ID: 900999548

View in Genome Browser
Species Human (GRCh38)
Location 1:6142000-6142022
Sequence CCCTCAGAGCCTGCCGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900999542_900999548 19 Left 900999542 1:6141958-6141980 CCAGAAAACTGACATGGCTGTAA 0: 1
1: 0
2: 1
3: 24
4: 201
Right 900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 282
900999540_900999548 21 Left 900999540 1:6141956-6141978 CCCCAGAAAACTGACATGGCTGT 0: 1
1: 0
2: 0
3: 21
4: 193
Right 900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 282
900999541_900999548 20 Left 900999541 1:6141957-6141979 CCCAGAAAACTGACATGGCTGTA 0: 1
1: 0
2: 0
3: 15
4: 194
Right 900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 282
900999544_900999548 -9 Left 900999544 1:6141986-6142008 CCTCTAGGACAAGCCCCTCAGAG 0: 1
1: 0
2: 2
3: 20
4: 125
Right 900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG 0: 1
1: 0
2: 3
3: 29
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900999548 Original CRISPR CCCTCAGAGCCTGCCGGCCT CGG Intronic
900110925 1:1005289-1005311 CTCTCACAGCCTGCGGCCCTGGG + Intergenic
900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG + Intergenic
900165702 1:1243539-1243561 CCCTCACAGCCTGCTGCCCAAGG - Exonic
900567612 1:3341321-3341343 CCTTCAGAGGCTGCAGGCCCTGG + Intronic
900634003 1:3652878-3652900 CCCTCAGCGCCGGCCGCCTTTGG + Intronic
900933662 1:5752105-5752127 CCCTCAGCCCCTGCTGCCCTGGG - Intergenic
900956123 1:5887433-5887455 CCTGCACAGCCGGCCGGCCTTGG + Exonic
900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG + Intronic
901400658 1:9013318-9013340 CCTTCAGAGCCGGCCGGGCGCGG - Intronic
901409475 1:9072177-9072199 CTCGCGGAGCCTGCAGGCCTCGG - Intronic
902629155 1:17694642-17694664 CCCTCAGGGCCTGCCCGTGTGGG - Intronic
903554191 1:24181164-24181186 TCCCCAGAGCCTGCCTGCCATGG + Intronic
903874716 1:26465780-26465802 CCCTCAGAGTCTCCTTGCCTGGG - Intronic
903968474 1:27103916-27103938 CCTCCAGAGCCAGCCTGCCTGGG - Intronic
904365188 1:30006297-30006319 CACTCAGAGGCTGCTGTCCTGGG - Intergenic
904422788 1:30404954-30404976 CCCTCAGAGCCTGCTGCTCTGGG + Intergenic
905478718 1:38246750-38246772 CCCCGAGAGGCTGCCAGCCTGGG - Intergenic
905873896 1:41420027-41420049 CCCTCAGTGCCAACCTGCCTAGG - Intergenic
906845782 1:49190306-49190328 TCCTCAGGGCCTGCAGGTCTGGG + Intronic
910879831 1:91913403-91913425 CCCTCACATCCAGCCGCCCTGGG - Intergenic
916215065 1:162387029-162387051 CCCTCACAGCCAGCCAGCCAGGG - Intergenic
918447977 1:184633520-184633542 CCCTCAGAACACGCCGGCCGTGG + Intergenic
920347142 1:205313764-205313786 CCCTCAGAGGCTGCAGGGCTAGG + Intronic
923987863 1:239401781-239401803 CCCTCAAAGTCTGCCGGGCATGG - Intronic
1063148952 10:3320042-3320064 CCCTCTGCACCTGCTGGCCTGGG + Intergenic
1066657707 10:37711313-37711335 CCCTCCGCGCCTGCTGGACTGGG - Intergenic
1067033809 10:42898504-42898526 CCCACACAGGCTGCCGCCCTCGG - Intergenic
