ID: 900997804

View in Genome Browser
Species Human (GRCh38)
Location 1:6131810-6131832
Sequence CGGGGACCCCGCCACAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900997790_900997804 8 Left 900997790 1:6131779-6131801 CCAAGGAGCAAGGGGCCCCATGG 0: 1
1: 1
2: 1
3: 19
4: 214
Right 900997804 1:6131810-6131832 CGGGGACCCCGCCACAGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 144
900997798_900997804 -7 Left 900997798 1:6131794-6131816 CCCCATGGGCCATGGGCGGGGAC 0: 1
1: 0
2: 0
3: 25
4: 268
Right 900997804 1:6131810-6131832 CGGGGACCCCGCCACAGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 144
900997799_900997804 -8 Left 900997799 1:6131795-6131817 CCCATGGGCCATGGGCGGGGACC 0: 1
1: 0
2: 0
3: 17
4: 186
Right 900997804 1:6131810-6131832 CGGGGACCCCGCCACAGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 144
900997800_900997804 -9 Left 900997800 1:6131796-6131818 CCATGGGCCATGGGCGGGGACCC 0: 1
1: 0
2: 0
3: 18
4: 245
Right 900997804 1:6131810-6131832 CGGGGACCCCGCCACAGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900997804 Original CRISPR CGGGGACCCCGCCACAGGCA GGG Intronic
900105315 1:978598-978620 CGGGAACCCTGCCAGAGGCTGGG + Intronic
900471567 1:2857582-2857604 CAGGGACCCACCCACAGCCAAGG + Intergenic
900517450 1:3089613-3089635 CGGGGAGCCCCTCACCGGCAGGG - Intronic
900659601 1:3775996-3776018 CATGGACCCCCCCACAGACACGG + Intergenic
900997804 1:6131810-6131832 CGGGGACCCCGCCACAGGCAGGG + Intronic
902377708 1:16037653-16037675 CAGGGACCCAGCAACAGACAAGG + Intergenic
902382886 1:16060909-16060931 CAGGGACCCAGCAACAGACAAGG + Intronic
902393351 1:16118980-16119002 GGGGGCCCCCACCCCAGGCAGGG + Intergenic
904475476 1:30762137-30762159 CTGGGCCCCTTCCACAGGCAGGG - Intergenic
905462197 1:38129200-38129222 GGGGGACCCCTCCCCAGGCCCGG + Intergenic
905912175 1:41662479-41662501 CGGGGACCCCGCCGCCGGCCCGG + Intronic
915431265 1:155868731-155868753 GGTGGACCCCAGCACAGGCAAGG + Exonic
916142983 1:161715678-161715700 AGGGGACCCAGCCTCAGTCAAGG + Intergenic
917533897 1:175860886-175860908 AGGGGAGCCGGCCACAGGGAAGG - Intergenic
918066588 1:181105575-181105597 CTGGCACCGCGCCACTGGCACGG - Intergenic
922720556 1:227898269-227898291 GGGGGACTGGGCCACAGGCAGGG - Intergenic
924502752 1:244652777-244652799 CGGGGCCCCCGCGGCATGCAGGG + Intergenic
1067055664 10:43048476-43048498 CAGGGTCCCCACCACAGCCATGG + Intergenic
1076657957 10:132036886-132036908 GGAGGACCCCGCCCCAGACAGGG - Intergenic
1077173313 11:1177949-1177971 TGGGGACCCCGGCAGATGCAAGG - Intronic
1077538533 11:3135730-3135752 GTGGGACCCTGCCGCAGGCAAGG - Intronic
1078565925 11:12414009-12414031 CAGGGGCCCAGCCAAAGGCAGGG - Intronic
1082799346 11:57402947-57402969 CTAGGACCCCCACACAGGCAGGG + Intronic
1083678325 11:64340248-64340270 CGGGCACCCCGACCCGGGCATGG + Exonic
1083815896 11:65132355-65132377 TGGGGACCCCCACACATGCAGGG + Intronic
1083998561 11:66283977-66283999 CGGGTACCCCCCCACCTGCAGGG - Exonic
