exonic
1152068637 17:78124613-78124635 CCTCCTGCTGCTGCTGCTGGTGG - Exonic
1155402831 18:25457741-25457763 TGTCCTACTGCTGCTCAGAGTGG + Intergenic
1157283305 18:46360265-46360287 ACTCCTGCTGCTGGGCACAGAGG + Intronic
1157635757 18:49152554-49152576 CCTCCTGCTGCTTTTCATAATGG - Intronic
1158623465 18:59051883-59051905 CCTCCCTCTGCTGTTCACAGCGG - Intergenic
1159070779 18:63621615-63621637 GCTGCTGCTGCTGCTAATGGTGG - Intergenic
1159402920 18:67960338-67960360 GCTGCTGCTGCTGCTGATGGTGG + Intergenic
1160619078 18:80157943-80157965 CCTCCCGCTGCTTCTCCTTGTGG - Exonic
1161723943 19:5917893-5917915 CCTCCTGCTCCTGCTCCACGCGG + Exonic
1162361732 19:10224446-10224468 CCGCATGCTTCTGCTCATCGGGG - Exonic
1162395975 19:10418323-10418345 CCTCCTGCTGATTCTCATCTGGG + Intronic
1162548018 19:11342734-11342756 CCTCCCCCTGCTTCTCATGGGGG + Intronic
1162700052 19:12507670-12507692 ATTACTGCTCCTGCTCATAGTGG - Intronic
1162943456 19:14028216-14028238 CATGCTGCTGCTGCTCCTGGCGG + Exonic
1163013533 19:14440308-14440330 CCTCCAGCTCCTGCTCCGAGGGG - Exonic
1163118277 19:15200803-15200825 GCCCCTGCTGCTGCTGCTAGCGG - Exonic
1163500228 19:17671884-17671906 CTTCCTGCTGCTGCCCATCTGGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1165810651 19:38609813-38609835 CTTCCTGCTGCCTCTCTTAGGGG - Intronic
1166775847 19:45311990-45312012 TCCCCTGCTGCTGCTCCTAACGG + Intronic
1167341425 19:48918745-48918767 CCTCCAGCTCCTGCTCATCCAGG - Exonic
1167468393 19:49662324-49662346 GCTGCTGCCGCTGCTCAGAGTGG - Exonic
1168660885 19:58165244-58165266 CCTCCTTCTGCTTCTCTAAGTGG - Intergenic
1168689563 19:58368606-58368628 CCGCCTGCTGCTGCTGGTTGGGG + Exonic
925024014 2:593852-593874 CCTCCTGCTCCTGCTCCTGTAGG - Intergenic
925858912 2:8156416-8156438 CCTCCAGGTGCTGCTGATGGTGG - Intergenic
926039044 2:9658027-9658049 CCTCCACCTTCTGCTCACAGAGG + Intergenic
926471438 2:13264234-13264256 TCTTCTGCTTCTGCTCATAAAGG - Intergenic
927051266 2:19331651-19331673 CCCCCTGCTGCTGCCAATAAGGG + Intergenic
928196594 2:29220750-29220772 CATCCTGCTGGAGCTCATGGCGG - Exonic
931054995 2:58459719-58459741 CCACCTGCTGCTGTTCTTATAGG - Intergenic
931835319 2:66092888-66092910 CTTGCTGCTGCTGCTGACAGGGG + Intergenic
934553882 2:95277470-95277492 CCTCCTGCAGCAGCTCAAGGAGG - Exonic
935271984 2:101442840-101442862 CCTCCTACTGATGCTCCTGGCGG + Intronic
935830990 2:107000393-107000415 GCTCCTGCTGGTGCCCAGAGTGG + Intergenic
936053721 2:109244793-109244815 CCTCCTGCTGCTGGCCTTGGAGG + Intronic
937100368 2:119263871-119263893 CCTCCTGCTGCTGCCCCAGGTGG - Exonic
937365289 2:121256976-121256998 CCTCCTGCTGAAGCTCTTACTGG - Intronic
940288624 2:152056533-152056555 CTTCCTTCTGCTGCTCACACGGG + Intronic
940848015 2:158661903-158661925 CCTCCTGCTGCTGCTGCCTGTGG + Intronic
943721103 2:191204411-191204433 TCTCATTCTGCTGCTCCTAGGGG - Intergenic
