ID: 901011686

View in Genome Browser
Species Human (GRCh38)
Location 1:6206055-6206077
Sequence TTCCCCGCCGGGTGTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011686_901011701 24 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011701 1:6206102-6206124 GTAGGAGAGGCCACGGCAGAGGG 0: 1
1: 0
2: 2
3: 44
4: 524
901011686_901011699 17 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011699 1:6206095-6206117 AGGAGAGGTAGGAGAGGCCACGG 0: 1
1: 0
2: 3
3: 98
4: 953
901011686_901011693 -10 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011693 1:6206068-6206090 CGGCGGGGAATTCCGAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 50
901011686_901011694 -3 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011694 1:6206075-6206097 GAATTCCGAGGGTGGGAGTGAGG 0: 1
1: 0
2: 6
3: 17
4: 247
901011686_901011702 27 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011702 1:6206105-6206127 GGAGAGGCCACGGCAGAGGGAGG 0: 1
1: 0
2: 5
3: 72
4: 665
901011686_901011700 23 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011700 1:6206101-6206123 GGTAGGAGAGGCCACGGCAGAGG 0: 1
1: 0
2: 5
3: 45
4: 405
901011686_901011697 6 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011697 1:6206084-6206106 GGGTGGGAGTGAGGAGAGGTAGG 0: 1
1: 2
2: 23
3: 235
4: 2123
901011686_901011696 2 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011696 1:6206080-6206102 CCGAGGGTGGGAGTGAGGAGAGG 0: 1
1: 0
2: 7
3: 132
4: 1113
901011686_901011698 11 Left 901011686 1:6206055-6206077 CCCAGAGGACACCCGGCGGGGAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 901011698 1:6206089-6206111 GGAGTGAGGAGAGGTAGGAGAGG 0: 1
1: 0
2: 12
3: 213
4: 1701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901011686 Original CRISPR TTCCCCGCCGGGTGTCCTCT GGG (reversed) Intronic
901011686 1:6206055-6206077 TTCCCCGCCGGGTGTCCTCTGGG - Intronic
902714808 1:18265414-18265436 CTCACCTCTGGGTGTCCTCTGGG + Intronic
905014938 1:34771376-34771398 TTGTCCTCAGGGTGTCCTCTAGG + Intronic
912920104 1:113858315-113858337 TTCTCAGCCAGGTGTACTCTGGG - Intronic
914431854 1:147625864-147625886 TTCCATGCCGAGCGTCCTCTTGG + Exonic
915346509 1:155200203-155200225 TTCCTGGCCAGTTGTCCTCTGGG - Intronic
915632543 1:157163463-157163485 TTCCCCTCCTGGTGACCTGTGGG + Intergenic
918805526 1:189036720-189036742 TTGCCCCCCTGGGGTCCTCTTGG + Intergenic
924800946 1:247329453-247329475 TTCCCAGCCCCGAGTCCTCTCGG - Exonic
1063884258 10:10561789-10561811 TTCCTGGCTGGGTGTCTTCTAGG + Intergenic
1063884450 10:10563229-10563251 TTCCTGGCTGGGTGTCTTCTAGG - Intergenic
1064100940 10:12463728-12463750 TTCCCCACCAGGTCTCATCTTGG + Intronic
1067142199 10:43667416-43667438 TTCCGCCGCGGCTGTCCTCTCGG - Intergenic
1067431487 10:46248819-46248841 TTCCCTGACTGCTGTCCTCTGGG - Intergenic
1077373291 11:2193649-2193671 TTCCCCTCCCTGTGTCCACTTGG - Intergenic
1090414133 11:126529132-126529154 CTCCCCGTCCTGTGTCCTCTTGG + Intronic
1090873626 11:130769593-130769615 TGCCCTGCCGGGTGTGATCTTGG - Intergenic
1094360527 12:29625778-29625800 TTCCCCACAGGCTGTCATCTCGG - Intronic
1103941594 12:124504165-124504187 TTCCCAGGCTGGAGTCCTCTCGG - Intronic
1118319232 14:64743454-64743476 TCACCCGCCGGTTGTCCTCCAGG - Exonic
1118750869 14:68807190-68807212 TCCCCCGCCGGCTGTCCACATGG - Intergenic
1121323902 14:93008638-93008660 TACCCGGCCGGCTGTGCTCTTGG + Intronic