1084478197 11:69400802-69400824 CGGGGAAGCAGCCACAGGAAGGG - Intergenic
1084887974 11:72223300-72223322 CGGAGACGCCGCCACCGGCTAGG + Intergenic
1084935226 11:72583374-72583396 CGGGGACCCAGGGCCAGGCAGGG - Intronic
1089631428 11:119787035-119787057 CGGGGACCCCAGGACAGGAAGGG - Intergenic
1100617299 12:96240800-96240822 CGAGGAACTCGCCACAGGCCTGG + Intronic
1102011559 12:109622268-109622290 GGGGGTCCCCGCCCCAGGAAGGG + Intergenic
1105207524 13:18235927-18235949 CGGGGACGCCACCAAGGGCATGG + Exonic
1113593674 13:111517474-111517496 GGGTGTCCCCTCCACAGGCAGGG - Intergenic
1113803099 13:113096556-113096578 CAGGGACCCGACCACTGGCAAGG + Exonic
1119421988 14:74512666-74512688 CGGGGACATCGCCACAGGGCAGG + Intronic
1121092288 14:91191033-91191055 ATGGGACCCCGCCACAAGCTAGG + Intronic
1202853325 14_GL000225v1_random:35593-35615 CGGGCACCCGGATACAGGCAGGG + Intergenic
1125610209 15:40964395-40964417 CCGCTTCCCCGCCACAGGCAGGG + Intergenic
1126583579 15:50262428-50262450 AGGGAGCCCCGCCACAGGAAGGG + Intronic
1131598726 15:93825922-93825944 CAGGGACACCACCACAGGGAAGG + Intergenic
1138580570 16:57938256-57938278 TGGGGACCCAGCCCCAGGCCTGG + Intronic
1139489723 16:67279735-67279757 CGGGGCCGCCCCCACGGGCATGG + Exonic
1140202343 16:72904766-72904788 TGGGACCCCCCCCACAGGCAAGG - Intronic
1141827979 16:86494299-86494321 CTGCGCCCCCGCCACAGGCCTGG - Intergenic
1142199924 16:88756185-88756207 CGGGCACCAGGCCACAGGGAGGG + Intronic
1142246022 16:88970418-88970440 CAGGGACCCTCCCAGAGGCAAGG - Intronic
1145961174 17:28887325-28887347 GGGGGACGCCTCCACAGGCTGGG - Intronic
1146929712 17:36768527-36768549 TGGGGTCCCCGCCCCAGGCCTGG + Intergenic
1147647128 17:42040569-42040591 CAGTGACCCCGCCACAGGTGAGG + Intronic
1147790594 17:43012256-43012278 CGGGGACTCCCCCAAAGACAAGG + Exonic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1152654809 17:81514622-81514644 CGGGTTCCCCGCCACCCGCAGGG + Intronic
1155159771 18:23186145-23186167 GGGTGACCCTGCCACTGGCAAGG + Intronic
1155199350 18:23503588-23503610 CGGGGCCCCCGCCGCGGGCGCGG + Exonic
1160719588 19:591311-591333 CGGGAACCCCGCCGCGGTCACGG - Intronic
1161064893 19:2232752-2232774 AGGGCACCAGGCCACAGGCAAGG + Intronic
1161378261 19:3950967-3950989 CGGGGATCCCGCCGCAGGCCGGG - Intergenic
1162933018 19:13966580-13966602 CGGGGACGCAGCCACGGGCATGG - Intronic
1163829727 19:19541858-19541880 CGGGGAGCCCGTCACAGGGTGGG + Intronic
1165601204 19:37056881-37056903 CGGGGATCCAGCCACCGCCAGGG + Intronic
1166130411 19:40742643-40742665 CGGGGAGCCCTCCTCTGGCAGGG + Exonic
1166682564 19:44777930-44777952 CGGGGCCACCGCCAGAGCCATGG - Exonic
1167376445 19:49114645-49114667 CCGGGACCCCTCCACAGGCCGGG - Intronic
925130255 2:1489328-1489350 GGGGGTCCCAGCCAGAGGCAAGG - Intronic
929033626 2:37671569-37671591 CGGAGACCCGGCCACCGGCCTGG - Exonic
934476893 2:94599580-94599602 AGAGGACCCCGCCCCAGCCAAGG - Intronic
938230136 2:129651286-129651308 CGGGGAACCTTCCACAGCCAAGG + Intergenic
