ID: 901006187

View in Genome Browser
Species Human (GRCh38)
Location 1:6172705-6172727
Sequence GACACTGAGGTGACTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 671
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 621}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901006181_901006187 -1 Left 901006181 1:6172683-6172705 CCGGCTCGGTGGATGCCCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 176
Right 901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 621
901006173_901006187 26 Left 901006173 1:6172656-6172678 CCACTGAAACAGCCCACGCTGTG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 621
901006175_901006187 14 Left 901006175 1:6172668-6172690 CCCACGCTGTGTAAACCGGCTCG 0: 1
1: 0
2: 0
3: 3
4: 9
Right 901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 621
901006176_901006187 13 Left 901006176 1:6172669-6172691 CCACGCTGTGTAAACCGGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 621
901006171_901006187 30 Left 901006171 1:6172652-6172674 CCTCCCACTGAAACAGCCCACGC 0: 1
1: 0
2: 1
3: 5
4: 108
Right 901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 621
901006172_901006187 27 Left 901006172 1:6172655-6172677 CCCACTGAAACAGCCCACGCTGT 0: 1
1: 0
2: 0
3: 11
4: 76
Right 901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901006187 Original CRISPR GACACTGAGGTGACTCAGGC TGG Intronic
900171715 1:1272610-1272632 GACAGGCAGGTGACCCAGGCAGG - Intronic
900648481 1:3719580-3719602 GACCCTCAGGAGACTCAGACAGG - Intronic
901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG + Intronic
901375888 1:8839141-8839163 GATACTCAGGAGACTGAGGCAGG + Intergenic
901545903 1:9956841-9956863 GATACTGAGGAGGCTGAGGCAGG - Intronic
901920616 1:12534228-12534250 GCCACTCAGGAGACTGAGGCAGG - Intergenic
901986004 1:13075822-13075844 GGCACTGAGGAGGCTGAGGCAGG - Intronic
901995805 1:13150945-13150967 GGCACTGAGGAGGCTGAGGCAGG + Intergenic
902148859 1:14426095-14426117 GAGGCTGAGCTGATTCAGGCAGG - Intergenic
902492721 1:16796924-16796946 AACACTGAGGTGACTGAGTCGGG + Intronic
902558599 1:17261691-17261713 AAAACTGAGGTGGCTCAGGTAGG + Intronic
902598945 1:17527978-17528000 GCCACTCAGGAGACTGAGGCAGG - Intergenic
902652316 1:17844786-17844808 GCCCCTGAGGGGACTCAGGGAGG - Intergenic
903213259 1:21830118-21830140 GACACGGAGGTGACTCTGGAGGG + Intronic
903386118 1:22928022-22928044 GCTACTGAGGAGACTGAGGCAGG + Intergenic
903564699 1:24256081-24256103 GCTACTGAGGAGACTGAGGCAGG + Intergenic
903695534 1:25203616-25203638 GCTACTGAGGAGACTGAGGCAGG + Intergenic
904098484 1:28001625-28001647 GCCACTCAGGGGACTGAGGCAGG + Intronic
904181097 1:28667245-28667267 GCTACTGAGGAGACTGAGGCAGG + Intergenic
904368791 1:30035378-30035400 GACACAGATGTGAATCAGGGAGG + Intergenic
904976665 1:34461869-34461891 GAGCCTGAGGGGACTCAGGCTGG - Intergenic
905108104 1:35576051-35576073 GAGCCTGAGGTGCCCCAGGCAGG + Intronic
905502624 1:38451719-38451741 CACACAGTGATGACTCAGGCAGG - Intergenic
907064093 1:51462249-51462271 GCCACTCAGGAGACTGAGGCAGG + Intronic
907302267 1:53495796-53495818 GAAAGTGAGATGACTCAGCCTGG - Intergenic
907751023 1:57263225-57263247 GCTACTCAGGTGACTGAGGCAGG - Intronic
908692866 1:66802332-66802354 GACACTCAGGAGGCTGAGGCAGG + Intergenic
908990779 1:70086233-70086255 GACACTCAGGAGGCTGAGGCAGG - Intronic
909193709 1:72588559-72588581 GACACTGAAGATACTAAGGCAGG - Intergenic
909946451 1:81669300-81669322 GATACTGAGGAGACTGAGGCGGG + Intronic
909961971 1:81857149-81857171 CACAGTTAGGTGACTTAGGCAGG + Intronic
910849537 1:91636941-91636963 GACTGTGAGGTCACACAGGCTGG + Intergenic
912495151 1:110086845-110086867 GGCAATGAGATGACTCTGGCTGG + Intergenic
912556763 1:110521894-110521916 GACACTGGGGTGACGCAGGTGGG - Intergenic
912665081 1:111571458-111571480 GCTAATGAGGTGACTCAGGTTGG - Intronic
913028187 1:114868248-114868270 GCCACTGAGGAGGCTGAGGCAGG - Intronic
913083716 1:115414283-115414305 GCCACTCAGGAGACTGAGGCAGG + Intergenic
914891629 1:151629693-151629715 GACCCTCAGGAGGCTCAGGCAGG - Intronic
914906697 1:151752023-151752045 GCCACTGGGGAGACTAAGGCAGG + Intergenic
915130982 1:153695313-153695335 GGTACTCAGGTGACTGAGGCAGG + Intergenic
915174798 1:154005833-154005855 GCCACTCAGGAGGCTCAGGCAGG - Intronic
915397661 1:155597926-155597948 GATACTGGGGAGACTGAGGCAGG - Intergenic
915598161 1:156906946-156906968 GGAAATGAGGTGACTCAGACAGG + Intronic
915901756 1:159851844-159851866 GAAACTGAGGCCCCTCAGGCTGG - Intronic
916556048 1:165895300-165895322 GACACTTAGGGGGCTGAGGCGGG + Intronic
916645710 1:166783292-166783314 GACACTTGGGTGGCTGAGGCAGG - Intergenic
916764524 1:167847525-167847547 GCTACTGAGGAGACTGAGGCAGG - Intronic
917385665 1:174471293-174471315 GCCTATGATGTGACTCAGGCTGG + Intronic
917939410 1:179903182-179903204 GATACTGAGGAGGCTGAGGCAGG + Intronic
918737679 1:188086865-188086887 GATACTCAGGAGACTGAGGCAGG - Intergenic
919384986 1:196910038-196910060 GCCACTCAGGAGACTGAGGCAGG + Intronic
919654437 1:200183561-200183583 GACACTTGGGAGACTAAGGCAGG + Intergenic
919733057 1:200926582-200926604 GCTACTGAGGTGGCTGAGGCAGG + Intergenic
920076271 1:203339398-203339420 GACACAGAGGTCACCCAGGAAGG - Intergenic
920108533 1:203571186-203571208 GCCACTTAGGGGACTGAGGCAGG + Intergenic
920655966 1:207875288-207875310 GATACTCAGGTGGCTGAGGCTGG - Intergenic
921989224 1:221346218-221346240 GCTACTCAGGAGACTCAGGCAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922770173 1:228177387-228177409 GACACTGAGGGGGCACAGGATGG - Exonic
922858967 1:228799212-228799234 AACACTCAGGAGACTGAGGCAGG + Intergenic
923527723 1:234785609-234785631 AACACTGAGGTGACTGAGTCGGG - Intergenic
923686526 1:236157333-236157355 GCCACTGGGGAGACTGAGGCAGG - Intronic
924775981 1:247114696-247114718 TACCCTGAGGTGACTTAGGGAGG - Intergenic
1063420792 10:5911240-5911262 GACACTGAGGTGGAGCAGGTGGG - Intronic
1063904707 10:10769650-10769672 GATACTCAGGGGACTGAGGCAGG + Intergenic
1064505605 10:16026900-16026922 GACATTGATCTGACCCAGGCTGG - Intergenic
1065229442 10:23582283-23582305 GCTAATGAGGTGACTCAGGGTGG + Intergenic
1065705072 10:28464992-28465014 GCCACTGAGGAGGCTGAGGCAGG - Intergenic
