ID: 900998319

View in Genome Browser
Species Human (GRCh38)
Location 1:6134655-6134677
Sequence GCGGCCACAGGCACCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900998312_900998319 8 Left 900998312 1:6134624-6134646 CCTATCACAGCGGCCACAGGGAC 0: 1
1: 1
2: 1
3: 23
4: 237
Right 900998319 1:6134655-6134677 GCGGCCACAGGCACCTACCATGG 0: 1
1: 1
2: 0
3: 12
4: 142
900998315_900998319 -5 Left 900998315 1:6134637-6134659 CCACAGGGACCTACCATGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 900998319 1:6134655-6134677 GCGGCCACAGGCACCTACCATGG 0: 1
1: 1
2: 0
3: 12
4: 142
900998307_900998319 26 Left 900998307 1:6134606-6134628 CCACAATGGCCAGGAGAACCTAT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 900998319 1:6134655-6134677 GCGGCCACAGGCACCTACCATGG 0: 1
1: 1
2: 0
3: 12
4: 142
900998309_900998319 17 Left 900998309 1:6134615-6134637 CCAGGAGAACCTATCACAGCGGC 0: 1
1: 0
2: 0
3: 6
4: 56
Right 900998319 1:6134655-6134677 GCGGCCACAGGCACCTACCATGG 0: 1
1: 1
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900998319 Original CRISPR GCGGCCACAGGCACCTACCA TGG Intronic
900611149 1:3545129-3545151 GCGGACACAGGCACCTTCCCCGG - Intronic
900998313 1:6134633-6134655 GCGGCCACAGGGACCTACCATGG + Intronic
900998319 1:6134655-6134677 GCGGCCACAGGCACCTACCATGG + Intronic
900998721 1:6136710-6136732 GCGGCCAGCGCCACCTACCTTGG + Exonic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
906212825 1:44021563-44021585 GCAGGCACTGGCCCCTACCATGG - Intronic
906216512 1:44044007-44044029 TGGGTCACTGGCACCTACCAAGG - Intergenic
909929407 1:81478261-81478283 ACGGCCACAGGAACCGAGCATGG - Intronic
914999611 1:152577006-152577028 GAGGCTCCAAGCACCTACCAAGG - Intronic
916194931 1:162213700-162213722 GCAGGCACAGGCACATGCCAGGG - Intronic
1066408978 10:35147184-35147206 GGGACTACAGGCGCCTACCACGG + Intronic
1067175706 10:43944029-43944051 GCAGCCACAGGGACCAACCTGGG - Intergenic
1067445114 10:46337067-46337089 GCGGCCCCAGGCACCAGCCCTGG - Intergenic
1067741158 10:48897012-48897034 GAGGCCACAGGAACCCACGAGGG + Intronic
1071696393 10:87878206-87878228 GGGACTACAGGCGCCTACCACGG + Intronic
1073494568 10:103879632-103879654 GCAGCCTCAGGCTCCTACCTGGG + Intergenic
1076357646 10:129864725-129864747 GCAGACACAGGCACCTACACAGG + Intronic
1077866243 11:6223895-6223917 GCGGCCACAGGCATCCAGCAGGG + Exonic
1078733960 11:14002752-14002774 GGGGGCACAGGCATCCACCAAGG + Intronic
1079131516 11:17749541-17749563 CAGGCCACAGCCACCCACCAGGG + Intronic
1080642228 11:34164673-34164695 ACGGCCACAGGTACCTGCCCGGG - Exonic
1092891739 12:12975390-12975412 GAGGGCACAGCCACCTACCGGGG - Exonic
1094277927 12:28699822-28699844 GCTGCCATAGCAACCTACCATGG - Intergenic
1094814031 12:34166556-34166578 GACTCCGCAGGCACCTACCACGG - Intergenic
1095102879 12:38201961-38201983 GACTCCACTGGCACCTACCACGG + Intergenic
1096131290 12:49160938-49160960 GGGGTTACAGGCACCCACCACGG + Intergenic
1096596908 12:52701612-52701634 GCGGCCACTAGCACCTCCCCAGG - Intronic