944654667 2:201865567-201865589 CATCCTGATGATGCTCAAAGGGG + Intronic
944811144 2:203328481-203328503 CCTCCTCCTCCTCCTCATACAGG - Exonic
945225768 2:207530132-207530154 CCTCCTCCTGCTCCTCTTACCGG - Exonic
946050331 2:216856861-216856883 TCTCCTGCTGCTGCTCTCATTGG - Intergenic
947156229 2:227164771-227164793 GCTCCTGCTGGTGCTCCTGGCGG + Exonic
947399050 2:229714345-229714367 GCTGCTGCTGCTGCTCGGAGCGG - Exonic
947736681 2:232458864-232458886 CCGCCTGCTGCTGGTAATCGGGG - Exonic
948174700 2:235934102-235934124 GCTGCTGCTGCTGCTCCTGGAGG - Intronic
948630738 2:239301046-239301068 CCTGCTGCTGCTGCTCAGCCGGG + Intronic
948752622 2:240141303-240141325 CCTCCTGGTCCTGCTCCTTGGGG + Intronic
1169207891 20:3750209-3750231 CCACCTGCTCCTGCGCAGAGCGG - Exonic
1169217506 20:3802067-3802089 CCTCCTGCTGCTCCTCAGGAGGG - Exonic
1170506528 20:17031323-17031345 CCTACTGCTGCTGGTCTTTGAGG - Intergenic
1170577157 20:17672969-17672991 CTTCCAGCTGCTGCCCATCGTGG - Intronic
1170898468 20:20437414-20437436 CCTCCTGCTGCTGGGTACAGAGG - Intronic
1172136622 20:32690671-32690693 CCTCCTGTTCCTGCTGATGGTGG + Intergenic
1172306165 20:33882310-33882332 CCTCCGGCTTCTGCTCAAACAGG + Intergenic
1173150506 20:40562897-40562919 CTCCCTGCAGCTGCTCAGAGAGG - Intergenic
1175960629 20:62634658-62634680 CCTCCTGCTGGTGGTAGTAGGGG + Intergenic
1176230997 20:64032834-64032856 CCTCCTCCTGCTGCTCCTGGGGG - Exonic
1179036591 21:37763399-37763421 CTTCCTGCTCCTGATCCTAGAGG + Intronic
1179260380 21:39752583-39752605 CCTCCTACTGTTTTTCATAGTGG + Intronic
1179261774 21:39764144-39764166 CCTCCTGGTCCTGCTTATGGAGG + Intronic
1179403642 21:41107858-41107880 CCTGCTGCTGCAGCACAGAGAGG + Intergenic
1180231665 21:46430197-46430219 CCTCCTGCTGCACCTCGCAGAGG - Exonic
1181695096 22:24588983-24589005 GCTCCTGGGGCTGCTCACAGAGG - Intronic
1182423309 22:30259000-30259022 CATCCTGCTGCCTCTCATGGTGG + Intergenic
1183456485 22:37925853-37925875 CCTCCTCCTCCTCCTCAAAGGGG - Exonic
1183857304 22:40643726-40643748 TCTGCTGCTGCTGCTGAAAGGGG + Intergenic
1184323690 22:43764605-43764627 TCTCCAACTGCTTCTCATAGTGG + Intronic
1185300502 22:50077454-50077476 CCTGCTGGAGCTGCTCATGGCGG - Exonic
950507042 3:13401413-13401435 CCTCCTGCCGCAGCCCATTGTGG - Intronic
950543270 3:13624846-13624868 CCTCCTGGTGCTGCACCTTGTGG - Intronic
950572424 3:13809662-13809684 CCTCCCCCTGCAGCTCAGAGAGG + Intergenic
950864078 3:16175199-16175221 CCTCCTGCTGCTCCTGATGCTGG + Exonic
953100493 3:39820960-39820982 CCTCAGGCTGCTGCTGATGGTGG + Intronic
953576983 3:44120759-44120781 CTTCCTGCTGCTGCTCACACAGG + Intergenic
953868410 3:46604690-46604712 CCTCTGGCTGCTTCTCATGGTGG + Intronic
956425565 3:69130988-69131010 CCTCCTGCTGCTGCTACTACTGG + Intergenic
958677079 3:97278813-97278835 CCTTCTGCTGCTGCCCATGAGGG - Intronic
959795534 3:110423690-110423712 CCTCCTGCAGCTACACATACAGG + Intergenic
