ID: 901011784

View in Genome Browser
Species Human (GRCh38)
Location 1:6206415-6206437
Sequence CTGGACGCCCAGTCGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011771_901011784 16 Left 901011771 1:6206376-6206398 CCCTAACCTGGGCCCTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 57
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011774_901011784 4 Left 901011774 1:6206388-6206410 CCCTAGCGGCTCCCCACTCCATG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011769_901011784 20 Left 901011769 1:6206372-6206394 CCAGCCCTAACCTGGGCCCTAGC 0: 1
1: 0
2: 0
3: 20
4: 206
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011772_901011784 15 Left 901011772 1:6206377-6206399 CCTAACCTGGGCCCTAGCGGCTC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011779_901011784 -9 Left 901011779 1:6206401-6206423 CCACTCCATGACCTCTGGACGCC 0: 1
1: 0
2: 0
3: 14
4: 141
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011768_901011784 21 Left 901011768 1:6206371-6206393 CCCAGCCCTAACCTGGGCCCTAG 0: 1
1: 0
2: 1
3: 23
4: 239
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011767_901011784 22 Left 901011767 1:6206370-6206392 CCCCAGCCCTAACCTGGGCCCTA 0: 1
1: 0
2: 0
3: 29
4: 312
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011778_901011784 -8 Left 901011778 1:6206400-6206422 CCCACTCCATGACCTCTGGACGC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011765_901011784 27 Left 901011765 1:6206365-6206387 CCAGGCCCCAGCCCTAACCTGGG 0: 1
1: 0
2: 3
3: 98
4: 740
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011775_901011784 3 Left 901011775 1:6206389-6206411 CCTAGCGGCTCCCCACTCCATGA 0: 1
1: 1
2: 1
3: 12
4: 141
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011773_901011784 10 Left 901011773 1:6206382-6206404 CCTGGGCCCTAGCGGCTCCCCAC 0: 1
1: 0
2: 2
3: 16
4: 209
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
901011777_901011784 -7 Left 901011777 1:6206399-6206421 CCCCACTCCATGACCTCTGGACG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901011784 Original CRISPR CTGGACGCCCAGTCGGGTCC AGG Intronic
901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG + Intronic
902454279 1:16520951-16520973 CTGAACGCCCTGTGGGCTCCTGG + Intergenic
902498175 1:16889365-16889387 CTGAACGCCCTGTGGGCTCCTGG - Intronic
906609763 1:47193090-47193112 CTGCACGCCCAGTCTGGTATTGG - Intergenic
913655069 1:120952615-120952637 CTGAACGCCCGGTGGGCTCCCGG + Intergenic
914004106 1:143717638-143717660 CTGAATGCCCAGTGGGCTCCCGG + Intergenic
914480343 1:148060438-148060460 CTGAACGCCCGGTGGGCTCCTGG + Intergenic
914645254 1:149646775-149646797 CTGAACGCCCGGTGGGCTCCCGG + Intergenic
916184003 1:162113341-162113363 CTGGCGGCCCAGTGGGGTCCTGG + Intronic
919947238 1:202328539-202328561 CTGGCAGCCCAGTGTGGTCCAGG + Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922349599 1:224724338-224724360 CTGGATGCCCAGGCTGGTGCAGG + Intronic
1063128211 10:3154044-3154066 CTGGAGGCCCAGTCGGGGTGTGG - Intronic
1066439872 10:35428274-35428296 CTGGAGCCCCAGTCGGGATCAGG - Intronic
1066526402 10:36284026-36284048 CTGCATGCCCTGTGGGGTCCAGG - Intergenic
1081851663 11:46278533-46278555 CTTTGCGCCCAGTCTGGTCCTGG - Intronic
1090189680 11:124759868-124759890 CTGGACGCCCCCTGGGGACCCGG + Intronic
1092232237 12:6782684-6782706 CTGGAAGCCAAGTGAGGTCCAGG + Intergenic
1104737211 12:131143070-131143092 CTGGACGCCCAGCCTTGGCCAGG + Intergenic
1107695066 13:42992072-42992094 CTTGCCGCCCAGAAGGGTCCTGG + Exonic
1124189732 15:27564472-27564494 CTGTATGCACAGGCGGGTCCCGG + Intergenic
1136991421 16:35153392-35153414 CTGGAAGCACAGTGGGGTCAAGG + Intergenic
1139594016 16:67947858-67947880 CTGGTAGCCCTGTCAGGTCCCGG + Intronic