1096974896 12:55694361-55694383 TCAGGCACAGGCACCTCCCAAGG + Intronic
1104454440 12:128899381-128899403 GCCGCAACAGGCACCGTCCATGG - Intronic
1104746314 12:131213102-131213124 GAGGACACAGGCACATTCCATGG - Intergenic
1112442421 13:99433939-99433961 GTGGGCACAGGCACCTCACAAGG + Intergenic
1114558626 14:23576444-23576466 CCGCCCGCAGGCACCTACCAGGG - Exonic
1118766553 14:68913631-68913653 TTGGCCACAGCCACCTCCCAGGG + Intronic
1121848497 14:97196801-97196823 GCTACCACAGGAACGTACCAGGG - Intergenic
1123017866 14:105384170-105384192 GGGGCCACAGGCATCCACCAGGG + Intronic
1125298051 15:38223633-38223655 CTGGCCTCAGGCACCTACCCAGG - Intergenic
1127191612 15:56537204-56537226 GGGACTACAGGCACATACCACGG - Intergenic
1130075289 15:80683716-80683738 GGGACTACAGGCACCTGCCATGG + Intronic
1131860728 15:96650741-96650763 GAGGCCACAGGCACATCGCAGGG - Intergenic
1132330412 15:101008672-101008694 TCGGCCGCCGGCACCTGCCACGG - Intronic
1133929671 16:10222043-10222065 GTGACCACAGGCACATGCCATGG + Intergenic
1134103282 16:11467950-11467972 GTGGACACAGACACCTACAAAGG + Intronic
1135390871 16:22092262-22092284 AAGGCCACAGGCACGCACCAGGG + Intergenic
1136220176 16:28823428-28823450 GCGGCCACAGGCCCCAGGCAGGG - Exonic
1136632861 16:31499284-31499306 GCCCCCACAGGCAGCTACCTTGG + Exonic
1138007964 16:53355205-53355227 CAGGCCACAGACACCCACCAGGG - Intergenic
1141610830 16:85180268-85180290 GCAGCCAGAGGCACCTGCCCCGG - Intronic
1141707989 16:85679830-85679852 GAGGCCACATGCCCCTCCCAGGG + Intronic
1148397738 17:47323827-47323849 GCGGCCACCGCCACCGCCCAGGG - Intronic
1149299090 17:55287771-55287793 GAGTCCACAAGGACCTACCAAGG - Intronic
1150249683 17:63699010-63699032 CCGGCCCCAGGCCCCTACCTTGG + Exonic
1150493197 17:65588454-65588476 GCAGCCACAGGGACAGACCAAGG - Intronic
1150651446 17:67012863-67012885 GCTGCCACAGGCACCTACTGAGG - Intronic
1152203408 17:78960250-78960272 GCTGCCCCAGGAACCAACCATGG - Intergenic
1155276184 18:24189766-24189788 GCGGCCGCAGGCAGCTATCCCGG - Intronic
1155378486 18:25189225-25189247 GGGGCCACAGGAACGTACCAAGG - Intronic
1157256372 18:46143299-46143321 GGGACTACAGGCACCCACCATGG + Intergenic
1158548303 18:58414380-58414402 GCAGCCCCACCCACCTACCATGG + Intergenic
1161816193 19:6501568-6501590 GACCCCACAGGCACATACCATGG - Exonic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1163063188 19:14774807-14774829 GGGACTACAGGCACCCACCATGG + Intronic
1163591726 19:18197522-18197544 GCGGTCACAGGCGCCAAGCAGGG - Exonic
1163678769 19:18668902-18668924 GCGGCCGCCGGCACCCACCATGG - Exonic
1163719798 19:18893727-18893749 GAGCCCACAGGCGCCTGCCAAGG + Intronic
1167178485 19:47883043-47883065 GCAGCCACATGCATCTCCCATGG - Intronic
1167671512 19:50856302-50856324 GAGGCCACAAGCACCTGCCAGGG - Exonic
925060183 2:884939-884961 GGGGTCACAGGGACCTCCCATGG + Intergenic
926608630 2:14923014-14923036 GGGACTACAGGCACCTGCCATGG - Intergenic
929075670 2:38077040-38077062 GCGGCCGCAGGCAGCGCCCAGGG - Intronic
929334470 2:40724196-40724218 GCGGCCACGGACTCATACCAGGG - Intergenic