1067552216 10:47244077-47244099 GCCTGGGAGCCTGCTGGCCTTGG + Intergenic
1069786935 10:70994524-70994546 CCCTCAAAGGCTTCAGGCCTGGG - Intergenic
1071956904 10:90770250-90770272 CTCTGAGAGCCTGCTGCCCTGGG + Intronic
1072416265 10:95249240-95249262 CCCTCAGAGGCTGGCTGCCCTGG - Intronic
1072470268 10:95706977-95706999 CCCTCAGTCCCTGCAGGCTTAGG - Intergenic
1074892566 10:117747804-117747826 TCCACATTGCCTGCCGGCCTAGG + Intergenic
1075427694 10:122354572-122354594 CACTGAGAGCCTGTCTGCCTGGG - Intergenic
1075603143 10:123785515-123785537 CCCTCAGTCCCTGGCAGCCTGGG + Intronic
1076417460 10:130301518-130301540 CCTTCAGAGCTCGCCAGCCTGGG + Intergenic
1076899953 10:133333512-133333534 CCCTCAGATCCTTCCACCCTCGG - Intronic
1076917156 10:133430008-133430030 CCCTCTGGGCCTGCAGGACTGGG + Intergenic
1076937251 10:133574767-133574789 CCCTCTGGGCCTGCAGGACTGGG + Intergenic
1077051124 11:567538-567560 CCCTCAACTCCTGCAGGCCTGGG + Intergenic
1077106896 11:846080-846102 GCCTCAGAGCCCGTGGGCCTGGG + Intronic
1077378607 11:2217423-2217445 CTGTCTGAGCCTGCCGGCCTGGG - Intergenic
1078091167 11:8265652-8265674 CCCTCAGACCCTGAGGGCATGGG - Intronic
1080684237 11:34502341-34502363 ATCTCAGAGCCTGCTGGCCATGG + Intronic
1081635050 11:44715570-44715592 CCCTCACAGCCTCCTGGTCTTGG + Intergenic
1083765415 11:64839170-64839192 CCCTGAGATCCTGCAGGCCATGG - Exonic
1084029058 11:66470309-66470331 TCATCAGACCCTGCCAGCCTTGG + Intronic
1084112438 11:67022989-67023011 GACTCAGAGCCAGCCGGCCTGGG - Intronic
1084173855 11:67413335-67413357 CCTTGAGAGCCTCCTGGCCTGGG - Intronic
1084607471 11:70180962-70180984 CCATCCTAGCCTGCAGGCCTGGG - Intronic
1084785368 11:71438826-71438848 CCCCCAGAGCCTGCCGGCATCGG + Intronic
1085402108 11:76241458-76241480 GTCTCAGATCCTGCAGGCCTCGG - Intergenic
1086361928 11:86068888-86068910 CCTTCCCCGCCTGCCGGCCTGGG + Exonic
1087725100 11:101707667-101707689 CCATCACAGCCTGGAGGCCTAGG + Intronic
1088821488 11:113461064-113461086 CCTTCAGAGCCTGCCCTCTTGGG - Intronic
1091389480 12:117430-117452 CCCTCATAGCCTCCCAGGCTGGG - Intronic
1092204803 12:6608158-6608180 CCCTCAGTCCCTGCAGGCCAGGG + Intergenic
1096995948 12:55838382-55838404 CCCTTAGAGCGTGGCAGCCTTGG + Intronic
1097245814 12:57607091-57607113 CCTTGAGAGCCTTCCGGGCTAGG - Exonic
1098006561 12:66003612-66003634 CCCTAAGAGGCTGCCGGAGTTGG - Intergenic
1099953954 12:89334189-89334211 CCCTGAGAACCTGCCTGCATGGG - Intergenic
1100151796 12:91747024-91747046 GCCTCACAGCATGACGGCCTTGG - Intergenic
1100407335 12:94283122-94283144 CTCACAGAGCCTGCAGCCCTGGG + Intronic
1101477514 12:105064674-105064696 CCATCAGACCCTGCCAGTCTGGG + Intronic
1102068224 12:109996343-109996365 CCCTCAGCGCCTTGCAGCCTTGG + Intronic
1103567752 12:121825388-121825410 ACATCAGAGCCTGCTGGGCTGGG + Intronic
1104149603 12:126070026-126070048 CACTTAGAGCCTGCCTGCTTTGG - Intergenic