1065783571 10:29192739-29192761 CACAGTGAGGGGACTCAGGGAGG - Intergenic
1068006384 10:51396287-51396309 GCCACTCAGGAGACTGAGGCAGG + Intronic
1068663678 10:59649719-59649741 GCTACTCAGGTGACTGAGGCAGG - Intergenic
1069684271 10:70307756-70307778 GTGACTGTGGTGCCTCAGGCAGG + Intronic
1070223729 10:74478329-74478351 GACACTCAGGAGGCTGAGGCAGG - Intronic
1070626686 10:78055862-78055884 GACACTCAGGAGGCTGAGGCAGG - Exonic
1070820452 10:79351049-79351071 GACAGTGAGGGGACTCGGCCTGG + Intronic
1071553570 10:86585608-86585630 GGCACTGTGGTGCCTCAGGAGGG - Intergenic
1072705605 10:97678715-97678737 GTCACTCAGGTCACTCAGGCTGG + Intronic
1073434948 10:103510691-103510713 GACACAGATGTTTCTCAGGCAGG - Intronic
1073764467 10:106666666-106666688 GACACTCAGGAGGCTGAGGCAGG - Intronic
1074621195 10:115124714-115124736 GCCAATGAGGTGACTCATGGTGG - Intronic
1074857109 10:117481559-117481581 CATTCTGAGGTCACTCAGGCAGG + Intergenic
1075273054 10:121069658-121069680 CTCTCTGAGCTGACTCAGGCCGG + Intergenic
1075864233 10:125704096-125704118 AACTCTGAGTTGACTCAGTCAGG - Intergenic
1076352007 10:129823302-129823324 GCCACTCAGGAGACTGAGGCAGG - Intergenic
1076563698 10:131383738-131383760 GGGACTGAAGTGACTCAGGGTGG + Intergenic
1077304387 11:1862615-1862637 GAAACTGAGATCACTCAGGGAGG - Intronic
1078304220 11:10166848-10166870 GCCACTCAGGAGACTGAGGCGGG + Intronic
1078453091 11:11454794-11454816 GAGACTGAGGAGACTCAGGAGGG - Intronic
1079054011 11:17189501-17189523 GATACTCAGGAGACTGAGGCTGG + Intronic
1080643101 11:34169473-34169495 GAAACTGAAGTGCCTCAGGGAGG + Intronic
1080651682 11:34227844-34227866 GATACTCAGGTGGCTGAGGCAGG - Intronic
1080651731 11:34228169-34228191 GATACTCAGGTGGCTGAGGCAGG - Intronic
1081494655 11:43596542-43596564 GACACTGAGGAGGCTGAGGTGGG - Intronic
1081810289 11:45910507-45910529 GACACTGAGGGGCCTGAGTCAGG + Intronic
1081810955 11:45913920-45913942 GTCACTCAGGAGGCTCAGGCTGG + Exonic
1081875565 11:46406163-46406185 GCTACTGAGGTGGCTGAGGCAGG - Intronic
1083041956 11:59697188-59697210 GACAATTAGTTGACTGAGGCTGG + Intergenic
1083305218 11:61758415-61758437 GACACTGAGTTCACTCAGTGGGG + Intronic
1083704983 11:64508040-64508062 GACCCTGGGGTGACTTAGGCCGG - Intergenic
1084021008 11:66418270-66418292 GAGAGTGGGGTGACTCAGCCAGG + Intergenic
1084046576 11:66571889-66571911 GACACTCAGGAGGCTGAGGCAGG + Intergenic
1084130465 11:67129990-67130012 TTCACTGTGGTCACTCAGGCTGG + Intronic
1084394329 11:68898897-68898919 GCTACTAAGGTGACTGAGGCAGG - Intronic
1084849096 11:71924265-71924287 GCTACTCAGGTGACTAAGGCAGG + Intronic
1085078823 11:73616771-73616793 CACGCTGAGGTGGCTGAGGCAGG - Intergenic
1085121021 11:73967631-73967653 GATACTCAGGAGACTGAGGCAGG + Intronic
1085219420 11:74860898-74860920 GATAATGAGATGACTCAGGATGG + Intronic
1085337737 11:75709053-75709075 GCCACTCAGGAGACTGAGGCAGG + Intergenic
1085533875 11:77206715-77206737 GACACTGTGTTGAGACAGGCAGG - Intronic
1085860112 11:80223051-80223073 GCCACTGAGGAGGCTGAGGCAGG + Intergenic
1086476305 11:87178535-87178557 GCTACTCAGGAGACTCAGGCAGG - Intronic
1088274980 11:108075645-108075667 GAAACTCAGGTGGCTGAGGCGGG - Intronic
1089150969 11:116363978-116364000 GCCACTCAGGAGACTGAGGCAGG - Intergenic
1089240553 11:117074813-117074835 GCTACTGAGGGGACTGAGGCAGG + Intronic
1089738698 11:120567097-120567119 GCTACTGAGGAGACTGAGGCAGG - Intronic
1089860249 11:121583606-121583628 GACACTGGGGAGGCTCAGGGAGG - Intronic
1089956781 11:122578618-122578640 GCCAGTGAGATGACTCAGGTTGG - Intergenic
1090300598 11:125634432-125634454 GATACTGAGGAGACTGAGGCAGG - Intronic
1091062338 11:132475085-132475107 GAATCTGTTGTGACTCAGGCAGG - Intronic
1091200393 11:133775880-133775902 GACACTTAGATAATTCAGGCAGG + Intergenic
1091456194 12:609828-609850 GCTACTGAGGAGGCTCAGGCAGG + Intronic
1092105791 12:5921026-5921048 GACTTGGAGGTGAGTCAGGCGGG - Exonic
1092526316 12:9312319-9312341 GACACTGGGGTCACTCACGAGGG - Intergenic
1092540956 12:9419471-9419493 GACACTGGGGTCACTCACGAGGG + Intergenic
1092693782 12:11145302-11145324 GACACTCAGGAGGCTGAGGCAGG - Intronic
1093472151 12:19513649-19513671 GATACTCAGGAGACTGAGGCGGG + Intronic
1094502730 12:31035578-31035600 GAGGCTGAGGGGACTCAGGGAGG - Intergenic
1094512087 12:31103016-31103038 GACACTGGGGTCACTCACGAGGG - Exonic
1096236643 12:49932851-49932873 GACACAGTGGTGACTAAGGCAGG - Intergenic
1096373685 12:51089757-51089779 GCTACTGAGGAGGCTCAGGCAGG + Intergenic
1096428923 12:51527377-51527399 GACAATGAGGGGCCTCAGTCTGG - Intergenic
1096632225 12:52935265-52935287 GCTACTCAGGTGACTGAGGCAGG + Intronic
1097123707 12:56756137-56756159 GCCACTCAGGAGACTGAGGCAGG - Intronic
1097192267 12:57225254-57225276 GACACTGAGGTTGCCCAGGCTGG - Exonic
1099607165 12:84818593-84818615 GATAAAAAGGTGACTCAGGCCGG - Intergenic
1099915898 12:88892698-88892720 GCCACTCAGGAGACTGAGGCAGG + Intergenic
1100838830 12:98592071-98592093 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1101965464 12:109279309-109279331 GTCACTGAGGTCACGCAGCCAGG + Exonic
1102106047 12:110324531-110324553 GACACTCAGGTGGCTGAGGCAGG - Intronic
1102155833 12:110727047-110727069 GACACTCAGGAGATTGAGGCAGG - Intronic
1102200866 12:111056817-111056839 GTGATTCAGGTGACTCAGGCTGG + Intronic
1102892934 12:116575066-116575088 GCCACTCAGGAGACTGAGGCAGG + Intergenic
1103565620 12:121814063-121814085 GACAGTGAGGTGAGTCTGGAAGG - Intronic
1105208642 13:18244060-18244082 GCTACTCAGGTGACTGAGGCAGG + Intergenic
1105489174 13:20870920-20870942 GCTACTGAGGAGACTGAGGCAGG - Intronic
1105568660 13:21577865-21577887 GCCACTGAGGAGGCTGAGGCAGG + Intronic
1106247913 13:27964590-27964612 GCTACTCAGGTGACTGAGGCAGG + Intronic
1106509248 13:30398858-30398880 GACACTCCGGAGACTCTGGCAGG - Intergenic
1106981955 13:35296267-35296289 GCTACTCAGGTGACTGAGGCAGG + Intronic
1107223300 13:38013468-38013490 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1108211545 13:48144602-48144624 GACACAGACGTGACCCTGGCAGG + Intergenic
1109962042 13:69644240-69644262 GATACTCAGGAGGCTCAGGCTGG + Intergenic
1111199380 13:84914096-84914118 GCCACTCAGGAGACTGAGGCAGG + Intergenic
1111635844 13:90902889-90902911 GAGACTGTGGTGACTAAGGCAGG + Intergenic
