ID: 901008583

View in Genome Browser
Species Human (GRCh38)
Location 1:6184205-6184227
Sequence GTCTTAAGACAGTTGATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901008583 Original CRISPR GTCTTAAGACAGTTGATATC TGG (reversed) Intronic
901008583 1:6184205-6184227 GTCTTAAGACAGTTGATATCTGG - Intronic
902261119 1:15225566-15225588 GTCCTAAGACAGTGAATCTCAGG + Intergenic
912402200 1:109403813-109403835 GTCTTAAGACATCTGATATCTGG + Intronic
912647190 1:111404420-111404442 GTCTTTAGAGAGTAGATATGGGG + Intergenic
917886251 1:179388172-179388194 TTTTTAAGACACTGGATATCAGG - Intronic
921761362 1:218918930-218918952 GTCTTAAGAAAGTCAACATCTGG - Intergenic
924843457 1:247739467-247739489 TTCTTCAGACAGTAGATAACAGG - Exonic
1063577810 10:7277702-7277724 GTCTTAAATCTGTTGAGATCAGG - Intronic
1066259483 10:33715340-33715362 GTGTTCTGACAGTTGACATCAGG + Intergenic
1069445981 10:68473507-68473529 GTCATAAAGCTGTTGATATCAGG - Intergenic
1072542397 10:96408051-96408073 GTCTTAAGACTGTTTATTTTGGG - Intronic
1073715505 10:106102064-106102086 CTCTTAAGACTGCTGACATCAGG - Intergenic
1074220696 10:111434890-111434912 GTCTTAAGACAACTGAGGTCTGG + Intergenic
1077715592 11:4576965-4576987 AACTTAAGACAGTTGATAGCAGG - Intronic
1077837935 11:5940744-5940766 GTTTCAAGACAGTAGACATCAGG + Intergenic
1083058132 11:59842788-59842810 GTCTTTAGACAGGTGATGGCTGG + Intronic
1084618949 11:70255279-70255301 TTCTAAATACAGTTGATTTCCGG - Intergenic
1091881448 12:3981800-3981822 GTTTTCTGACATTTGATATCAGG + Intergenic
1097983388 12:65757280-65757302 GTCTTAAGACAGTTGCTCTAAGG + Intergenic
1105362938 13:19737522-19737544 GTAATAAGACAGTTAACATCAGG - Intronic
1106997341 13:35501703-35501725 TTCTTAAAACAGTTAATATATGG + Intronic
1113419326 13:110158102-110158124 GTCTCAAAACAGTCAATATCTGG + Intronic
1117567094 14:57004701-57004723 ATCTTATGACAATTGCTATCTGG + Intergenic
1118826602 14:69388716-69388738 GTCTTAAAATAGTTGACAGCGGG - Intronic
1118947640 14:70402519-70402541 GTTTTTAGACACTTAATATCAGG + Intronic
1121421931 14:93822128-93822150 GGAGTAAGACAGTTGATTTCAGG - Intergenic
1125927616 15:43576119-43576141 GTCTTATGACAGTTCGTGTCAGG + Intronic
1125940759 15:43675684-43675706 GTCTTATGACAGTTCGTGTCAGG + Intergenic
1126705355 15:51400726-51400748 GTCCTAAAACAGGCGATATCTGG - Intronic
1130753403 15:86737385-86737407 GTCTTAAGACACATTATTTCTGG + Intronic
1137354586 16:47748414-47748436 GTCTCAAGACACTGGACATCAGG - Intergenic
1143503672 17:7352508-7352530 GTCTTCAGACAGTGGGTTTCCGG - Exonic
1144417595 17:15066305-15066327 GTCTTCAGACAGTTGGTTTCTGG + Intergenic
1144871689 17:18376074-18376096 TTCTGAAGACAGTTGATTGCAGG + Intergenic
1145218456 17:21069642-21069664 GGCTTAACACATTTGATCTCAGG - Intergenic
1159032008 18:63240996-63241018 GGCTTAAGATATTTGCTATCTGG - Intronic
1162684132 19:12367571-12367593 GTCTTAATGCAGTTGAGATAAGG - Intergenic
1165216392 19:34276656-34276678 ACCTTAAGACAGATGATATGAGG - Intronic
1168567507 19:57437150-57437172 GTCTTAAAACAGTTGTCCTCAGG + Intronic
930299931 2:49602738-49602760 GTCTTAAGAACATTGATATGAGG + Intergenic
935462540 2:103355100-103355122 GTCTTAAGATAGATGATCTGCGG - Intergenic
936387900 2:112046807-112046829 TTCTTAAGACACCGGATATCAGG - Intergenic
937212869 2:120288291-120288313 GTCTTAAAATATTTGATGTCTGG + Intronic
940689931 2:156903539-156903561 ATCTTGAGACACTTGATACCAGG + Intergenic
943907465 2:193517780-193517802 GTCTTTAAACAGTTGATCCCAGG - Intergenic
945765331 2:213969425-213969447 TTCTTAACACTGTTGATATTTGG - Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1172826887 20:37796408-37796430 GTTTTTAGACACTTGACATCAGG - Intronic