1104429003 12:128701358-128701380 CCCTCAGAGCCAGCTGGTGTTGG + Intronic
1104841272 12:131827294-131827316 CCCTCAGAGCCTCCCTGGCCCGG - Intergenic
1105821844 13:24087178-24087200 CTCCCAGAGCCTGCCAGCCCAGG + Intronic
1109526333 13:63580664-63580686 CCATCACAGCCTGGAGGCCTAGG - Intergenic
1112301286 13:98233001-98233023 GCCTCAAAGCCTGAGGGCCTGGG - Intronic
1113926831 13:113946484-113946506 CCCACACAGCCTCCTGGCCTGGG - Intergenic
1115583946 14:34790889-34790911 ACCTCAGGGTCTGCCCGCCTCGG - Intronic
1117538100 14:56720814-56720836 CCCTTAAGGCCTGCCAGCCTGGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118473270 14:66094311-66094333 CCCTCAGAGCCCACTGCCCTGGG - Intergenic
1118600150 14:67466365-67466387 CTCTTAGAGTCTTCCGGCCTTGG - Intronic
1119348639 14:73946284-73946306 ACCTCAGAGCCTGCGGGCACTGG + Exonic
1119473861 14:74915948-74915970 GCCTCAGAGCCTGGGGGCCAGGG - Intronic
1121461311 14:94080913-94080935 TCATCAGAGCCTGACGGCCTTGG - Intronic
1121775841 14:96590264-96590286 TCCTCAGAGCCTGCGGCCTTGGG - Intergenic
1122153657 14:99737907-99737929 CCCTCGGCGACTGGCGGCCTTGG - Intronic
1122293940 14:100694461-100694483 CCTTCAGAGCCAGCCGGGCTCGG - Intergenic
1122593321 14:102871112-102871134 CCGTCAGGGCATGTCGGCCTGGG + Intronic
1122717918 14:103706519-103706541 CGTTCAGAGCATGCCTGCCTGGG - Intronic
1122804169 14:104248280-104248302 CCCCCAGGGCCTGGAGGCCTGGG - Intergenic
1122881563 14:104692695-104692717 CCCTCCCAGCCAGTCGGCCTGGG + Intronic
1127103226 15:55588155-55588177 CCCTCAGCACATGCCGGCCCCGG - Intronic
1128224699 15:65993701-65993723 CCCTCAGAGCCTACATGGCTGGG - Intronic
1129269184 15:74410542-74410564 CACTCAGAGCCGGCTGGCCCGGG - Exonic
1129968013 15:79754028-79754050 CCCACAGTGCCTTCTGGCCTGGG + Intergenic
1130507812 15:84562594-84562616 ACCTCAGAGGCTGCTGGACTGGG - Intergenic
1131059932 15:89398371-89398393 CCCTCAGAACCTGTGGGGCTTGG - Intergenic
1131463878 15:92639042-92639064 CACTCAGTGCCTTCTGGCCTTGG - Intronic
1132356212 15:101173364-101173386 CGCTCTGAGCCTGCTGGGCTGGG + Intergenic
1132622153 16:872907-872929 CCCTGAGCACCTGCCTGCCTGGG + Intronic
1132878296 16:2149821-2149843 CCCGCTGAGCCTGCAGGCCTGGG + Intronic
1132903542 16:2271001-2271023 CCCTCAGAGGCTGGTGGCCTGGG + Intergenic
1132993295 16:2808537-2808559 CTCCCAGTGCCTGCCTGCCTGGG + Intergenic
1133023278 16:2976293-2976315 AGCTCAAAGCCTGCCAGCCTGGG + Intronic
1134103734 16:11470807-11470829 CCCTCAGAGGCAGCCTTCCTGGG - Intronic
1135323370 16:21511507-21511529 TCCTCAGGGCCTCCAGGCCTTGG + Intergenic
1136334854 16:29604773-29604795 TCCTCAGGGCCTCCAGGCCTTGG + Intergenic
1137236542 16:46623111-46623133 CCCTAAGAGGCTGCCGGAGTTGG - Intergenic
1138085708 16:54132017-54132039 TCCTCAGAGCCTGGCTGCCCTGG + Intergenic
1138453746 16:57108895-57108917 GCCTCAGATCCTGCCAGCATTGG - Intronic
1139861774 16:70027811-70027833 ACCTCAGAATCTGCCCGCCTCGG + Intergenic
1141733166 16:85835638-85835660 CGCTCACAGCCAGCAGGCCTGGG - Intergenic