1112094168 13:96114261-96114283 GCTACTCAGGTGACTGAGGCAGG - Intronic
1112558447 13:100490851-100490873 GGCACTGAGGGCACTCAGGGTGG + Intronic
1113490611 13:110688796-110688818 GAGACTCAGGTGGCTGAGGCAGG + Intronic
1113917556 13:113883540-113883562 GGCACTGAGGGGACGCACGCGGG - Intergenic
1114445645 14:22785908-22785930 GACACTCAGGAGGCTGAGGCAGG + Intronic
1115527294 14:34294197-34294219 GACACTCAGGAGGCTGAGGCAGG - Intronic
1115633410 14:35267667-35267689 GATACTGAGGAGGCTGAGGCAGG + Intronic
1115687522 14:35811631-35811653 GCCACTCAGGAGACTGAGGCAGG + Intergenic
1116005776 14:39288584-39288606 GATACTCAGGTGGCTGAGGCAGG - Intronic
1116851587 14:49914368-49914390 GATACTCAGGAGACTGAGGCAGG - Intergenic
1118192748 14:63595011-63595033 CACCCTGAGGTGATTCAGGCAGG - Intergenic
1118513982 14:66507493-66507515 GAAACTGAGGAGTCTGAGGCAGG - Exonic
1119489301 14:75016972-75016994 GACACTGGGCTGATTCAGTCAGG + Exonic
1119677752 14:76568701-76568723 GACACTCAGGTGGCTGAGACAGG + Intergenic
1119783381 14:77294431-77294453 GCCACTCAGGAGACTGAGGCAGG - Intronic
1121599822 14:95195104-95195126 GCCACAGGGGTGATTCAGGCGGG - Intronic
1121600102 14:95196965-95196987 GTCACAGAGCTGACTCAGCCAGG - Intronic
1122767155 14:104080701-104080723 GACACTGTGTTGAAGCAGGCTGG - Intergenic
1122849661 14:104520896-104520918 GCCACTGCGGTGACTCAGGTCGG - Intronic
1202854789 14_GL000225v1_random:43557-43579 GCCACCGAGGAGACTGAGGCTGG - Intergenic
1123412318 15:20071006-20071028 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1123413656 15:20079842-20079864 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1123440907 15:20290754-20290776 GACACTCGGGAGACTGAGGCAGG - Intergenic
1123521660 15:21078126-21078148 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1123522998 15:21086954-21086976 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1123660730 15:22562413-22562435 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1123712003 15:22995130-22995152 GCCACTCAGGAGACTAAGGCAGG + Intronic
1123807836 15:23893582-23893604 GATACTCAGGAGACTGAGGCAGG - Intergenic
1124263478 15:28213096-28213118 GACACTCAGGAGGCTGAGGCAGG + Intronic
1124503182 15:30248592-30248614 GCCACTGAGGAAGCTCAGGCTGG + Intergenic
1124523569 15:30427169-30427191 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1124535098 15:30539046-30539068 GACACTCAGGAGGCTGAGGCAGG + Intergenic
1124701717 15:31919461-31919483 GATACTCAGGTCACTGAGGCAGG - Intergenic
1124740373 15:32290054-32290076 GCCACTGAGGAAGCTCAGGCTGG - Intergenic
1124763553 15:32468555-32468577 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1124775073 15:32580496-32580518 GACACTCAGGAGGCTGAGGCAGG + Intergenic
1124798688 15:32808290-32808312 GACACTCAGGTGACACAGCTAGG - Intronic
1125684521 15:41555965-41555987 GACAGTGATGTATCTCAGGCTGG + Intergenic
1125986634 15:44059621-44059643 GCTACTGAGGAGACTGAGGCAGG - Intronic
1127427715 15:58872555-58872577 GCCACTCAGGAGACTGAGGCAGG + Intronic
1127961528 15:63894311-63894333 GAGGCTGTGGTGACTCAGCCAGG - Intergenic
1128003248 15:64214249-64214271 GTCAGTGAAGTGACTCAGGGCGG - Intronic
1128141174 15:65301795-65301817 GATACTCGGGTGACTGAGGCAGG + Intergenic
1128246355 15:66135411-66135433 GACACAGAGAAGACTCAGGCGGG + Intronic
1128831139 15:70769883-70769905 GCCACTCAGGTGGCTGAGGCAGG + Intergenic
1129330648 15:74825597-74825619 GGCTCTGAGGTGGGTCAGGCAGG - Exonic
1129488238 15:75897780-75897802 GCTACTGAGGAGACTGAGGCAGG - Intronic
1129804017 15:78438787-78438809 GAGACTGAGGGGCCTTAGGCTGG - Intronic
1130005928 15:80097535-80097557 GCTACTCAGGTGACTGAGGCAGG + Intronic
1130308926 15:82735739-82735761 GACACTCAGGAGGCTGAGGCAGG + Intergenic
1130653001 15:85772902-85772924 GGCACAGAGGTGCCCCAGGCTGG - Intronic
1132343661 15:101093647-101093669 CACATGGAGGTGACACAGGCAGG + Intergenic
1132354002 15:101158082-101158104 GGCCCTGAGGTGACCCAGACTGG + Intergenic
1132609817 16:810035-810057 GACACTTGGGAGGCTCAGGCAGG - Intronic
1132630677 16:915779-915801 GCGACTGCGGTGCCTCAGGCGGG + Intronic
1132638086 16:963143-963165 GACACAGAGGGGACTCGGGGTGG + Intronic
1132685149 16:1159041-1159063 CACCCTGAAGTGCCTCAGGCAGG - Intronic
1133159578 16:3901672-3901694 GACACTCAGGAGGCTGAGGCGGG - Intergenic
1133759585 16:8787805-8787827 GTCACTGGGGAGACTGAGGCAGG - Intronic
1133789196 16:8996155-8996177 GACAGGCATGTGACTCAGGCTGG + Intergenic
1133964755 16:10522506-10522528 GCTACTCAGGAGACTCAGGCAGG + Intergenic
1134338938 16:13327502-13327524 GACACTCGGGAGACTGAGGCAGG + Intergenic
1135847172 16:25929268-25929290 GCCACTCAGGAGGCTCAGGCAGG + Intronic
1136566846 16:31075655-31075677 GACACTGAAATGACTCGGGGTGG + Intronic
1136603303 16:31312536-31312558 GACACTTAGGAGGCTGAGGCAGG - Intronic
1136725947 16:32357636-32357658 GACACTCAGGAGACTGAGGCAGG + Intergenic
1136844280 16:33563687-33563709 GATACTCAGGAGACTGAGGCAGG + Intergenic
1136928317 16:34395819-34395841 GACACTCAGGAGGCTAAGGCAGG + Intergenic
1136976257 16:35015985-35016007 GACACTCAGGAGGCTAAGGCAGG - Intergenic
1137741506 16:50780628-50780650 GCTACTCAGGTGACTGAGGCAGG - Intronic
1137978301 16:53049265-53049287 GCCACTGAGGAGGCTGAGGCAGG - Intergenic
1138445661 16:57061579-57061601 GTCACTGAGGTGGCTCTGGCAGG - Intronic
1138479826 16:57294887-57294909 GATACTCAGGAGACTGAGGCAGG + Intergenic
1138821342 16:60263840-60263862 GATACTCAGGAGGCTCAGGCAGG - Intergenic
1139152889 16:64405978-64406000 GATACTCAGGAGACTGAGGCAGG - Intergenic
1139679687 16:68551868-68551890 GATACTGAGGAGGCTGAGGCAGG - Intronic
1139722658 16:68869364-68869386 GCTACTGAGGTGGCTGAGGCAGG + Intronic
1140030074 16:71328621-71328643 GACTAAGAGGTGACTCAGGATGG + Intergenic
1140901242 16:79369995-79370017 GTCACGGAGGTGACTCAACCGGG + Intergenic
1141044691 16:80705508-80705530 CACACTGAGGGAACGCAGGCAGG + Intronic
1141733656 16:85838729-85838751 GCCACAGGGGTGACTCAGGCAGG + Intergenic
1142001009 16:87664511-87664533 GCTACTGAGGAGACTGAGGCAGG + Intronic
1142178297 16:88655185-88655207 GACACCAAGGTGACGCGGGCCGG - Exonic
1142398528 16:89846914-89846936 GACACTCGGGAGACTGAGGCAGG - Intronic
