ID: 901011896

View in Genome Browser
Species Human (GRCh38)
Location 1:6206867-6206889
Sequence ACTTCTGGCGGGGAGAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011896_901011904 22 Left 901011896 1:6206867-6206889 CCTTAGCTCTCCCCGCCAGAAGT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901011896 Original CRISPR ACTTCTGGCGGGGAGAGCTA AGG (reversed) Intronic