1141922298 16:87144131-87144153 GTCTCAGAGCCTGCAGGGCTTGG - Intronic
1142035574 16:87860591-87860613 TCCTCAGGGCCTCCAGGCCTTGG + Intronic
1142367810 16:89659309-89659331 CCCGCAGAGCCTGCCGTCCGAGG + Intronic
1142605924 17:1081007-1081029 CCCTCACAGCCTGCCCACCCTGG - Intronic
1143022386 17:3923622-3923644 CCCGCAGAGCCTCCCAGCTTGGG - Intergenic
1144665841 17:17101857-17101879 CCCAGAAAGCCTGCCTGCCTTGG + Intronic
1146143511 17:30389135-30389157 CCCCCAGAGCCCGCTGCCCTGGG - Intronic
1146176673 17:30669526-30669548 CCCTCCCAGCCTGCTGGCATTGG + Intergenic
1146350137 17:32085641-32085663 CCCTCCCAGCCTGCTGGCATTGG + Intergenic
1147320100 17:39640799-39640821 CCCGCAGAGCCTCCCCGGCTGGG + Intronic
1147667879 17:42160125-42160147 CCCTCAGAGCCTGACCCTCTGGG - Exonic
1147861992 17:43529219-43529241 GCCCCAGAGCCTGGCGACCTGGG + Exonic
1148049241 17:44761007-44761029 CCCCCAGTGACTGCGGGCCTTGG - Intronic
1148386569 17:47238554-47238576 GCCCCAGAGCCCGCCGCCCTGGG - Intergenic
1148676859 17:49450827-49450849 GCCACAGAGCCTGCCTTCCTGGG - Intronic
1148895624 17:50837538-50837560 CCCTCAGAGCTGGCCAGACTGGG - Intronic
1150060506 17:62065110-62065132 CCCTCGGCGCCCGCCGGCCCCGG + Intronic
1150216895 17:63476306-63476328 CTCTCAAAGCCTGCTAGCCTCGG + Intergenic
1152049285 17:77959397-77959419 CCCTCAAACCCGGCCGGCCCGGG - Intergenic
1152231934 17:79118096-79118118 CCCCCAGTGCCGGCCGGCCCTGG + Intronic
1152583569 17:81179509-81179531 CACTTAGAGCCTGGGGGCCTAGG - Intergenic
1152853583 17:82650915-82650937 TCCCCAGAGCCTCCCAGCCTGGG + Intergenic
1156683566 18:39618594-39618616 CCCTCAGCAGCTGCTGGCCTTGG - Intergenic
1157787870 18:50502374-50502396 ACTTCAGACCCTGCTGGCCTGGG + Intergenic
1159962056 18:74563013-74563035 CCCTCAGAGCCTTGCAGCCTTGG - Intronic
1160167438 18:76526901-76526923 CCTTCAGACCCTGGCGACCTCGG + Intergenic
1160505427 18:79423860-79423882 GCCTCAGAGTCAGGCGGCCTTGG + Intronic
1160544159 18:79641832-79641854 CCCTCCCAGCCTCCTGGCCTCGG + Intergenic
1160866685 19:1259374-1259396 CCCTAAGGGACTTCCGGCCTTGG - Exonic
1160945739 19:1643036-1643058 GCCTCAGAGCCTGTCTGTCTTGG + Intronic
1161141499 19:2650878-2650900 CCCTCAGAAACTGCCGAGCTGGG + Intronic
1161452252 19:4353008-4353030 CCTTCAGAGCCTGCCCACCCGGG + Exonic
1162300708 19:9843265-9843287 CCCTTCCAGCCTGCTGGCCTTGG + Intronic
1162338818 19:10079069-10079091 CCCTCGGGGCCTTCTGGCCTTGG + Intergenic
1162525381 19:11203492-11203514 CCCACCCAGCCTGCCTGCCTGGG + Intronic
1162982143 19:14247361-14247383 CCCTCCCAGCCTGCTGGCATTGG - Intergenic
1163253347 19:16139898-16139920 CCCTCAGTGTCCGCAGGCCTCGG - Intronic
1165244959 19:34493485-34493507 CCCACAGATCCTGCAGGCCCTGG + Exonic
1165754723 19:38286182-38286204 CCCACAGAGCCTGCCTGCCTGGG - Intronic
1166645325 19:44527363-44527385 GCCTCAGAGCCTGACCACCTGGG + Intronic
1167690097 19:50980027-50980049 CCCTCAGACCCAGCAGTCCTGGG - Intronic