1203000484 16_KI270728v1_random:160119-160141 GACACTCAGGAGACTGAGGCAGG - Intergenic
1203132086 16_KI270728v1_random:1696523-1696545 GACACTCAGGAGACTGAGGCAGG - Intergenic
1203154446 16_KI270728v1_random:1863986-1864008 GATACTCAGGAGACTGAGGCAGG + Intergenic
1142994602 17:3753216-3753238 GACACAGAGGTGATGGAGGCTGG - Intronic
1143143669 17:4758697-4758719 GCCACTCAGGAGACTGAGGCAGG - Intergenic
1143370143 17:6434468-6434490 GATACTCAGGAGACTGAGGCAGG - Intronic
1143450607 17:7034656-7034678 GAAACTCAGGAGACTGAGGCAGG + Intergenic
1144376463 17:14647346-14647368 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1144795519 17:17888739-17888761 CACACTGAGGTGACTCTGCCAGG + Intronic
1145159066 17:20562383-20562405 GCTACTCAGGAGACTCAGGCAGG + Intergenic
1145860026 17:28201902-28201924 GACACTTAGGAGGCTGAGGCAGG + Intergenic
1145966844 17:28925218-28925240 GACCTTGTGGTGACTCAGGCTGG + Intronic
1146074536 17:29715852-29715874 GACACTGACTTGACTCAGCGGGG + Intronic
1146634556 17:34494448-34494470 GAGACTAAGGTGACTCTGGTGGG - Intergenic
1146693810 17:34893971-34893993 GACCCTGAGATGGCTCAGGGAGG - Intergenic
1146763774 17:35500615-35500637 GATACTCAGGAGACTGAGGCAGG + Intronic
1147428032 17:40355581-40355603 CACACAAAGGTGACACAGGCGGG - Intronic
1148772726 17:50076467-50076489 CACACTGAGGTGAGTGGGGCTGG + Exonic
1149283272 17:55131872-55131894 GACACTCAGGTGGCTGAGGTGGG - Intronic
1149799843 17:59557171-59557193 GCCACTGAAGTGGCTGAGGCAGG + Intergenic
1150103485 17:62444389-62444411 GACACTCAGGAGGCTGAGGCAGG - Intronic
1150122331 17:62614545-62614567 GATACTGAGGAGACTGAGGCAGG - Intronic
1150135832 17:62694457-62694479 GAGGCTGAGATGAGTCAGGCAGG + Intergenic
1150293595 17:63996157-63996179 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1150767717 17:68015422-68015444 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1150810592 17:68353811-68353833 GCTACTCAGGTGACTGAGGCAGG - Intronic
1150881013 17:69028276-69028298 GCCACTCAGGAGACTGAGGCAGG - Intronic
1151095773 17:71496175-71496197 GATACTTAGGAGACTGAGGCAGG + Intergenic
1151247463 17:72805858-72805880 GATACTTAGGAGACTGAGGCAGG - Intronic
1151560233 17:74866007-74866029 GACATTGTGCTGACTGAGGCGGG - Intronic
1151611732 17:75180604-75180626 GATACTCAGGAGACTGAGGCAGG + Intergenic
1152065345 17:78109517-78109539 GACACTCAGGAGGCTGAGGCGGG + Intergenic
1152157943 17:78647064-78647086 GACACTCAGGAGGCTGAGGCAGG + Intergenic
1152380895 17:79941832-79941854 GAAAGTGAGGTGACACAGCCAGG + Intronic
1152757913 17:82094675-82094697 GCCACTCAGGAGACTGAGGCAGG + Intronic
1153055518 18:942221-942243 GCTACTCAGGTGACTGAGGCAGG + Intergenic
1153216705 18:2827519-2827541 GATACTCAGGAGACTGAGGCAGG + Intergenic
1153306746 18:3638357-3638379 GACACTCAGGAGGCTGAGGCAGG - Intronic
1153377934 18:4402007-4402029 CACACTGAGGGGACACAGACAGG + Intronic
1153895597 18:9556302-9556324 GCCACTCAGGAGACTGAGGCAGG - Intronic
1154087403 18:11320771-11320793 GACACTGGGGAAACACAGGCAGG - Intergenic
1155239267 18:23849348-23849370 GTGACTGAGCTGACTCAGGCAGG - Intronic
1155435368 18:25807176-25807198 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1155848821 18:30744557-30744579 GCTACTGAGGAGACTGAGGCAGG + Intergenic
1156180925 18:34602889-34602911 GCTACTGAGGAGACTGAGGCAGG + Intronic
1157183305 18:45517048-45517070 GACACAGAGGTGAATGAGACTGG + Intronic
1158014203 18:52765143-52765165 GATACTCAGGTGGCTGAGGCAGG - Intronic
1158192427 18:54845293-54845315 GCCACTCAGGAGACTGAGGCAGG + Intronic
1159362300 18:67421083-67421105 GCCACTGAGGAGGCTGAGGCAGG - Intergenic
1160414951 18:78703389-78703411 GTCACTGAGCTGTCTCCGGCAGG - Intergenic
1160737403 19:670044-670066 GCCACTCAGGAGGCTCAGGCAGG - Intergenic
1160911814 19:1477949-1477971 GCCACTCAGGAGACTGAGGCAGG - Intronic
1160979768 19:1811627-1811649 GACTCAGACGTGACTCAGGAAGG - Exonic
1161371530 19:3914707-3914729 GATACTGAGGAGGCTGAGGCAGG + Intronic
1161446804 19:4323273-4323295 CAGACGGAGGGGACTCAGGCAGG - Intronic
1161557312 19:4951152-4951174 GCTACTGAGGTGGCTGAGGCAGG + Intronic
1161739627 19:6012825-6012847 GAGACTGAGGTGAGTCTAGCAGG - Intronic
1161848370 19:6725416-6725438 GACAGTGAGTGAACTCAGGCAGG - Intronic
1162255579 19:9486626-9486648 GACACTTGGGAGACTGAGGCAGG + Intronic
1162335337 19:10056749-10056771 GCCACTGAGGAGGCTAAGGCAGG - Intergenic
1162417069 19:10544414-10544436 GACCCACAGGTGACTCAGGACGG - Intronic
1162425689 19:10594130-10594152 GCCACTGAGGTGGGGCAGGCGGG - Intergenic
1162482196 19:10934336-10934358 GCCACTGAGGAGGCTGAGGCAGG + Intergenic
1162584918 19:11552709-11552731 GACACTGGGGCGACGCAGGAAGG + Intronic
1162849535 19:13419972-13419994 GCCACTCAGGAGACTGAGGCAGG + Intronic
1162992163 19:14310615-14310637 GACTCTGGGGTGATTTAGGCAGG - Intergenic
1163052757 19:14696848-14696870 GCTACTCAGGAGACTCAGGCAGG - Intronic
1163267190 19:16228344-16228366 GACACTGAGGGGACACCGCCTGG + Intronic
1163269491 19:16242863-16242885 GCTACTGAGGAGACTGAGGCAGG - Intronic
1163553119 19:17976825-17976847 GCCACTCAGGAGACTGAGGCAGG - Intronic
1163654666 19:18538757-18538779 GCTACTGAGGAGGCTCAGGCAGG - Intronic
1163766336 19:19165438-19165460 GTCTCTGAGGTGTCTCAGGGAGG + Intronic
1164648488 19:29875553-29875575 GATACTCAGGAGACTGAGGCAGG + Intergenic
1164660418 19:29960960-29960982 GCTACTCAGGAGACTCAGGCAGG - Intronic
1164696718 19:30250376-30250398 CACACTGTGGTGACACATGCAGG + Intronic
1164985879 19:32648152-32648174 GACACTCAGGAGGCTGAGGCAGG + Intronic
1164987223 19:32657348-32657370 GCTACTCAGGAGACTCAGGCAGG + Intronic
1165018946 19:32907247-32907269 GCCACTGGGGAGACTGAGGCAGG + Intronic
1165131741 19:33636787-33636809 GCTACTGAGGAGACTGAGGCAGG + Intronic
1165446960 19:35861761-35861783 GACACGGAGGAGACTGAGGAGGG - Intronic
1166193105 19:41188966-41188988 GCCACTGGGGTGGCTGAGGCAGG - Intergenic
1166528757 19:43529803-43529825 GACCCAGAGGTGACTCAGTCTGG + Intronic
1166668362 19:44695224-44695246 GACACTTAGGAGGCTGAGGCAGG - Intergenic
1166737579 19:45095242-45095264 GATACTGAGGAGGCTGAGGCAGG - Intronic
1166991522 19:46695663-46695685 GAGGCTGAGGGGACCCAGGCGGG + Intronic
1167281633 19:48572672-48572694 GGCACTGAGGTGCCACAGGAGGG + Intronic