1139775127 16:69311847-69311869 CTGAACGCCCAGCCGGACCCCGG - Intronic
1139956473 16:70695613-70695635 CTGCACACCCAGTGGGGACCTGG - Exonic
1142066206 16:88064510-88064532 CTGGACGCCTAGCCGCATCCTGG - Intronic
1146057222 17:29587542-29587564 CTGGATGCCCAGTGGGCTCAGGG - Intronic
1150144369 17:62755367-62755389 CTGGATGCCCCTTCGTGTCCTGG + Intronic
1151275243 17:73029301-73029323 TTGGAAGCCCAGTTGGGTGCAGG + Intronic
1152144028 17:78556944-78556966 CTGGAAGCCGAGTCGGGAACCGG - Intronic
1156406194 18:36784964-36784986 CTGGAGGCCTAGTCGTGTACAGG + Intronic
1160760347 19:781075-781097 CTGGCCGCCCTGTGGGGCCCCGG + Intergenic
1160822978 19:1066981-1067003 GTGCACGCCCACTCGCGTCCGGG + Intronic
1163851841 19:19668829-19668851 CCGGCCCCCCATTCGGGTCCGGG + Intronic
1164735851 19:30540325-30540347 CTGCACACCCAGTCGGGTGTAGG + Intronic
1165447247 19:35863053-35863075 CTGGAGGCACAGTCAGGTCTGGG - Intronic
928964857 2:36966441-36966463 ATGGACGAGCAGGCGGGTCCCGG - Exonic
933596574 2:84288939-84288961 CTGGAAGCCCTCTCGAGTCCTGG - Intergenic
938168923 2:129057728-129057750 CTTTACGCACAGTCGGGGCCTGG + Intergenic
938381183 2:130837334-130837356 CTGCGCGCCCAGGCCGGTCCAGG - Intronic
942401879 2:175611400-175611422 CTGTTCGGCCACTCGGGTCCTGG - Intergenic
1172806470 20:37615444-37615466 CTGGACACCCAGGAGGCTCCGGG + Intergenic
1176301219 21:5100026-5100048 CTGGACACTCACTCGGGGCCTGG - Intergenic
1179855811 21:44161873-44161895 CTGGACACTCACTCGGGGCCTGG + Intergenic
1180949665 22:19715337-19715359 CTGGGTGCCCAGATGGGTCCTGG + Intronic
1182284008 22:29233428-29233450 CTGGAGGCCCAGTGGGTCCCTGG - Exonic
1184058998 22:42070684-42070706 CCGGACTTCCAGCCGGGTCCGGG + Exonic
954640053 3:52092451-52092473 CTGGACCCCGAGGCTGGTCCAGG + Intronic
956482500 3:69687330-69687352 CAGGACGCCCAGGCAGGGCCTGG - Intergenic
968518857 4:1026721-1026743 CTGAAAGACCAGGCGGGTCCCGG - Exonic
979888906 4:126065177-126065199 CTAGAAGCACAGTGGGGTCCTGG + Intergenic
984639444 4:182145066-182145088 CTGGGCGCCCAGTGGGGGCGGGG + Intronic
986257264 5:6110746-6110768 CTGGACGTGCAGTCTGGCCCTGG - Intergenic
988615663 5:32772378-32772400 CTGGACCCACAGTCCAGTCCTGG - Intronic
998231883 5:140366118-140366140 GTGGACACTCAGTCAGGTCCAGG - Intronic
1011698253 6:89932583-89932605 CTGGGTGCCCAGGGGGGTCCGGG + Exonic
1019480468 7:1264467-1264489 CTGGAATCCCAGCCGGGCCCCGG - Intergenic
1023864313 7:44231703-44231725 CTGGACGTCCAGTCAGGCCCCGG + Intronic
1024192300 7:47024897-47024919 TTGGATGCCCAGTGGGCTCCAGG + Intergenic
1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG + Intergenic
1024284348 7:47744409-47744431 CTGGACGCCCAGAGGGGTGGAGG + Intronic
1028718740 7:94004493-94004515 CCGGACGCCCCGTCCGCTCCTGG - Intergenic
1034439061 7:151077322-151077344 CTGGAGGCACAGTCAGGTCCTGG + Exonic
1035675864 8:1455224-1455246 GTGGACGCCCAGTCAGGTGCAGG + Intergenic
1044916408 8:97116911-97116933 CTGGATGCTCTGTTGGGTCCAGG + Intronic
1049579405 8:143404576-143404598 CTGGATACCCAGGCAGGTCCTGG + Intergenic
1057258352 9:93568705-93568727 TTGGATGCCCAGTGGGCTCCAGG + Intergenic
1057294819 9:93828693-93828715 CTGGAGGCCCAGACAGGTCAGGG - Intergenic
1057794687 9:98146727-98146749 CTGGGCTCCCATTCGGGTCCTGG + Intronic
1060520251 9:124290319-124290341 CCGGACTCCCAGTCAGGACCTGG - Intronic
1060545033 9:124454501-124454523 CAGGATGCCCAGTCGTGGCCTGG + Exonic
1061099128 9:128478847-128478869 CTGGAGTCCGAGTCGGCTCCAGG + Intronic
1061450824 9:130666154-130666176 CTGGACACACAGTGGGCTCCCGG + Intronic
1062529697 9:136994420-136994442 TTGGGAGCCCAGTCCGGTCCTGG + Intergenic
1197708645 X:129651201-129651223 CTGAACCCCCAGCCGGGCCCTGG + Intronic
1199773404 X:150989839-150989861 CTCTCCGCCCTGTCGGGTCCTGG + Exonic