961374148 3:126451396-126451418 CATGCTGCTGCTGCTCAGTGCGG - Intronic
961448697 3:126992714-126992736 CCTGCTGGTTCTGCTCATAGTGG + Intronic
961454757 3:127018395-127018417 TCTCCTGCTGCTGGTCATCGTGG + Exonic
961819736 3:129569846-129569868 CGTCCTGCTGCTGCTCTCCGTGG - Exonic
962056570 3:131878216-131878238 CCTACTGCTGATGAACATAGGGG - Intronic
962448580 3:135492172-135492194 CCTCCTGCTCCAGTTCCTAGAGG - Intergenic
963888098 3:150603368-150603390 GCTTCTGCTGCTTCTCCTAGTGG + Exonic
964634008 3:158841526-158841548 CCTCCAGCTGCTGCCCACACTGG - Intergenic
967075707 3:186000032-186000054 CCCTGTGCTGCTGCTCATGGTGG - Intergenic
967521759 3:190440364-190440386 CCTCCTGCTGCTGGTTTTGGTGG - Exonic
968137225 3:196228136-196228158 CCTGCTGATGCTGGTCATGGTGG + Exonic
968605144 4:1531913-1531935 CCTCCTCCTGCTGCCCAGGGCGG - Intergenic
969134474 4:5019400-5019422 CGTGCTGCTGCTGCTCCTGGCGG - Exonic
969179203 4:5424275-5424297 CCTCCTGCCACTGTTCATGGGGG - Intronic
969609790 4:8220513-8220535 CCCCCTGCTGCTGCTCGCACTGG - Intronic
969659959 4:8521341-8521363 CCTGCTGATGCTGCGCATGGTGG - Intergenic
971011930 4:22447926-22447948 GCTACTGCTGCTGATCATTGAGG - Intronic
972279498 4:37588445-37588467 CCTCCTGCTGCTGCGTGCAGTGG + Intronic
972518278 4:39830000-39830022 CCTCATGATACTGCTCATGGCGG - Intronic
974920334 4:68231232-68231254 CCACCTGCTGCTGATCAGAGAGG + Exonic
975131914 4:70839665-70839687 CCGCCTGCTGCTGCTGCTCGGGG - Exonic
975985960 4:80202095-80202117 CCTCCTGCTGCTGCTGCTGCTGG - Exonic
979545208 4:121932609-121932631 CCTGCAGCTCCTGCTCACAGGGG + Exonic
979677023 4:123420587-123420609 CCTCCTGATCCAGCTCTTAGTGG - Intergenic
981162999 4:141521607-141521629 CCTCCTGCTCCTGTTCACTGTGG + Intergenic
981483392 4:145260140-145260162 GCTCCAGCTGCAGCTCAAAGGGG - Intergenic
985517839 5:356259-356281 CCTCCTGCTGCGGGGCATGGAGG + Intronic
987092929 5:14523445-14523467 CCTCCTGCTGGTGCTCCCATTGG + Intronic
987805365 5:22758374-22758396 ACTGCTGCTGCTACTGATAGTGG - Intronic
991198330 5:63961083-63961105 CATCCCGCTGCTGCTCATGCTGG - Exonic
991963990 5:72072975-72072997 CTTCCTGCTGCTGCTCAGGGTGG - Intergenic
992886799 5:81167629-81167651 CTGCCTGCAGCTGCTCATGGGGG - Intronic
997732625 5:136192326-136192348 CTTCCTGCTGCTGCTCTCGGTGG - Intergenic
999098714 5:149004747-149004769 CCTCCGGGTGCTCCTCAGAGAGG - Exonic
1001169644 5:169407039-169407061 CCTCCTGATGCTACTTACAGGGG - Intergenic
1001480486 5:172085943-172085965 CCTCCTTGTGCTGCTCTTGGGGG - Intronic
1001999430 5:176189418-176189440 CCTCCTCCTGCTGCTCCTCCAGG - Intergenic
1002649744 5:180682487-180682509 CCTCCTCCTGCTGCTCCTCCAGG + Intergenic
1003023179 6:2529745-2529767 TCTCCTACAGCTGGTCATAGAGG - Intergenic
1003586457 6:7394017-7394039 CGTACAGCTGCTGCTCATACTGG + Intronic
1003617300 6:7667421-7667443 CCTCCTGCTGCTACCTACAGTGG + Intergenic
1005448451 6:25950521-25950543 GCTCATGCTGCTGCTCAGACTGG - Intergenic