1167340979 19:48915893-48915915 GCTACTCAGGTGACTGAGGCAGG - Intronic
1167400925 19:49268411-49268433 GCCACTCAGGAGACTGAGGCAGG + Intergenic
1167996250 19:53404897-53404919 GACAGTGAAATGACTGAGGCAGG - Intronic
1168282093 19:55311407-55311429 GACAGTGACCTGAGTCAGGCTGG + Intronic
925125056 2:1448406-1448428 GTCACGGAAGTGACTCAGGCGGG - Intronic
925264508 2:2557482-2557504 GACATTGTTGTGACTCTGGCTGG + Intergenic
925335896 2:3098936-3098958 GATACTCAGGAGACTAAGGCAGG + Intergenic
925364081 2:3299258-3299280 GACAATGAGCTGACCCAGGGCGG - Intronic
925702357 2:6651367-6651389 GATACTCAGGAGACTGAGGCAGG + Intergenic
925967128 2:9076391-9076413 CAAACTGGGGTGACTCACGCTGG + Intergenic
926186311 2:10693512-10693534 GTTACTGAGGTGGCTGAGGCAGG + Intergenic
926381066 2:12290057-12290079 GACACTCAGGAGGCTGAGGCAGG - Intergenic
927099171 2:19774757-19774779 GACAATGAAGTGACACAGTCAGG - Intergenic
927649310 2:24902190-24902212 GACACTAGGGAGACTGAGGCAGG - Intronic
927837251 2:26409041-26409063 GACACTCAGGAGGCTGAGGCAGG - Intronic
927895419 2:26778557-26778579 GAGACTGAGGCCACACAGGCTGG + Exonic
927983428 2:27390126-27390148 GCCACTCAGGAGACTGAGGCAGG - Intronic
928601321 2:32906486-32906508 GCCACTCAGGAGACTGAGGCAGG - Intergenic
928899104 2:36298752-36298774 GACAAAGAGATGAGTCAGGCTGG + Intergenic
929308557 2:40395263-40395285 GTCAGTCAGGAGACTCAGGCCGG - Intronic
929437635 2:41940551-41940573 GACACTGAGGTCATTCACGGTGG + Intronic
931189237 2:59983500-59983522 GAAACTCAGGAGAGTCAGGCTGG - Intergenic
931341775 2:61408779-61408801 GATACTGAGGAGGCTGAGGCAGG + Intronic
931715171 2:65023025-65023047 GACACAGAGTTGACCCAGCCAGG + Exonic
932290883 2:70578473-70578495 GCTACTCAGGTGACTGAGGCAGG - Intergenic
932768168 2:74484123-74484145 GTCACTGGGGTTACTGAGGCAGG + Intronic
933641904 2:84771174-84771196 GATACTCAGGAGACTGAGGCAGG + Intronic
933648362 2:84830249-84830271 GCAACAGAGCTGACTCAGGCAGG + Intronic
934899116 2:98143149-98143171 GCTACTGAGGAGACTGAGGCAGG - Intronic
937263443 2:120601050-120601072 GAAACTGAGGAGACACAGCCGGG - Intergenic
937408494 2:121651942-121651964 GCCACTCAGGAGACTGAGGCAGG + Intergenic
937824782 2:126356874-126356896 GTGACTGAGGTGACTCATGAGGG + Intergenic
938107501 2:128543349-128543371 CTCAGTGAGGTGACTTAGGCTGG + Intergenic
938295488 2:130176067-130176089 GCTACTGAGGAGACTGAGGCAGG - Intronic
938461136 2:131497760-131497782 GCTACTGAGGAGACTGAGGCAGG + Intergenic
939309399 2:140454908-140454930 GCCACTGTAGTGACTCAGGCAGG + Intronic
939341067 2:140896591-140896613 GCTACTCAGGTGACTGAGGCAGG - Intronic
939367315 2:141250241-141250263 GCTAATGAGGTGACTCAGGGTGG + Intronic
940736968 2:157464349-157464371 GACAATTAGGTTACTCTGGCAGG - Intronic
940878946 2:158926682-158926704 GACACTTAGGAGGCTGAGGCAGG - Intergenic
941790248 2:169544457-169544479 GCTACTGGGGTGACTGAGGCAGG + Intronic
941960004 2:171244286-171244308 GTTAATGAGGTGACTCAGGGTGG + Intergenic
942043887 2:172087969-172087991 GACAACAACGTGACTCAGGCTGG - Intronic
942141949 2:172985747-172985769 AACACTGTGGTGAGTCAGGAGGG - Intronic
942168744 2:173268442-173268464 GCCACTCAGGAGACTGAGGCAGG + Intergenic
943699674 2:190976026-190976048 GAATTTTAGGTGACTCAGGCAGG - Intronic
943785401 2:191872293-191872315 GACACTCAGGAGGCTGAGGCAGG + Intergenic
944416454 2:199484291-199484313 GACACTCAGGAGGCTGAGGCAGG - Intergenic
945075044 2:206030349-206030371 GTCACTCAGGAGACTGAGGCAGG + Intronic
945259112 2:207827863-207827885 GAGGCTGAGGTAACTGAGGCAGG - Intergenic
945755618 2:213842875-213842897 GCCACTCAGGAGACTGAGGCAGG - Intronic
946519691 2:220451416-220451438 GACACATTGGCGACTCAGGCAGG - Intergenic
948811247 2:240479530-240479552 TTCCCTGAGGTGGCTCAGGCAGG + Intronic
948900560 2:240954803-240954825 GCTAATGAGGTGACTCAGGGTGG - Intronic
1169434602 20:5574624-5574646 GACACTGGGGAGACTGAGGTGGG + Intronic
1169981746 20:11392603-11392625 GATACTCAGGAGACTGAGGCAGG - Intergenic
1170606873 20:17881478-17881500 GCTACTCAGGAGACTCAGGCAGG + Intergenic
1170648217 20:18215402-18215424 GATACTCAGGAGACTGAGGCAGG - Intergenic
1170784180 20:19453236-19453258 GCTACTCAGGTGACTGAGGCAGG + Intronic
1170921507 20:20683782-20683804 GAAAATGTGGTGATTCAGGCAGG - Intronic
1171520090 20:25769157-25769179 GACACTAGGGTGATTCAGACAGG + Intronic
1171556829 20:26087336-26087358 GACACTAGGGTGATTCAGACAGG - Intergenic
1172169473 20:32920312-32920334 GGCACTGGGGAGAATCAGGCCGG - Intronic
1172287398 20:33750491-33750513 CTCACTCAGGTCACTCAGGCTGG + Intronic
1172339691 20:34146445-34146467 GCCACTCAGGGGACTGAGGCAGG + Intergenic
1172855194 20:37996410-37996432 GACACTGAGGTAAATCAAGCAGG + Exonic
1172953455 20:38737977-38737999 GCCACTCAGGAGACTGAGGCAGG - Intergenic
1172964355 20:38823527-38823549 GCCACTCAGGTGGCTGAGGCAGG + Intronic
1173273601 20:41558716-41558738 GAGACTGAGGTGACTGAGAAGGG - Intronic
1173945343 20:46945918-46945940 GACACTGAGCTGTCTCACGCTGG + Intronic
1175010126 20:55726398-55726420 GACACTGAGGGGACACAGTGGGG + Intergenic
1175895182 20:62332909-62332931 GGCACTGAGGTCACACATGCAGG + Intronic
1176654222 21:9575433-9575455 GACACTAGGGTGATTCAGACAGG + Intergenic
1176733039 21:10519421-10519443 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1177070726 21:16503466-16503488 GCTACTCAGGAGACTCAGGCAGG + Intergenic
1179534754 21:42044295-42044317 GACACCGAGCTGAGGCAGGCTGG - Intergenic
1179555715 21:42174353-42174375 CCCACTCACGTGACTCAGGCTGG - Intergenic
1180013062 21:45064166-45064188 GACACTGGGGTGACTATGGAAGG - Intergenic
1180168382 21:46042270-46042292 GATACTTAGGAGACTGAGGCAGG + Intergenic
1180767619 22:18355275-18355297 GCTACTCAGGTGACTGAGGCAGG - Intergenic
1180778687 22:18507115-18507137 GCTACTCAGGTGACTGAGGCAGG + Intergenic
1180811413 22:18764423-18764445 GCTACTCAGGTGACTGAGGCAGG + Intergenic
1180845659 22:18980217-18980239 GTCACTGAGCTGAGCCAGGCAGG - Intergenic
1181197564 22:21198677-21198699 GCTACTCAGGTGACTGAGGCAGG + Intergenic
1181386340 22:22548538-22548560 GACACTTAGCTGACTGACGCTGG + Exonic
1181704185 22:24638504-24638526 GCTACTCAGGTGACTGAGGCAGG - Intergenic
1181926047 22:26359600-26359622 GACCCTGAGGTTACCCAGGCTGG - Intronic
