ID: 901011895

View in Genome Browser
Species Human (GRCh38)
Location 1:6206862-6206884
Sequence TGGCGGGGAGAGCTAAGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011895_901011904 27 Left 901011895 1:6206862-6206884 CCGGTCCTTAGCTCTCCCCGCCA 0: 1
1: 0
2: 1
3: 12
4: 162
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011895_901011901 -6 Left 901011895 1:6206862-6206884 CCGGTCCTTAGCTCTCCCCGCCA 0: 1
1: 0
2: 1
3: 12
4: 162
Right 901011901 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901011895 Original CRISPR TGGCGGGGAGAGCTAAGGAC CGG (reversed) Intronic