1167745227 19:51346871-51346893 CCCTCAGTGCCCGCTGGCCAGGG + Intronic
1168707927 19:58480229-58480251 CCCTCCCAGGCTGCCGGCCCTGG - Exonic
926013715 2:9429228-9429250 CCCACTGGGGCTGCCGGCCTTGG + Intronic
926115536 2:10210661-10210683 CCCGCAAAGCCTGCAGGCCAGGG + Exonic
928842062 2:35621129-35621151 CTCTCAAATCCTGCCTGCCTTGG + Intergenic
929893175 2:45936104-45936126 CCCTCAGTGCCTGCCCTCCTAGG - Intronic
930115946 2:47718336-47718358 CCCGCTGAGCCTGGCGACCTTGG + Intronic
930728824 2:54708973-54708995 CCCTCGGAGCCTGCCGTCCTGGG + Intergenic
932570129 2:72934161-72934183 CTCGGAGAGCCTGCCTGCCTGGG + Exonic
932907906 2:75773858-75773880 CCCTCAGAAGCTGCAGGCATTGG - Intergenic
935359594 2:102236282-102236304 CCCTGAGAGCCAGCCGGCAGGGG + Intronic
936060931 2:109295383-109295405 ACTTCAGAGCCAGGCGGCCTGGG - Intronic
937914294 2:127091425-127091447 GACTCAGAACCTGCCAGCCTTGG - Intronic
938323032 2:130377792-130377814 CCCCCGGATCCTGCCGGCCCAGG - Intergenic
938962317 2:136354760-136354782 GCTTCACAGCCTGCCAGCCTAGG + Intergenic
939131339 2:138239047-138239069 CCCTCAGACCCTGCCACCCCAGG - Intergenic
941021021 2:160407900-160407922 CCCTGAGAGCGCGCCGGCCGGGG + Intronic
941376017 2:164731873-164731895 GCATCAGAGGCTGCAGGCCTGGG - Intronic
942206221 2:173622152-173622174 TCCTCAGAGCATGGTGGCCTTGG - Intergenic
945061071 2:205909376-205909398 CCCTCAGTGCCTGCTGTCTTGGG + Intergenic
947190556 2:227500476-227500498 CTCTCAGAACCTGCTGTCCTAGG + Intronic
947715943 2:232338883-232338905 CCCACAGCACCTGCCGGCCAGGG + Intronic
947734966 2:232449625-232449647 CCCACAGCACCTGCCGGCCAGGG + Intergenic
947789061 2:232852181-232852203 CCCTCAGAGCCTTCCAGCCCTGG + Intronic
948645291 2:239400613-239400635 CCCGCGCAGCCTGCAGGCCTTGG - Exonic
948887760 2:240892584-240892606 CACTGTGAGCCTGCTGGCCTGGG - Intronic
948887773 2:240892638-240892660 CACTGTGAGCCTGCTGGCCTGGG - Intronic
949019599 2:241734038-241734060 CCCGAGGAGCCTCCCGGCCTGGG - Intergenic
949064840 2:241983767-241983789 ACCCCAGAGCCTGTGGGCCTGGG + Intergenic
1171142709 20:22756955-22756977 AACTCAGAGCCTGCTGGCCAGGG + Intergenic
1171854357 20:30331293-30331315 TCCTCAAAGCCTGACGGCATTGG - Intergenic
1172111206 20:32546177-32546199 ACCTCATGACCTGCCGGCCTTGG + Intronic
1172189890 20:33055554-33055576 CCCTCACAGACTGCCCACCTGGG - Intronic
1173992912 20:47316941-47316963 CCCTCGGAGCCTCACTGCCTGGG - Intronic
1175216384 20:57393529-57393551 GCCTTGGAGCCTGCCTGCCTTGG + Intronic
1175338173 20:58210048-58210070 CTCTCCGGGCCTGCCGGCGTCGG - Intergenic
1175540303 20:59743927-59743949 CCCTCACACCCTGCCAGCCCTGG + Intronic
1175737887 20:61399845-61399867 CCCTCAGACCCTGCCGGGGAAGG - Intronic
1176056612 20:63152294-63152316 GCCTCCGAGCCTGCCAGCCTAGG - Intergenic
1176217690 20:63956046-63956068 CCCGAGGAGCCTGCCGGCTTGGG + Intronic
1178818246 21:35951341-35951363 TTCTCTGAGCCTGCCAGCCTAGG + Intronic