1182025118 22:27111806-27111828 GCCACTCAGGAGGCTCAGGCGGG + Intergenic
1182154488 22:28056404-28056426 GTCACTCAGGAGACTGAGGCAGG - Intronic
1182827972 22:33282231-33282253 GCTACTCAGGTGACTGAGGCAGG + Intronic
1182908490 22:33959172-33959194 GCCACTCAGGAGACTGAGGCAGG - Intergenic
1183081256 22:35458118-35458140 GACATTGTGGTGACTCAGGCTGG + Intergenic
1183438645 22:37810071-37810093 CACCCTGAGGTGATCCAGGCAGG + Exonic
1183472809 22:38018621-38018643 GACTGTGAGGTGGCCCAGGCTGG + Intronic
1183813532 22:40278850-40278872 GCTACTCAGGAGACTCAGGCGGG - Intronic
1183885992 22:40882523-40882545 GCTACTCAGGTGGCTCAGGCAGG + Intronic
1183990637 22:41594989-41595011 GCTACTCAGGTGACTGAGGCAGG + Intergenic
1183997141 22:41643295-41643317 GCTACTCAGGTGACTGAGGCAGG + Intronic
1184160780 22:42696009-42696031 GCTACTCAGGTGACTGAGGCAGG + Intronic
1184295858 22:43524817-43524839 GCTACTCAGGTGACTGAGGCAGG - Intergenic
1184357751 22:43993993-43994015 GACACAGGGCTGAATCAGGCAGG + Intronic
1185154219 22:49183582-49183604 GTCACTGAGGTGACAAATGCTGG - Intergenic
1185272114 22:49934535-49934557 GTCAGTGGGGTGACTCAGGGTGG + Intergenic
1203229236 22_KI270731v1_random:96158-96180 GCTACTCAGGTGACTGAGGCAGG - Intergenic
949163600 3:911020-911042 GCCACTCAGGAGACTGAGGCAGG - Intergenic
950288907 3:11767735-11767757 GGCACTGAGGTGGCTGAGGCAGG - Intergenic
950743547 3:15068627-15068649 GACCCTCTGGTGACTCTGGCAGG - Intergenic
952080750 3:29754601-29754623 GACATTTTGGTGACTCAGGTGGG - Intronic
952284657 3:31956614-31956636 GCCACTCAGGAGACTGAGGCAGG + Intronic
952370606 3:32719135-32719157 GCCACTGAGGAGGCTGAGGCAGG + Intronic
952637586 3:35550477-35550499 GTCTGTGAGGTGGCTCAGGCAGG + Intergenic
952820599 3:37482682-37482704 GGTACTGAGGTGACACAGGTAGG + Intronic
953128370 3:40113253-40113275 GATACTCAGGAGGCTCAGGCAGG - Intronic
953514223 3:43574064-43574086 GCTACTGGGGTGACTGAGGCAGG - Intronic
953592041 3:44267404-44267426 GCCACTCAGGAGACTGAGGCAGG - Intronic
954022439 3:47754312-47754334 GCTACTGAGGAGGCTCAGGCAGG - Intronic
954067630 3:48119439-48119461 GATACTGAGGAGGCTGAGGCAGG + Intergenic
954332276 3:49897424-49897446 GACATAGAGGTGGCTTAGGCAGG + Intronic
956442898 3:69297562-69297584 CAACCTGAGGTGCCTCAGGCTGG - Intronic
957970736 3:87378445-87378467 GTTACTGAGGAGACTGAGGCAGG + Intergenic
958169075 3:89915859-89915881 GCTACTCAGGTGACTGAGGCAGG + Intergenic
958980289 3:100711212-100711234 GATACTCAGGAGACTGAGGCAGG - Intronic
960228919 3:115201663-115201685 GATACTCAGGAGACTGAGGCAGG - Intergenic
961062704 3:123844951-123844973 GCTACTGAGGTGGCTGAGGCAGG - Intronic
961354762 3:126330182-126330204 GATTCTGCTGTGACTCAGGCTGG - Intergenic
961619406 3:128211969-128211991 GCCACTGAGGAGGCTGAGGCAGG - Intronic
962750522 3:138431737-138431759 GACACAGAGGAGACACAGGAAGG - Intergenic
963437957 3:145295854-145295876 GATACTGAGGAGGCTGAGGCAGG + Intergenic
964394738 3:156233679-156233701 GAGAATGAGGTGGCCCAGGCAGG + Intronic
964860718 3:161197916-161197938 GACACTTGGGTGGCTGAGGCAGG + Intronic
965117556 3:164511678-164511700 GCTACTGAGGAGACTGAGGCAGG + Intergenic
965799046 3:172472752-172472774 GACACTCAGGAGGCTGAGGCAGG - Intergenic
966155827 3:176915369-176915391 GACACTCAGGAGCCTGAGGCAGG + Intergenic
966386660 3:179406722-179406744 GCTACTGAGGAGACTGAGGCAGG - Intronic
966720570 3:183058508-183058530 GCCACTCAGGAGGCTCAGGCAGG + Intronic
966912664 3:184568299-184568321 GACACTGGGCTGTGTCAGGCAGG - Intronic
967090261 3:186128995-186129017 GATACTGAGGAGGCTGAGGCAGG + Intronic
967332843 3:188309130-188309152 GATACTGAGGAGGCTAAGGCAGG - Intronic
967645430 3:191917372-191917394 GCCACTCAGGAGACTGAGGCAGG + Intergenic
968617507 4:1585396-1585418 GCTACTGAGGAGACTGAGGCAGG - Intergenic
968755586 4:2414188-2414210 AACCCTCAGGTGACTGAGGCTGG + Intronic
969166314 4:5318909-5318931 GATACTGAGGAGGCTGAGGCAGG - Intronic
969222920 4:5773064-5773086 GACACTGCGGTGACCGAGGCAGG - Intronic
969235292 4:5861332-5861354 GAGACAGAGATAACTCAGGCAGG + Intronic
969261898 4:6038899-6038921 GTCACTGAGCTGAGTGAGGCGGG - Intronic
969469024 4:7375629-7375651 GACACAAAGCTGGCTCAGGCTGG - Intronic
969929370 4:10615072-10615094 GTCACTCAGGTGACTGAAGCAGG + Intronic
970012958 4:11480780-11480802 GAAACTGAGTTGACTCATCCAGG + Intergenic
970739837 4:19222961-19222983 GCCACTCAGGAGACTGAGGCAGG + Intergenic
970881656 4:20939483-20939505 GATACTCAGGAGACTGAGGCAGG - Intronic
971917932 4:32898224-32898246 GATACTAAGGAGACTGAGGCGGG - Intergenic
971955109 4:33407416-33407438 GATACTCAGGAGACTGAGGCAGG + Intergenic
972638513 4:40905251-40905273 GAGACAGAGGTGACCCAGGCTGG - Intronic
974321271 4:60353407-60353429 GATACTGAGGAGACTGAGGCAGG + Intergenic
974475233 4:62370539-62370561 GCCACTCAGGAGACTGAGGCAGG + Intergenic
974700124 4:65432677-65432699 GATACTTAGGAGACTGAGGCGGG - Intronic
975351475 4:73351946-73351968 GCTACTCAGGAGACTCAGGCAGG - Intergenic
975582957 4:75923152-75923174 GACACTCAGGAGGCTGAGGCGGG - Intronic
976180587 4:82395181-82395203 TACACTGAGGTGACTCATGCTGG - Intergenic
978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG + Intergenic
979787949 4:124740150-124740172 GCTACTGAGGAGACTGAGGCAGG + Intergenic
979814419 4:125082362-125082384 GCCACTGAGGAGGCTGAGGCAGG + Intergenic
981419481 4:144532847-144532869 GTCACTCAGGTGGCTGAGGCAGG + Intergenic
981822648 4:148903577-148903599 GACACTGAGGAGCCATAGGCTGG - Intergenic
982300899 4:153878614-153878636 GCTAATGAGGTGACTCAGGGTGG - Intergenic
982361136 4:154520434-154520456 GAGACGGAGGTCACCCAGGCTGG + Intergenic
982522638 4:156438459-156438481 GCTACTGAGGAGACTGAGGCAGG + Intergenic
983041562 4:162934301-162934323 GAAACTGAGTTGACTAAGGTGGG - Intergenic
983755326 4:171328199-171328221 GATACTCAGGAGGCTCAGGCAGG + Intergenic
984069606 4:175094513-175094535 GGCACTGAGCTGGTTCAGGCAGG - Intergenic
984445810 4:179834167-179834189 GACTGTGAGGTTTCTCAGGCTGG - Intergenic
985259621 4:188103122-188103144 GCTACTCAGGTGACTGAGGCAGG - Intronic
985720656 5:1486955-1486977 GAAACTGAGGGGACTCATGGCGG - Intronic
987359128 5:17090931-17090953 GCTACTGGGGTGACTAAGGCAGG + Intronic