931303999 2:61010460-61010482 GGGATCACAGGCACCTGCCATGG + Intronic
933897271 2:86823413-86823435 GGGACTACAGGCACCCACCACGG + Intronic
934521470 2:95022691-95022713 GTGGCCCCAGGCACCTGCCCTGG - Intergenic
938256004 2:129860526-129860548 GTGGCCACAGGTCCCTGCCAAGG + Intergenic
938407464 2:131040449-131040471 GCGGCCCCCGGCCCCTACCTGGG + Intronic
942070228 2:172309480-172309502 GGGACCACAGGCGCCCACCACGG + Intergenic
944741619 2:202618430-202618452 GGGACTACAGGCACCTGCCATGG + Intergenic
945267169 2:207901917-207901939 GCGGACACAGGCACTTGCCATGG + Intronic
947791640 2:232872267-232872289 GAGGCCACAGGCCCCCAACAGGG - Intronic
948126240 2:235566769-235566791 GCAGCCACAGGAAACTAACACGG - Intronic
948518576 2:238521813-238521835 ACGACCACAGGCTCCCACCACGG - Intergenic
948533906 2:238632083-238632105 GCAGCCAGAGGCACTGACCAAGG - Intergenic
948895778 2:240926228-240926250 GCAGCCCCAGGCTCCTTCCAAGG - Intronic
1170603648 20:17860080-17860102 GCAGCCCCAGGCTCCAACCAGGG - Intergenic
1173387993 20:42606268-42606290 ACACACACAGGCACCTACCAAGG + Intronic
1174424608 20:50423251-50423273 TTGGCCACAGGCCCCTCCCAGGG - Intergenic
1175999424 20:62825343-62825365 CCGGCCACAGACACAAACCAGGG - Intronic
1177631526 21:23735087-23735109 GAGACCACAGGCTCCTGCCATGG + Intergenic
1181145368 22:20842090-20842112 GGGACTACAGGCACCTGCCACGG - Intronic
1181772168 22:25133676-25133698 GGGACTACAGGCACCCACCATGG + Intronic
1182421935 22:30252807-30252829 GTGGCCACAGCCACCTTCCCAGG + Intergenic
1185047227 22:48534572-48534594 CCGGGCACAGGCACATTCCAGGG - Intronic
950645599 3:14374785-14374807 ATGTCCACAGCCACCTACCAGGG + Intergenic
952638221 3:35557517-35557539 GGGGCCATAGGCACCTGCCTGGG - Intergenic
953038892 3:39237556-39237578 GCTGCCAAAGGCTCATACCAGGG + Intergenic
954145255 3:48631278-48631300 GGGGCCACAGGCATCTCCTATGG - Exonic
954374875 3:50188879-50188901 CCGGCCCCAGGCCTCTACCACGG - Exonic
954709125 3:52496267-52496289 GCTCCCAGAGGCCCCTACCATGG - Intronic
960936067 3:122903419-122903441 GGGGCCCCAGGCTCCTCCCAGGG - Intergenic
961047922 3:123722110-123722132 GTGCCCAGAGGCTCCTACCATGG + Exonic
961270038 3:125681454-125681476 GTGACCAGAGGCTCCTACCACGG - Intergenic
961630812 3:128297098-128297120 GAGACCATAGGCACATACCAGGG + Intronic
961721056 3:128896284-128896306 GCGGCCACAGGCAGAGCCCAGGG - Intronic
962362325 3:134752805-134752827 GTGGCCATAGGCAATTACCAAGG - Intronic
963443148 3:145367039-145367061 CCAGCCACAGCCACCAACCATGG + Intergenic
964506561 3:157406168-157406190 GCAGCCACTGGCACCAACCAAGG + Intronic
968628999 4:1640753-1640775 GCTGCCACCGGCACCTGCCCTGG - Exonic
968629063 4:1641000-1641022 GCTGCCACCGGCACCTGCCCTGG - Exonic
968690326 4:1986821-1986843 GCGCCCACACGCACCCTCCAAGG + Intronic
968929455 4:3570872-3570894 GCAGCCACAGGCAACTAACTCGG + Intergenic
969353434 4:6611342-6611364 GAGGGCACAGGCCCCTCCCAAGG - Intronic
971934572 4:33131494-33131516 GGGACCACAGGCACCCGCCAAGG - Intergenic
985511733 5:317570-317592 GCGGCCACGACCACCCACCAGGG + Intronic
990944752 5:61238302-61238324 GAGGCCACAGCCACCTTCCAAGG - Intergenic
