ID: 901011895 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:6206862-6206884 |
| Sequence | TGGCGGGGAGAGCTAAGGAC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 176 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 12, 4: 162} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901011895_901011901 | -6 | Left | 901011895 | 1:6206862-6206884 | CCGGTCCTTAGCTCTCCCCGCCA | 0: 1 1: 0 2: 1 3: 12 4: 162 |
||
| Right | 901011901 | 1:6206879-6206901 | CCGCCAGAAGTTGCAGGCTTCGG | 0: 1 1: 0 2: 1 3: 7 4: 92 |
||||
| 901011895_901011904 | 27 | Left | 901011895 | 1:6206862-6206884 | CCGGTCCTTAGCTCTCCCCGCCA | 0: 1 1: 0 2: 1 3: 12 4: 162 |
||
| Right | 901011904 | 1:6206912-6206934 | AGATCAGCTTAACTGAAGCCTGG | 0: 1 1: 0 2: 0 3: 8 4: 110 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901011895 | Original CRISPR | TGGCGGGGAGAGCTAAGGAC CGG (reversed) | Intronic | ||