1180986250 22:19905526-19905548 CCCTCAGAGGCTGCCCGCTTGGG - Intronic
1180995634 22:19963886-19963908 CCCTCAGTGCTTCCCAGCCTGGG + Intronic
1180999955 22:19983398-19983420 CCCTCAGGACCTGCCTGCCAAGG + Intronic
1181484477 22:23221856-23221878 ACCTCAGATTCTGCCTGCCTCGG - Intronic
1182667596 22:31970873-31970895 CCCACGGAGCCTGGCGGCCGCGG - Intergenic
1183149852 22:36028785-36028807 CCCTCACAGCACGCCGGCCGAGG + Intergenic
1183952580 22:41359820-41359842 TCCTCTGAGCCTCCCAGCCTGGG - Exonic
1184892499 22:47388597-47388619 CCCTAAGAGCCTGCTGTTCTGGG + Intergenic
1185098990 22:48827584-48827606 CCCTGCGAGCCTGCAGGCCATGG + Intronic
1185266594 22:49907215-49907237 CCCTCAGAGCCTCCCAGGCCTGG + Intronic
1185271118 22:49929654-49929676 CCCTCGGAGCCGCCCGGCCTGGG + Intergenic
1185410481 22:50679012-50679034 CCCTCAGACCCTGCTGGACCTGG + Intergenic
949709873 3:6861201-6861223 CCCGCGGCGCCTGCCAGCCTGGG - Exonic
950135025 3:10574979-10575001 GTCTCAGGGCCTGCCGGGCTGGG + Intronic
950286804 3:11751502-11751524 CAGTCAGAGCCTGCCGTGCTGGG + Intergenic
950661818 3:14471554-14471576 GCCTCAGGGCTTGCAGGCCTGGG + Intronic
950689691 3:14646131-14646153 CCATGTGAGCCTGCTGGCCTGGG + Intergenic
952207106 3:31191222-31191244 GCCTCAAAGCCATCCGGCCTTGG + Intergenic
953759896 3:45678435-45678457 CCCTCAGCTCCTGCCACCCTGGG - Exonic
954660582 3:52224794-52224816 CCCTGGGAGGCAGCCGGCCTGGG - Intronic
961575073 3:127828652-127828674 GGCTCTGAGCCTGCCTGCCTTGG + Intergenic
961749662 3:129087809-129087831 CCCTAAGAGGCTGCCGGAGTTGG - Exonic
964723484 3:159791034-159791056 CCCTCACACCTTGCCTGCCTTGG + Intronic
968814145 4:2812977-2812999 ACCTCAGGGACTGCCGGGCTGGG + Intronic
968842888 4:3021131-3021153 CCCACAGAGCCCTCCAGCCTTGG + Intronic
969869716 4:10097071-10097093 CCCTCAGATGCTGCTGGCCCCGG + Intronic
971201043 4:24509377-24509399 TCTTCAGGGCCTGCTGGCCTGGG + Intergenic
973624357 4:52756660-52756682 CCCTCCCAGCTTGCCAGCCTGGG + Intergenic
974894840 4:67926711-67926733 CCCCCAGAGCCTGCCACCCTGGG + Intronic
977741278 4:100486668-100486690 ATCTCAGAGCCTGCCAGGCTTGG - Intronic
977885159 4:102245181-102245203 CCCTCTGCACCTGCTGGCCTGGG - Intergenic
983873137 4:172844980-172845002 ACCTCATGACCTGCCGGCCTTGG - Intronic
984282303 4:177685842-177685864 CCCTAAGAGCCTGCTGACATGGG + Intergenic
984874305 4:184353856-184353878 CCCTCACAGCATGGCTGCCTTGG - Intergenic
985554016 5:547312-547334 CCCTCAGAAGCTGCAGACCTGGG + Intergenic
986004908 5:3659482-3659504 CCTTCAGAGGCTGCCGGGCTGGG - Intergenic
986241233 5:5961662-5961684 CGCTCCAACCCTGCCGGCCTCGG + Intergenic
986501015 5:8400163-8400185 CCCTCAGAGCCTCCCCTACTTGG + Intergenic
986799281 5:11242845-11242867 CCCTTAGATCTTGCTGGCCTTGG + Intronic
988609976 5:32714157-32714179 CCCCCAGTCCCAGCCGGCCTTGG - Intronic
989262262 5:39431222-39431244 ACCTCAGAACGTGCCTGCCTTGG + Intronic
991934010 5:71784056-71784078 AGCTCAGAGCTTGCAGGCCTGGG - Intergenic