1124689588 15:31810890-31810912 TGCCCTGCTGGGTGTCCTTTAGG - Intronic
1138495976 16:57409736-57409758 TTCCTGACAGGGTGTCCTCTTGG - Intronic
1140253152 16:73312501-73312523 TTCCCAGCCCACTGTCCTCTCGG - Intergenic
1140442838 16:74999916-74999938 TCCGCCGCCGGGCGCCCTCTCGG - Exonic
1141853069 16:86660757-86660779 TTCTATGCCAGGTGTCCTCTTGG - Intergenic
1142610859 17:1108746-1108768 CTCCCCGACCGGTGTCCTCGGGG - Intronic
1150292504 17:63989557-63989579 TCCCTCGCCGGGTGTACTCTGGG + Intergenic
1151876406 17:76869961-76869983 GGCCCCGCCGGGCGTCCACTGGG - Intronic
1162612733 19:11768642-11768664 TCCACCTCAGGGTGTCCTCTGGG - Intronic
1165141461 19:33702680-33702702 ATCCCCCTCGGGGGTCCTCTGGG - Intronic
1166101139 19:40572093-40572115 TTCCCCACCGTGTGTGCTCCCGG - Exonic
1166305645 19:41935706-41935728 TTCATCTCCGGGTGTCCACTTGG - Intergenic
1166924896 19:46260735-46260757 GTCCCAGCCGGGGGTCCCCTGGG + Intergenic
926312981 2:11687900-11687922 TTCAGCCCCCGGTGTCCTCTCGG - Intronic
927015842 2:18961041-18961063 TTTCCCTCCAGGTGGCCTCTTGG - Intergenic
927558204 2:24050313-24050335 TCCCCCGCCGGGCCTCCCCTCGG + Intronic
927917797 2:26947867-26947889 TTCCCCGCCTGCAGTCTTCTGGG + Exonic
928593354 2:32838987-32839009 TTCCTGGCCGTGTGACCTCTTGG - Intergenic
931881654 2:66576187-66576209 TTGCCCGCTGGATTTCCTCTCGG - Intergenic
946147671 2:217743212-217743234 TTCCCATCCGGGAGCCCTCTTGG - Intronic
1172307201 20:33889153-33889175 TTCCCTGCCTGTTTTCCTCTGGG + Intergenic
1174377973 20:50138935-50138957 GTCCCAGCTGGGTGACCTCTGGG - Intronic
1175958708 20:62624270-62624292 ATCCCGCCCGGGTCTCCTCTCGG + Intergenic
952906519 3:38142631-38142653 TTACCCTCAGGCTGTCCTCTGGG + Exonic
954870914 3:53766910-53766932 TCCCCAGTCTGGTGTCCTCTAGG + Intronic
956818270 3:72928851-72928873 TTCCTCGCCGGGAGTCGTCGGGG + Intronic
962951903 3:140227446-140227468 TTCCCTCCCGGCTGTCCTCATGG + Intronic
970516880 4:16840910-16840932 TTCCTTGCAGGGTCTCCTCTAGG - Intronic
976523636 4:86059888-86059910 TTTCCTGCCAGCTGTCCTCTGGG + Intronic
987511805 5:18848804-18848826 TTCCCCGCCTGGTGTTCTCACGG - Intergenic
988856129 5:35229741-35229763 TTCCCCGCCGGATGCCCGCGAGG + Intronic
997646429 5:135485032-135485054 GTCCCCCCCAGGTGGCCTCTGGG + Intergenic
1001932815 5:175685152-175685174 TTTTCCGCCTGGTGCCCTCTGGG - Intronic
1002801803 6:530562-530584 TTCCGGGCCCTGTGTCCTCTGGG - Intronic
1006424269 6:33954489-33954511 TGCCCCACAGGCTGTCCTCTAGG + Intergenic
1016364007 6:143296383-143296405 TTCCCCGAGGGGTGCCTTCTTGG + Intronic
1019428373 7:987761-987783 GTCCCCTCCGTGTGTCCTGTGGG + Intronic
1022597159 7:31723619-31723641 TTCCACACCTGTTGTCCTCTGGG + Intergenic
1024246125 7:47471739-47471761 CTCCCCCTCGGGTGTCCACTGGG + Intronic
1031401482 7:121329681-121329703 TGCCCAGCCGGGCGCCCTCTCGG - Exonic
1032578592 7:133081953-133081975 TTCCCCGCTAGGTCTCCGCTGGG - Exonic
1034522774 7:151632851-151632873 TTCGCAGCCGAGTGTCTTCTCGG + Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1047725428 8:127679948-127679970 TTCCCCACCCTGAGTCCTCTTGG - Intergenic
1052969939 9:34371243-34371265 ATCGCCGCCGGCTGTCCGCTGGG + Exonic
1053503653 9:38621825-38621847 TTCCCAGCCCGCTGTCCTGTGGG - Intergenic
1055102788 9:72482377-72482399 TTTCCTGCCAGGTGTCCTTTTGG - Intergenic
1058110490 9:101027371-101027393 TTCTCCTCTGGGTGTGCTCTAGG + Intergenic