1177832593 21:26155693-26155715 GTCTAAAAATAATTGATATCTGG + Intronic
1182007010 22:26969389-26969411 GGCTTAAGACCTTTCATATCTGG + Intergenic
949773379 3:7603403-7603425 GTCATAAAACAGTAGAAATCTGG - Intronic
951754797 3:26078136-26078158 GTCTTAAGGCAGATGATAAAAGG - Intergenic
958144168 3:89602366-89602388 TTCTTAAGAAAGTTGAGTTCTGG + Intergenic
959530104 3:107426028-107426050 GTCCTACAACAGTTGTTATCTGG - Intergenic
962077267 3:132095759-132095781 GTTTTAAGAAAATTGCTATCAGG - Intronic
964540158 3:157770495-157770517 GTCTTAGGACACTTGCTGTCTGG - Intergenic
973015524 4:45132974-45132996 CTCTTTAGACATTAGATATCAGG - Intergenic
974431346 4:61800572-61800594 GTCTTAAAAAAGTTGATGTCTGG + Intronic
975063145 4:70028798-70028820 GTAATAAGAAAGTAGATATCAGG - Intronic
982844992 4:160240502-160240524 GTATCAAGACATTGGATATCAGG - Intergenic
984393472 4:179167517-179167539 GTTTTAAGACAGGTGAAATGGGG + Intergenic
987240272 5:15990367-15990389 GTCTTAAGACAAATGAAAACAGG - Intergenic
995363146 5:111322075-111322097 GTTATAAGACAGTTGTTTTCAGG + Intronic
996326811 5:122284695-122284717 TTTTTAAGACAGTAGATATTTGG + Intergenic
999463439 5:151777239-151777261 GTATTCAAACATTTGATATCTGG - Intronic
1004089605 6:12487611-12487633 GCCTTAGGACAGTTGATCTGAGG - Intergenic
1010897139 6:81378377-81378399 GTCTTAAAAATGTTGATGTCAGG + Intergenic
1012939303 6:105400678-105400700 TGCTTAAGAGAGTTGCTATCAGG - Intronic
1013990479 6:116249493-116249515 GTCTAGAGACAAATGATATCAGG - Exonic
1016275301 6:142344607-142344629 TTCTTAAGAAATCTGATATCAGG + Intronic
1020671778 7:11124073-11124095 TTCTGAAGAAAGTTGGTATCAGG + Intronic
1024778318 7:52815476-52815498 ATCTTAAAACAGTTGATAATAGG + Intergenic
1029166566 7:98595601-98595623 GACTTAAGACAGTTGGCATCAGG - Intergenic
1029812020 7:103058773-103058795 TTTTTAAGAAAGTTGAGATCTGG + Intronic
1031137119 7:117896934-117896956 GGCTTAATACTGTTGACATCTGG + Intergenic
1036590062 8:10161099-10161121 GTATTTAGAAAGTGGATATCTGG - Intronic
1037164948 8:15816111-15816133 GTCCAAAGACAGTTGCTAACTGG - Intergenic
1037893684 8:22637553-22637575 CTCTCAAGAGAGTTGATACCCGG - Intronic
1041055297 8:53979608-53979630 GTCTTAACAAAGGTGATCTCAGG - Intronic
1044096756 8:88076044-88076066 CTCTTAAGACAGTTCATATTCGG - Intronic
1044492799 8:92840146-92840168 GTTTTAAGACATTTGTTATCAGG - Intergenic
1046832909 8:118766105-118766127 TGCTTAAGATATTTGATATCTGG - Intergenic
1048708267 8:137179059-137179081 GTATTATGATAGTTAATATCAGG + Intergenic
1048944825 8:139434919-139434941 GGCTTAAGACATTTGCTACCTGG - Intergenic
1050371897 9:4930746-4930768 GTTTTAAGACAATAGATAGCTGG + Intergenic
1057166366 9:92929992-92930014 GTTTTAAGACATTTAATAGCAGG - Intergenic
1058279656 9:103098303-103098325 TTGTTAAGAAAGTTGATCTCAGG + Intergenic
1059992255 9:119876203-119876225 GACTTAATATAGTTGATATTTGG - Intergenic
1060080540 9:120639967-120639989 GTATAAAGACATTTGATATATGG - Intronic
1060237187 9:121872924-121872946 AACTTAAGACAGTAAATATCAGG + Intronic
1062123313 9:134846036-134846058 GTCTTTAAACAGTTGATGTTGGG - Intergenic
1186007145 X:5085266-5085288 GTCTAAAGAAAGTTGATTCCAGG + Intergenic
1186054971 X:5640726-5640748 GACTTAAGAGGGTTGATATCAGG - Intergenic
1187181659 X:16948022-16948044 GTGATAAGACTGTTAATATCAGG + Intronic
1188666284 X:32825291-32825313 GTCTTATGACAGTGGATAAGGGG - Intronic
1189369926 X:40419570-40419592 CTCTTAGGACAGTTGCTATGGGG - Intergenic
1193848435 X:86504382-86504404 ATCTTAAGACAATTGATTCCAGG - Intronic
1194996846 X:100600354-100600376 GTATTAAGACAGTGGAAATAAGG + Intergenic
1196157398 X:112446207-112446229 ATCTTTAGACAATTGTTATCTGG + Intergenic