1005838164 6:29723478-29723500 CCTCCTCCTGCTGCTCTCAGGGG + Exonic
1005859072 6:29887775-29887797 CCTCCTCCTGCTGCTCTCAGGGG + Intergenic
1005864230 6:29926481-29926503 CCTCCTCCTGCTGCTCTTGGGGG + Intergenic
1005905535 6:30259648-30259670 CCTCCTCCTGCTGCTCTTGGGGG + Intergenic
1006027992 6:31159481-31159503 CTTCCAACTGCTGCGCATAGGGG + Exonic
1006358761 6:33575854-33575876 CCTCCTGTTCCTGCTGATGGCGG + Exonic
1006378039 6:33682679-33682701 ACTCCTCCTGCCGCTCACAGTGG + Intronic
1006476805 6:34260849-34260871 CCTCCTGCTGCTGCTTTCACAGG + Intergenic
1006610721 6:35292762-35292784 CAAGTTGCTGCTGCTCATAGAGG - Exonic
1007257021 6:40536607-40536629 CCTCCAGCTGCACCTCCTAGTGG - Intronic
1007562291 6:42819882-42819904 GTTCCTGATGCTGCTGATAGGGG + Intronic
1008353463 6:50521217-50521239 CCTTATGCTGCTGCTCTAAGAGG + Intergenic
1011327952 6:86171879-86171901 ACTCCTAGTGCTGCTTATAGGGG - Intergenic
1013583592 6:111559464-111559486 CCTGCTGCGGCTGCTGAGAGAGG - Exonic
1014336705 6:120146831-120146853 CCTCCTGCTCCTGCTCCTGCAGG + Intergenic
1014569870 6:122996237-122996259 CCGGCTGCTGCTGCTGAAAGAGG - Exonic
1015093822 6:129390304-129390326 GATGCTGCTGCTGCTTATAGGGG + Intronic
1015137437 6:129889457-129889479 CCTCCTGCTGCTTCTCCTAATGG - Intergenic
1015601659 6:134916505-134916527 CCTCCTGCTGATGTTCAAATTGG + Intergenic
1015940035 6:138440411-138440433 CCACATGCTGCTGCTATTAGTGG - Intronic
1015977785 6:138808490-138808512 CCTCCTGCCTCTGCCCATATTGG + Intronic
1017679935 6:156853463-156853485 CCTCCAGCTACTGCTCCTACAGG - Intronic
1018858811 6:167695934-167695956 TCTCCTGTTGCTGCACACAGAGG + Intergenic
1019009520 6:168831887-168831909 CCTCCTGCTCCTGATTTTAGGGG + Intergenic
1019414713 7:921991-922013 CCTCCTGCTGCTGCTGCTTCTGG - Intronic
1020052876 7:5094074-5094096 CCTCTTTCTGCTCCTCATACTGG - Intergenic
1021038625 7:15833028-15833050 CCTCCTGCTGCTTATCTGAGAGG + Intergenic
1021510823 7:21430021-21430043 CCTGCTGCTACTGCTGATAGTGG + Exonic
1023277190 7:38532613-38532635 CCACATGCTGCTGCTGCTAGTGG + Intronic
1023877066 7:44292442-44292464 CCTGCTGCAGCTGCACACAGTGG - Intronic
1026381059 7:69799791-69799813 CCTCCTGGTGCTGTTCCTTGAGG + Intronic
1026636038 7:72082476-72082498 CCTCCTGCACCTGCTCTTTGAGG + Intronic
1027406282 7:77864719-77864741 CCTCCTGCTAGTGCTCCTATGGG + Intronic
1029580470 7:101433738-101433760 CCTCCTGTTGCTGCTCTGACAGG - Intronic
1031142851 7:117963966-117963988 TGTCCTGGTGCTGCTTATAGAGG - Intergenic
1031973763 7:128081368-128081390 CCACGGGCTGCTCCTCATAGTGG - Exonic
1033720249 7:144051196-144051218 CCTTCTGCTGCTCCTCAGGGTGG - Exonic
1034429813 7:151035643-151035665 CCTCACGCTGCTGCTGATGGTGG + Exonic
1034832194 7:154319031-154319053 CCTCCTGCTGCTGGCCCTGGGGG - Intronic
1034960626 7:155362204-155362226 CCTCCTCCTGCAGCTCCTTGGGG - Intronic
