ID: 901011900

View in Genome Browser
Species Human (GRCh38)
Location 1:6206879-6206901
Sequence CCGAAGCCTGCAACTTCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011900_901011904 10 Left 901011900 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011900_901011905 26 Left 901011900 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 901011905 1:6206928-6206950 AGCCTGGAGATTGCAGTTACTGG 0: 1
1: 0
2: 1
3: 6
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901011900 Original CRISPR CCGAAGCCTGCAACTTCTGG CGG (reversed) Intronic