994245641 5:97472160-97472182 CCCGCAGAGCCTGCCATCCTAGG - Intergenic
996383116 5:122882497-122882519 CCCTCTAGGCCTTCCGGCCTTGG + Intronic
997046916 5:130330066-130330088 CCTTCACAGCCTGGAGGCCTAGG + Intergenic
998192775 5:140041939-140041961 CCCGCAGACCCTGCCAGCCTGGG + Intronic
998511529 5:142718308-142718330 CCCTCAGAGCCTTCGGCCCAGGG - Intergenic
1001924764 5:175628021-175628043 GGCTCAGAGGCTGCAGGCCTGGG + Intergenic
1002267636 5:178046304-178046326 CACTCAGACCCTGCTGTCCTGGG - Intronic
1002576861 5:180178950-180178972 CCCTCAGACCTTGCTGTCCTTGG - Intronic
1002872371 6:1178473-1178495 CCCTCAGAGCCTCCTGGTCAGGG + Intergenic
1006116075 6:31776840-31776862 CCCGCAGAGCCGGCCTGCCCTGG - Intronic
1006318347 6:33304330-33304352 CCATCCCAGCCTGCCTGCCTCGG - Exonic
1006367932 6:33626487-33626509 TCCTCACAGCCTGTCAGCCTGGG - Intronic
1006434129 6:34017402-34017424 CCCTCCGAAGCTGCTGGCCTGGG + Intergenic
1006458123 6:34143575-34143597 GCCTCAGGGCCTTCCGGCCTAGG - Intronic
1007844311 6:44741034-44741056 CCCTCACACCCTGGCGGTCTCGG + Intergenic
1010378597 6:75202755-75202777 CCCCCAGCGCTTGCCGCCCTGGG - Exonic
1015597049 6:134875802-134875824 CCCTTTGACCCTGCAGGCCTGGG - Intergenic
1017626680 6:156356433-156356455 TCCTCAGAGCCTGGGGACCTAGG - Intergenic
1018038965 6:159904919-159904941 CCCCAAGAACCTGCTGGCCTCGG + Intergenic
1018774409 6:166999618-166999640 CCCCCAGTGCCCGCCGGCCCCGG - Intronic
1019032448 6:169024640-169024662 CCCTCAGAGCCGCCCCGCATCGG + Intergenic
1019516083 7:1440799-1440821 CCCCCACAGCCAGCCGGCCGGGG + Intronic
1021097084 7:16547222-16547244 CCACCAGAGCCTGCCACCCTGGG + Intronic
1021759715 7:23891870-23891892 ACTTCAGAGGCTGCTGGCCTAGG - Intergenic
1023852317 7:44157371-44157393 CCCTGAGAGCCTGGCGCCCCAGG + Intronic
1024250518 7:47502566-47502588 CCCTCATCGCCTGCTGCCCTGGG - Intronic
1025811806 7:64880432-64880454 GCCTCAGAAACTGCCGGGCTGGG + Intronic
1028406981 7:90485894-90485916 CCCACAGAGACTTCTGGCCTTGG - Intronic
1028922206 7:96321595-96321617 CCCCCAGCGCTTGCCGGCCCAGG + Intronic
1029460972 7:100693860-100693882 CCCCCAGAGCCGGCCAGCCTCGG - Intergenic
1029595907 7:101537598-101537620 CCCACAGAGCCTGCAGACCTGGG - Intronic
1034210569 7:149358878-149358900 CCCCCGGAGCCTGCTGCCCTGGG - Intergenic
1034815390 7:154167864-154167886 CACTCTGAGCCTGCAGGCCTGGG - Intronic
1035569839 8:665301-665323 ACCTCTGAGCCCGCCGGCCCTGG + Intronic
1035570806 8:671181-671203 ACCTCTGAACCTGCCGGCCCTGG + Intronic
1035570835 8:671297-671319 ACCTCTGAACCTGCCGGCCCCGG + Intronic
1035570847 8:671355-671377 ACCTCTGAACCTGCCGGCCCCGG + Intronic
1035570859 8:671413-671435 ACCTCTGAACCTGCCGGCCCCGG + Intronic
1035570884 8:671529-671551 ACCTCTGAACCTGCCGGCCCTGG + Intronic
1035570913 8:671645-671667 ACCTCTGAACCTGCCGGCCCCGG + Intronic
1035570938 8:671760-671782 ACCTCTGAACCTGCCGGCCCCGG + Intronic