988215113 5:28262042-28262064 GCTACTGAGGAGACTGAGGCAGG - Intergenic
990143657 5:52734125-52734147 GCTACTCAGGTGGCTCAGGCAGG - Intergenic
990748430 5:58985019-58985041 GCCACTCAGGTGGCTGAGGCAGG - Intronic
991706828 5:69366868-69366890 GCTACTGAGGAGACTGAGGCAGG - Intronic
992302223 5:75394611-75394633 GCTACTGAGGAGACTGAGGCAGG + Intronic
992810303 5:80380742-80380764 GGTACTTAGGTGACTGAGGCAGG + Intergenic
993141342 5:84038030-84038052 GTCACTCAGGTCACTCAGGCTGG + Intronic
995129776 5:108618215-108618237 GCTAATGAGGTGACTCAGGGTGG + Intergenic
995156796 5:108924246-108924268 GCTACTCAGGAGACTCAGGCAGG + Intronic
995513364 5:112929772-112929794 GCTACTGAGGAGACTAAGGCAGG + Intergenic
996737431 5:126770836-126770858 GACACTTAGGAGGCTGAGGCAGG - Intergenic
997026772 5:130073397-130073419 GCCACTCAGGAGACTGAGGCAGG - Intronic
997058303 5:130470724-130470746 GATACTGAGGAGGCTGAGGCAGG - Intergenic
997530742 5:134579801-134579823 GACAGTGAGTAGACTCTGGCTGG - Exonic
997776333 5:136610168-136610190 GAAACTCAGGTGGCTGAGGCAGG + Intergenic
998213656 5:140220821-140220843 GACCATGAGGTGTCTCTGGCTGG + Intronic
999364963 5:151016953-151016975 GGCACTGAAGTGACGCAGGCTGG + Intergenic
999391529 5:151196261-151196283 GATACTGAGGAGGCTGAGGCAGG - Intronic
999929354 5:156413586-156413608 GATACTCAGGTGGCTGAGGCAGG - Intronic
999978229 5:156933677-156933699 GCCACTCAGGAGACTGAGGCAGG - Intronic
1000958987 5:167577040-167577062 GAAACTGAGGGGACCCACGCTGG + Intronic
1001921992 5:175608006-175608028 GCCACTTAGGAGACTGAGGCAGG + Intergenic
1002496991 5:179622597-179622619 GACACTCGGGAGACTGAGGCAGG + Intronic
1003403779 6:5811582-5811604 GGCCCTGGGGTGACTAAGGCAGG - Intergenic
1003583655 6:7366132-7366154 GCCACTCAGGAGACTCAGGCAGG + Intronic
1005946060 6:30596820-30596842 GCTACTGAGGAGACTGAGGCAGG - Intronic
1006026012 6:31147429-31147451 GACACTGAGGTACCCAAGGCAGG - Intronic
1006184553 6:32173719-32173741 GACACTGAGCTGTGTGAGGCAGG - Intronic
1006258696 6:32851168-32851190 GAGAGTGAGGTGAATCAGACAGG + Intronic
1006293581 6:33159517-33159539 GCTACTCAGGAGACTCAGGCAGG - Intergenic
1007501248 6:42298826-42298848 GCTACTCAGGAGACTCAGGCAGG + Intronic
1009406894 6:63324990-63325012 GCTACTCAGGGGACTCAGGCAGG + Intergenic
1010164533 6:72899955-72899977 GATACTCAGGAGACTGAGGCAGG - Intronic
1010417327 6:75627785-75627807 GTCACTCAGGAGACTGAGGCAGG - Intronic
1010435637 6:75826799-75826821 AGCAGTGAGGTGACTGAGGCAGG + Intronic
1011547939 6:88501028-88501050 GCCACTGAGGAGGCTGAGGCAGG + Intergenic
1011604928 6:89094030-89094052 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1013235427 6:108194370-108194392 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1013434003 6:110083479-110083501 GCCACTCAGGTGACTGAGGCAGG - Intergenic
1013538496 6:111085381-111085403 GATACTCAGGTGGCTGAGGCAGG - Intergenic
1013564724 6:111346593-111346615 GCTACTCAGGAGACTCAGGCGGG - Intronic
1014474020 6:121850642-121850664 GATACTGAGGAGGCTAAGGCAGG - Intergenic
1014801724 6:125786200-125786222 TACACTTACTTGACTCAGGCCGG - Intronic
1014993357 6:128110015-128110037 GACACTCAGGAGACTGAGGCAGG - Intronic
1016243491 6:141957861-141957883 GACACTGAGGCAGCTTAGGCTGG - Intergenic
1016835573 6:148473363-148473385 GACACTCAGGAGACTGAAGCAGG - Intronic
1017008364 6:150044586-150044608 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1017506618 6:155074457-155074479 GCCACTCAGGAGACTGAGGCAGG - Intronic
1018023149 6:159781658-159781680 GATACTCAGGAGACTGAGGCAGG + Intronic
1018297003 6:162358946-162358968 GATACTGAGGAGACTGAGTCAGG + Intronic
1018332811 6:162749630-162749652 GATACTCAGGGGACTGAGGCAGG - Intronic
1019326622 7:441606-441628 TCCAATGAGGTGACTCGGGCGGG - Intergenic
1020029533 7:4923213-4923235 GCTACTGAGGTGGCTGAGGCAGG - Intronic
1020110366 7:5444410-5444432 GCTACTGAGGAGGCTCAGGCAGG + Intronic
1020146348 7:5646842-5646864 TACTCTGAGTTGACTCAGCCAGG + Intronic
1020192870 7:6013837-6013859 GGCACTCAGGAGACTAAGGCAGG + Intronic
1020215906 7:6189922-6189944 GATACTCAGGAGACTGAGGCAGG + Intronic
1020264285 7:6550100-6550122 GATACTCAGGAGACTGAGGCAGG - Intronic
1021511662 7:21439784-21439806 GCCACTCAGGTGGCTGAGGCAGG + Intronic
1022042218 7:26591988-26592010 CACAGTGAGGTGGCCCAGGCAGG - Intergenic
1022277575 7:28870688-28870710 GCCAGTGTGGTGGCTCAGGCTGG - Intergenic
1022334687 7:29411460-29411482 TACACTGAGGTGGCTCTGGGTGG - Intronic
1022872533 7:34494194-34494216 GATACTCAGGAGACTGAGGCAGG + Intergenic
1023442191 7:40195823-40195845 GACACTCAGGAGGCTGAGGCAGG - Intronic
1023969076 7:44978388-44978410 GACACTGAGATGAAGCAGTCAGG - Intronic
1024646047 7:51371282-51371304 GACACTCAGGAGGCTGAGGCAGG - Intergenic
1025226083 7:57164718-57164740 GCTACTCAGGTGACTGAGGCAGG + Intergenic
1025280573 7:57624101-57624123 GACACTAGGGTGATTCAGACAGG + Intergenic
1025304157 7:57841406-57841428 GACACTAGGGTGATTCAGACAGG - Intergenic
1025804667 7:64819477-64819499 GCCACTGAGGAGACTGAGGCAGG - Intronic
1025902887 7:65761394-65761416 GCCACTCAGGAGACTGAGGCAGG - Intergenic
1026037817 7:66842186-66842208 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1026048564 7:66925130-66925152 GCCACTCAGGAGACTGAGGCAGG - Intronic
1026068335 7:67095544-67095566 GATACTGAGGAGGCTGAGGCAGG + Intronic
1026165387 7:67904655-67904677 GATACTCAGGAGACTGAGGCAGG - Intergenic
1026194142 7:68157768-68157790 GATACTCAGGCGACTGAGGCAGG + Intergenic
1026708584 7:72716748-72716770 GATACTGAGGAGGCTGAGGCAGG - Intronic
1026807226 7:73435983-73436005 GACCCTGTGGGGACTCAGCCTGG - Exonic
1027001899 7:74659337-74659359 GCCACTGAGGAGGCTGAGGCAGG - Intronic
1027938167 7:84636081-84636103 GATACTCAGGAGACTGAGGCAGG - Intergenic
1028393051 7:90337190-90337212 GCAAATGAGATGACTCAGGCTGG - Intronic
1029258118 7:99283206-99283228 GCCACTCAGGAGACTGAGGCAGG - Intergenic
1029524107 7:101084820-101084842 GATACTCAGGAGACTGAGGCAGG - Intergenic
1029681897 7:102117284-102117306 GCTACTGAGGTGGCTGAGGCAGG + Intronic
1029847584 7:103428672-103428694 GCTACTGAGGAGACTGAGGCAGG - Intronic
1030554719 7:111008928-111008950 GACACTGAGATGACTCAAAGTGG - Intronic