942505627 2:176638337-176638359 CGGGGAGCCAGCGAAAGGCAGGG - Intergenic
947586656 2:231360823-231360845 CGGGGACCCCCCGCCAGCCAAGG + Intronic
947792997 2:232878355-232878377 AGGGGATCTCACCACAGGCATGG - Intronic
1171512395 20:25696347-25696369 GGGGGACTCGGCCACAGCCAGGG - Intronic
1172880984 20:38199865-38199887 TGGGGTCCCCGCCAGAGGCTGGG + Intergenic
1173873305 20:46355021-46355043 GAGGAACCCCGGCACAGGCAGGG - Intronic
1176022342 20:62968198-62968220 CAGGGTCCCGGACACAGGCAAGG - Exonic
1176119721 20:63448805-63448827 CGGGGCACTGGCCACAGGCATGG + Intronic
1176220999 20:63969441-63969463 CCGGGACCCCGGCCCAGGCCTGG + Intronic
1176267353 20:64217124-64217146 CGTGGCCCCCGCCACACCCAGGG + Exonic
1176303868 21:5113514-5113536 CAGGGACCCCTCCTCAGCCAGGG + Intergenic
1179640369 21:42743889-42743911 CGGGGAGCCCTCCCCAGGCCCGG - Intronic
1179853162 21:44148436-44148458 CAGGGACCCCTCCTCAGCCAGGG - Intergenic
1179975846 21:44865640-44865662 CAGGAACCCCGCTGCAGGCAGGG + Intronic
1181653055 22:24271371-24271393 CGCTGTCCCCGCCCCAGGCAAGG - Intronic
1182468315 22:30531877-30531899 AGGTGACCCCGCCAGGGGCATGG - Intronic
1184493578 22:44824500-44824522 CAGGGACCCGGCCACAGGATGGG - Intronic
1184890575 22:47376489-47376511 GGGGTACCCAGCCACCGGCAGGG + Intergenic
952319082 3:32259131-32259153 CGGGGACCTGGCCGCAGGGACGG + Intronic
961594778 3:128007291-128007313 CAGGGACCCAGCCAGAGGCTGGG - Intergenic
962318065 3:134371047-134371069 CAGGGACCCGGCCACATGCGGGG - Exonic
969302011 4:6302616-6302638 CGTGGACCCCGACAAAGGGAAGG + Exonic
969498597 4:7540048-7540070 CGGGGCCTCCACGACAGGCAGGG - Intronic
969677485 4:8622056-8622078 AGGGGATCCTGCCAGAGGCAAGG - Intergenic
969678440 4:8627697-8627719 AGGGGATCCTGCCAGAGGCAAGG - Intergenic
969679396 4:8633331-8633353 AGGGGATCCTGCCAGAGGCAAGG - Intergenic
985663972 5:1172267-1172289 GGGTGACCCCACCACAGGGACGG + Intergenic
985686058 5:1282286-1282308 CAGGGGCCCCGTCACAGGCCTGG - Intronic
985745150 5:1642638-1642660 CCAGGACTCCTCCACAGGCAGGG + Intergenic
989125804 5:38051388-38051410 CAAGGAGCCAGCCACAGGCAGGG - Intergenic
990346904 5:54880461-54880483 CCAGGCCCCAGCCACAGGCATGG + Intergenic
992773856 5:80072953-80072975 CAGGGAGCCAGCCATAGGCATGG - Intronic
996790722 5:127290553-127290575 GGGTGACCCCGCCAAAGGCCTGG - Intergenic
997177941 5:131797646-131797668 CGGGACCCCTGCCACAGCCATGG + Intergenic
997870014 5:137498650-137498672 CGGGGACCCCGCGGCGGGCACGG + Intronic
1001396165 5:171420612-171420634 CGGGGAACCGGCCAAGGGCAAGG + Intronic
1002851817 6:1003465-1003487 CTGGGACCCCTGCACAGGTACGG + Intergenic
1003035263 6:2636096-2636118 CTGGGGCCAGGCCACAGGCAGGG + Intergenic
1004352733 6:14904397-14904419 TGGGGACCCCAACACAGACATGG - Intergenic
1004426233 6:15509136-15509158 CGGGGACCCAGCCTCAATCAGGG - Intronic
1007735356 6:43978917-43978939 TGTGGACACCGCCACAGACAGGG - Intergenic
1007946982 6:45835721-45835743 CGGGGCCCCTGCCACAGAAAAGG - Intergenic