996242106 5:121216180-121216202 GCGCCCACAGGCACTCACCCTGG + Intergenic
996863316 5:128089250-128089272 GGGACAACAGGCTCCTACCATGG - Intronic
997429271 5:133826327-133826349 GCAGCCACAGGAAACTAACATGG - Intergenic
999451451 5:151681258-151681280 GTGGCCACATGCAGCTACAATGG + Intronic
1001553250 5:172619386-172619408 GCGGCCACAACCATCTACTAAGG - Intergenic
1005965328 6:30722570-30722592 GACCCCACCGGCACCTACCACGG + Exonic
1006162406 6:32046291-32046313 GCGGCCACAGGCACTGCCCTGGG + Intronic
1007808003 6:44465114-44465136 GCAGCCCGAGGCACCTAACACGG - Intergenic
1016308953 6:142713246-142713268 GCAGCCACATGCTCCTAGCACGG - Intergenic
1019062407 6:169265857-169265879 GGGGCCACAGGCACCTGTCTGGG - Intergenic
1019453796 7:1114182-1114204 GCGGCCACTGGCCCATACAAGGG + Intronic
1021752235 7:23813909-23813931 GAGGCCACAGGCACCAACAAAGG - Intronic
1023033997 7:36115025-36115047 GGGGGCACAGGCACATCCCACGG + Intergenic
1024604486 7:51012839-51012861 GCTCCCAGAGGCACCTCCCAAGG - Intergenic
1025006093 7:55356166-55356188 GGGATTACAGGCACCTACCACGG + Intergenic
1033269925 7:139921565-139921587 GGGACCACAGGCACACACCACGG - Intronic
1036223884 8:6942556-6942578 GCGGTCAGATGCACCTCCCAGGG - Intergenic
1038757111 8:30352098-30352120 GACCCCACTGGCACCTACCACGG + Intergenic
1039489991 8:37940222-37940244 GGGGCCACAGGAACATTCCAGGG + Intergenic
1041981488 8:63866383-63866405 CTGCACACAGGCACCTACCATGG + Intergenic
1045385333 8:101666876-101666898 CCATCCACTGGCACCTACCACGG + Exonic
1047940841 8:129826240-129826262 GGGGCCACAGGCATCTGGCAGGG - Intergenic
1049284094 8:141765238-141765260 ATGGCCACAGGCTCCTGCCACGG + Intergenic
1049341454 8:142114782-142114804 GTGGCCTCAGGCACCTGCCCAGG - Intergenic
1051631427 9:19144634-19144656 GGGACTACAGGCACCTGCCACGG + Intronic
1052945533 9:34165369-34165391 GGGACTACAGGCACCTGCCACGG + Intergenic
1053804148 9:41784309-41784331 GCAGCCACAGGCAACTAACTCGG + Intergenic
1054141131 9:61531150-61531172 GCAGCCACAGGCAACTAACTCGG - Intergenic
1054192456 9:61995805-61995827 GCAGCCACAGGCAACTAACTCGG + Intergenic
1054460823 9:65461593-65461615 GCAGCCACAGGCAACTAACTCGG - Intergenic
1054645950 9:67592886-67592908 GCAGCCACAGGCAACTAACTCGG - Intergenic
1056672064 9:88638818-88638840 GAGGCCTCAGGGATCTACCATGG + Intergenic
1060479729 9:124011225-124011247 GCGGCCTCAGGCACCCGCCTGGG - Intronic
1062321192 9:135991183-135991205 AGGGCCACTGGCACCTCCCAGGG + Intergenic
1062584234 9:137241754-137241776 GACCCCACGGGCACCTACCACGG + Exonic
1186295392 X:8143119-8143141 GCTGACACAGACACCTACGAGGG - Intergenic
1189003497 X:36970678-36970700 GGGGCCACAGGGAACTTCCAGGG - Intergenic
1189046139 X:37593198-37593220 GGGGCCACAGGGAACTTCCAGGG + Intronic
1194601278 X:95924275-95924297 GCCGCAACAGGCCCCTCCCAAGG + Intergenic
1197639923 X:128956197-128956219 GCCCCAACAGGCACCTCCCAGGG + Intergenic
1199703010 X:150399165-150399187 CCTGCCACAGCCACCTCCCAGGG - Intronic
1200056811 X:153465882-153465904 GGGGCCACAGGCTCTTACCCGGG + Intronic