1032032677 7:128497592-128497614 GACACTCAGGAGGCTGAGGCAGG - Intronic
1032877127 7:136049701-136049723 GATACTGAGGAGGCTGAGGCAGG - Intergenic
1033394402 7:140959890-140959912 GCCACTGAGGAGGCTAAGGCGGG + Intergenic
1033880676 7:145879763-145879785 GATACTCAGGAGACTGAGGCAGG - Intergenic
1034045213 7:147920242-147920264 GCCACTCAGGAGACTGAGGCAGG + Intronic
1034465630 7:151226963-151226985 GACTCGGAGGGGACTCACGCGGG - Intronic
1034823632 7:154239878-154239900 GCTACTGAGGTGGCTGAGGCAGG + Intronic
1034931282 7:155165918-155165940 GACACTGAGGGAACTTTGGCTGG + Intergenic
1035098604 7:156377928-156377950 GACACTCAGGAGGCTGAGGCAGG + Intergenic
1035401089 7:158566240-158566262 GGCACTCAGGAGACTGAGGCAGG + Intronic
1037352140 8:17971853-17971875 GACACTCAGGGGGCTGAGGCAGG - Intronic
1037784850 8:21896467-21896489 GCCCCTGATGTGATTCAGGCAGG - Intergenic
1037834133 8:22206388-22206410 GATACTGAGGAGGCTAAGGCAGG + Intronic
1037981206 8:23255684-23255706 GACTCCTAAGTGACTCAGGCGGG - Intronic
1038473983 8:27849350-27849372 GCCACTCAGGAGACTGAGGCAGG + Intergenic
1038621298 8:29145517-29145539 GATACTGAGGAGGCTGAGGCAGG + Intronic
1038708568 8:29920260-29920282 GCTACTCAGGTGACTGAGGCAGG - Intergenic
1039305885 8:36262117-36262139 GATACTCAGGTGGCTGAGGCAGG + Intergenic
1039591155 8:38750059-38750081 GCCACTCAGGAGACTGAGGCAGG + Intronic
1039797758 8:40929726-40929748 GACAATGAGGAGAGTCAGGAGGG - Intergenic
1042301307 8:67285403-67285425 GATACTCAGGAGACTAAGGCAGG + Intronic
1043137263 8:76544039-76544061 GATACTGAGGAGGCTGAGGCAGG - Intergenic
1043428091 8:80168817-80168839 GACACAGAGGTTACTATGGCTGG + Intronic
1043466341 8:80511597-80511619 GCCACTGAGGAGGCTGAGGCGGG - Intronic
1043691464 8:83158663-83158685 GCTACTCAGGTGACTGAGGCAGG - Intergenic
1044842748 8:96351228-96351250 GCCACTGAGGAGACTGAGGCAGG + Intergenic
1045309923 8:100992254-100992276 GCTACTGAGGAGACTGAGGCAGG - Intergenic
1045918114 8:107497851-107497873 TACACGCAGCTGACTCAGGCAGG - Exonic
1046231310 8:111362047-111362069 GCCACTCAGGAGACTGAGGCAGG - Intergenic
1046983773 8:120364769-120364791 GACACTCAGGAGGCTGAGGCAGG + Intronic
1047436683 8:124840635-124840657 GGGACTGAGGAGAGTCAGGCTGG - Intergenic
1048005802 8:130418516-130418538 GAGACAGAGGTCACCCAGGCTGG - Intronic
1048291585 8:133185415-133185437 GACACAGAAGTGACCCAAGCCGG + Intergenic
1048482527 8:134812621-134812643 GATACTCAGGTGACTGAGGCAGG + Intergenic
1048922087 8:139240511-139240533 GATACTCAGGAGACTGAGGCAGG - Intergenic
1049152650 8:141045337-141045359 GATACTGAGGAGGCTGAGGCAGG + Intergenic
1049929725 9:444702-444724 GCTAATGAGGTGACTCATGCTGG - Intronic
1050639399 9:7651134-7651156 GCTACTCAGGTGACTGAGGCAGG + Intergenic
1050686364 9:8174337-8174359 GACACTGAGGTTCTTCTGGCTGG + Intergenic
1050727987 9:8674344-8674366 GGCACTCAGGAGACTGAGGCAGG + Intronic
1051075102 9:13223920-13223942 GATACTCAGGAGACTGAGGCAGG + Intronic
1051310584 9:15766765-15766787 GATACTCAGGAGGCTCAGGCAGG - Intronic
1052371674 9:27672468-27672490 GCCACTTAGGTGGCTGAGGCAGG - Intergenic
1053194622 9:36106992-36107014 GATACTCAGGAGACTGAGGCAGG + Intronic
1053346275 9:37380563-37380585 GCCACTCAGGTGGCTGAGGCAGG + Intergenic
1054924964 9:70579882-70579904 GACACTCAGTTGCCTCATGCTGG + Intronic
1056438155 9:86593563-86593585 GACACTCAGGAGGCTGAGGCTGG - Intergenic
1057124597 9:92606790-92606812 GCTACTGAGGAGACTGAGGCAGG + Intronic
1057206100 9:93173521-93173543 GACACTGGGCAAACTCAGGCTGG - Intergenic
1057251792 9:93509090-93509112 AGCACTCAGCTGACTCAGGCAGG - Intronic
1057357427 9:94343395-94343417 GATACTCAGGAGACTGAGGCAGG + Intergenic
1057725845 9:97567659-97567681 GACACAGAGAGGACTCTGGCTGG + Intronic
1059190710 9:112323138-112323160 GCTACTGAGGAGGCTCAGGCAGG + Intronic
1059313856 9:113407596-113407618 GATACTCAGGAGGCTCAGGCGGG + Exonic
1059798667 9:117727717-117727739 GCTACTGAGGTGCCTGAGGCAGG + Intergenic
1060388767 9:123259595-123259617 GATACTGAGGAGGCTGAGGCAGG + Intronic
1060736578 9:126070131-126070153 GCCACTGATGAGGCTCAGGCAGG + Intergenic
1061186998 9:129060642-129060664 GCCACCGAGGTGACTCGGGGTGG + Exonic
1061358608 9:130125484-130125506 GCTACTCAGGTGACTGAGGCGGG - Intronic
1062174184 9:135151779-135151801 GAGGCTGAGGAGGCTCAGGCAGG - Intergenic
1062288305 9:135783434-135783456 GAGTTTGAGGTGTCTCAGGCTGG - Intronic
1203631943 Un_KI270750v1:78891-78913 GACACTAGGGTGATTCAGACAGG + Intergenic
1185440926 X:227334-227356 GGCACCGAGGTGACCCGGGCGGG + Intergenic
1186237650 X:7530888-7530910 CACACTCAGGTGACTCATTCTGG + Intergenic
1186417464 X:9396154-9396176 GCTACTGAGGAGACTGAGGCAGG + Intergenic
1187212203 X:17242835-17242857 GACAATGATCTGACTGAGGCTGG - Intergenic
1187374608 X:18740519-18740541 GACACTCAGGAGGCTGAGGCAGG - Intronic
1188344233 X:29044316-29044338 GATACTCAGGAGGCTCAGGCAGG + Intronic
1188397624 X:29704555-29704577 GATACTCAGGAGACTGAGGCAGG + Intronic
1188690430 X:33122112-33122134 GTTACTGAGGAGGCTCAGGCAGG + Intronic
1190243077 X:48672832-48672854 GCCACTCAGGAGACTGAGGCAGG + Intergenic
1190539941 X:51466901-51466923 GATACAGAGATGACTCAAGCTGG + Intergenic
1190939558 X:55027394-55027416 GACAGAGAGGTGACTAAAGCAGG + Intronic
1190950755 X:55140560-55140582 GCTACTGAGGAGACTGAGGCAGG + Intronic
1192114897 X:68400711-68400733 GCCACTCAGGGGACTGAGGCAGG - Intronic
1192333274 X:70197323-70197345 GACACTGATGACACTCGGGCTGG + Intronic
1194379793 X:93177999-93178021 GACACAAAGGTGCCTCAGGAGGG - Intergenic
1195129431 X:101839176-101839198 GACACGGAGGTGAGTGAGGCCGG + Intronic
1195176807 X:102320653-102320675 GACACGGAGGTGAGTGAGGCCGG - Intronic
1195182057 X:102366440-102366462 GACACGGAGGTGAGTGAGGCCGG + Intronic
1195264743 X:103169581-103169603 GAGACAGAGGTCACCCAGGCTGG + Intergenic
1195651249 X:107287389-107287411 GCCACTCAGGTGAGTCATGCAGG - Intergenic
1196734120 X:118969961-118969983 GCTACTGAGGAGTCTCAGGCAGG - Intergenic
1199462402 X:148099123-148099145 GACACAGTGGTGACCCAGGTGGG - Intergenic
1200794409 Y:7327624-7327646 GATACTCAGGAGACTGAGGCAGG - Intergenic
1201272987 Y:12273510-12273532 GCTACTGAGGAGACTGAGGCAGG + Intergenic
1201470262 Y:14325523-14325545 GTCACTCAGGAGACTGAGGCAGG + Intergenic