1012052436 6:94361949-94361971 CTGGGGCCCCGCCCCAGGCTGGG - Intergenic
1013352419 6:109317727-109317749 CGGGGACCTTGGCACAGGGAGGG + Intergenic
1015842291 6:137488718-137488740 CGGGGACCCCGAGACAGTCCGGG + Intergenic
1019149090 6:169992662-169992684 CGGGGGCAGCCCCACAGGCATGG + Intergenic
1019256599 7:56478-56500 CGGGGACACCGACACAGGGAGGG - Intergenic
1019285281 7:220161-220183 CAGGGACCCCACCACAGCGAGGG - Intronic
1019772682 7:2893599-2893621 AGGGGACCCCCCCACATGCAAGG - Intergenic
1020009205 7:4799347-4799369 CGAGGACACCCCCACAGGCCCGG - Exonic
1022032357 7:26503950-26503972 CGGGGACGCAGCTACAGGGAGGG - Intergenic
1025813439 7:64889451-64889473 CGGGGACGCAGCCCCAGGAAAGG - Intronic
1032781883 7:135170465-135170487 CGCTGACCCCGCCACACGCCGGG + Intronic
1035479342 7:159169629-159169651 TGTGGACCCCACCCCAGGCATGG - Intergenic
1039466349 8:37788045-37788067 CAGGCTCCCCGCCACAGGCCCGG + Intronic
1039595641 8:38787863-38787885 CGGGGACCCGGCTCCGGGCAGGG - Intronic
1039665529 8:39522819-39522841 CGGCGGCCCAGCCACAGGGATGG + Intergenic
1049064501 8:140302191-140302213 CGGGGAGCCTGCCACATGCGTGG + Intronic
1049470713 8:142773999-142774021 CAGGGACCCCACCCCAGGCCTGG - Intronic
1049656640 8:143801908-143801930 GGGGGACCCGGCCAGATGCAAGG + Intronic
1049680840 8:143917370-143917392 CGTGGACCCCGAGACGGGCAAGG - Exonic
1052853134 9:33390326-33390348 AGAGGACCCCGCCCCAGCCAAGG + Intronic
1053931161 9:43114824-43114846 AGAGGACCCCGCCCCAGCCAAGG + Intergenic
1056475735 9:86949204-86949226 CTGGGATCCCTCCACAGGTAAGG + Intergenic
1056776414 9:89516278-89516300 CAGGCACCCGACCACAGGCATGG - Intergenic
1056776684 9:89518245-89518267 CAGGCACCCGACCACAGGCATGG - Intergenic
1057131362 9:92656632-92656654 CACGGACCCCACCACAAGCAAGG + Intronic
1057131683 9:92658353-92658375 TGGGGTCCTCGCCACAAGCAGGG + Intronic
1057669908 9:97077966-97077988 TGGGGCCTCCGTCACAGGCAGGG + Intergenic
1059400987 9:114070713-114070735 CAGGGACCCAGCCAGTGGCATGG + Intronic
1060152839 9:121299753-121299775 CGGGGACCGCCCCCCAGGGAGGG - Intronic
1061895435 9:133644479-133644501 CTGGGAGCCCACCACAGCCATGG - Intronic
1062025202 9:134337044-134337066 CTGGGGCCTCTCCACAGGCAGGG - Intronic
1062028062 9:134349626-134349648 AGGAGACCCCGCATCAGGCAAGG + Intronic
1062040889 9:134403819-134403841 CGGGGACCTCGCCAATGTCAAGG - Intronic
1062103180 9:134738891-134738913 CTGGGTCACCTCCACAGGCAGGG - Intronic
1062287407 9:135779234-135779256 CTGAGACCCCCCCACAGCCATGG + Intronic
1062312608 9:135947156-135947178 CGTGGACGCCGCAGCAGGCAGGG - Intronic
1062493875 9:136822401-136822423 TGGTGAACCCACCACAGGCACGG - Intronic
1062554456 9:137107693-137107715 CGGCCACCGGGCCACAGGCACGG + Intronic
1189954157 X:46261290-46261312 TAGGAACCCCACCACAGGCAGGG - Intergenic
1199468364 X:148165752-148165774 CTGGGACCAGGCCAAAGGCAGGG + Intergenic
1199816044 X:151397465-151397487 CGGGGACCTGGCCTCAGGGAAGG + Intronic
1200117542 X:153775952-153775974 CGTGGACGCCGTGACAGGCAAGG + Exonic