1035570950 8:671818-671840 ACCTCTGAACCTGCCGGCCCCGG + Intronic
1035670014 8:1409816-1409838 GCCTCAGAGCCTGAAGGCCCTGG - Intergenic
1037139605 8:15504163-15504185 GCCTCAGAGCCAGACTGCCTGGG + Intronic
1038000843 8:23390105-23390127 CCATCAGACCCTCCCTGCCTGGG + Intronic
1039567261 8:38560326-38560348 CACTCAGCGTCTGCAGGCCTGGG - Intergenic
1039725750 8:40214460-40214482 CCATCAGGGCCTGCTGCCCTGGG + Intergenic
1042166774 8:65953042-65953064 CTGTCAGAGGATGCCGGCCTTGG - Intergenic
1042271572 8:66961644-66961666 CCCCCAGGGCCCGCCGGCCCCGG + Exonic
1042687994 8:71462582-71462604 CCCCCGGAGCCTGCCACCCTGGG - Intronic
1046149362 8:110202832-110202854 CCGGCAGGCCCTGCCGGCCTCGG - Intergenic
1046395548 8:113633894-113633916 CCCCCAGATCCTGCCACCCTGGG - Intergenic
1047367629 8:124226796-124226818 ACTTCAGAGCCAGGCGGCCTGGG + Intergenic
1048348855 8:133599615-133599637 CCCTCAGAGGCTGCAGGGCTGGG + Intergenic
1049173919 8:141179877-141179899 CCCTCAGTCCCTGCCGTCCAGGG - Intronic
1049205315 8:141360936-141360958 CCCTCAGAGCCGGCCGGAGAGGG + Intronic
1049476290 8:142798378-142798400 CGCTCAGAGCCCGGCAGCCTTGG + Intergenic
1049705252 8:144039255-144039277 CCCTGAGAGCCTGCTTTCCTTGG - Intronic
1049731337 8:144180103-144180125 CCCTCAGTCGCTGCCAGCCTTGG - Intronic
1055814165 9:80185517-80185539 CCCTCAGCAGCTGCTGGCCTGGG + Intergenic
1060413065 9:123412499-123412521 CTCACAGAGCCTGCAGGCATAGG - Intronic
1060667166 9:125438835-125438857 AGCTCAGAGCCTGCCTGCCAGGG - Exonic
1061850115 9:133409948-133409970 CCCTCAGAGACTGCTGCCGTGGG - Intronic
1062046459 9:134426736-134426758 CCCTCACATCCTGCAGGCCTGGG - Intronic
1062229411 9:135473106-135473128 CCCTCAATGCCTTCTGGCCTTGG + Intergenic
1062515620 9:136933745-136933767 ACCTTAGAGCCTGCTGGCCAGGG + Intronic
1062542014 9:137045761-137045783 CCTGCAGGGCCTGCGGGCCTGGG + Intronic
1062621916 9:137426657-137426679 CCCACAGAGCCTGCCCTCCTGGG - Intronic
1062680236 9:137775260-137775282 GACTCAGAGGCTGCCGGACTGGG - Intronic
1203445038 Un_GL000219v1:46090-46112 CCCACACAGCCTGCGCGCCTGGG - Intergenic
1185449747 X:275860-275882 CGCTCAGAGCCTGCAGGCTTGGG + Intergenic
1185471966 X:389352-389374 ACCTCAGGCCCTGCCAGCCTTGG - Intergenic
1185514643 X:690433-690455 CCCTCAGAGGCTGCCCTCATGGG + Intergenic
1193040206 X:76996880-76996902 CCCTCTGAAGCTGCTGGCCTGGG + Intergenic
1195626058 X:107006582-107006604 CTCTCAGAGCCTGCTTCCCTGGG - Intergenic
1195654715 X:107323805-107323827 CCCCCGCAGCCTGCCGCCCTGGG + Intergenic
1197715448 X:129703011-129703033 CCCTCAGAGCCTGACCTCCTTGG + Intergenic
1199853076 X:151739051-151739073 CCCTCTGAGCTTGCCTGCCTTGG - Intronic
1200074217 X:153543342-153543364 CCCTGAGAGCCGGCAGGCCAAGG + Intronic
1200145009 X:153921902-153921924 CCCTCAGAGCCGACGGGACTGGG - Intronic
1202376173 Y:24239520-24239542 ACCTCAGAGGCTGCTGGACTGGG - Intergenic
1202494607 Y:25430598-25430620 ACCTCAGAGGCTGCTGGACTGGG + Intergenic