1035052256 7:156005631-156005653 CCTCCTTCTGCTGCAAAGAGAGG - Intergenic
1035610755 8:962518-962540 CCTCCTGGGGCTGCTCACATGGG + Intergenic
1035701048 8:1639434-1639456 ACCCCTGCTGCTCCGCATAGAGG - Intronic
1037331607 8:17748648-17748670 GCTCCTGCCGGTGCTCAAAGTGG + Intronic
1037702320 8:21286294-21286316 CCTCCTACAGCTGGTCATACTGG - Intergenic
1039595574 8:38787550-38787572 CCTCCGGCTCCAGCTCCTAGGGG - Exonic
1041629865 8:60075142-60075164 TCTCATGCTGCTGCTGAAAGTGG + Intergenic
1042011626 8:64252354-64252376 CTTCCTGTTCCTGTTCATAGGGG + Intergenic
1044694112 8:94905715-94905737 CTTCTTGGTCCTGCTCATAGTGG + Intronic
1046957148 8:120073435-120073457 CCTCCTGCTGCTTGTGATTGTGG - Intronic
1047171653 8:122499064-122499086 CATCCTGCCACTGCTCAGAGTGG - Intergenic
1049272500 8:141703419-141703441 CCCCCTCCTGCTGCCCAAAGTGG + Intergenic
1049360447 8:142210279-142210301 CCTCCTGCTGCTCCAGACAGGGG + Intergenic
1049389839 8:142362017-142362039 CCTCCTGCTGCAGGCCATCGGGG - Intronic
1049425945 8:142537939-142537961 CCTCCTGCTTCTGCACCCAGAGG + Intronic
1049719417 8:144108687-144108709 CCTCAGGCTGCTGCTCGTTGCGG + Exonic
1049772770 8:144391414-144391436 GCTCCTGCTGCGGCTCGTTGAGG + Exonic
1050343303 9:4662422-4662444 GCTGCTGCTGCTGCTCGAAGCGG - Exonic
1052403434 9:28029519-28029541 CCTGCTGCTGGTACTCAGAGTGG - Intronic
1053147839 9:35723965-35723987 CCTTGTGCTTCTGCTCATTGTGG + Exonic
1055525392 9:77128509-77128531 GCTCCTGCTGTGGCTCAAAGGGG - Intergenic
1056272554 9:84960633-84960655 TCTTATGCTGCTCCTCATAGAGG - Intronic
1057039280 9:91835720-91835742 CCTCCTGCAGCTGCAAGTAGTGG - Intronic
1057226051 9:93293722-93293744 CCTCCTCCTGCTGCACTTGGGGG + Intronic
1060564113 9:124574318-124574340 CCTCCTGCCTCTGATCAGAGTGG - Intronic
1060819328 9:126652261-126652283 ACTCCTGCTGCTCCACACAGGGG - Intronic
1061007520 9:127936553-127936575 CCTCCTGCTGCTCCTGTTTGTGG - Exonic
1061282800 9:129607177-129607199 CTTCTTGGTGCTGTTCATAGGGG + Intergenic
1061287805 9:129634128-129634150 GCTCCTGCCGCTGTTCAGAGAGG + Exonic
1061513568 9:131075724-131075746 CCTCCTGCTGCCCCTAACAGAGG - Intronic
1203776687 EBV:77222-77244 TCTGCTGCTGCTGGTCATGGCGG - Intergenic
1187472948 X:19585684-19585706 GCTGCTGCTGCTGCTGGTAGTGG - Intronic
1188031633 X:25270270-25270292 CGACCTGCCGCTGCTCATAGGGG + Intergenic
1189354069 X:40298335-40298357 CCTGCTGCAGCTGCCCTTAGAGG - Intergenic
1189884909 X:45532778-45532800 CTTCCTGCTTCTGCTCAGAGTGG + Intergenic
1189997214 X:46650527-46650549 CCTGCTGCTGCAGATCATGGTGG - Intronic
1196111663 X:111953104-111953126 CTTCTTGCTGCTGCTCAATGGGG + Intronic
1198377243 X:136052272-136052294 TCTCCTGCTGCTGCCTATGGTGG + Intergenic
1198979642 X:142380307-142380329 CCTCCTTCTGCTGCCCATGCTGG - Intergenic
1199945026 X:152658426-152658448 CCTCCTACAGCTGGTCATAAAGG + Intergenic
1200070188 X:153525427-153525449 CCTGCTCCTGCTGCTCTTTGAGG - Intronic