ID: 901011900

View in Genome Browser
Species Human (GRCh38)
Location 1:6206879-6206901
Sequence CCGAAGCCTGCAACTTCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011900_901011904 10 Left 901011900 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011900_901011905 26 Left 901011900 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 901011905 1:6206928-6206950 AGCCTGGAGATTGCAGTTACTGG 0: 1
1: 0
2: 1
3: 6
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901011900 Original CRISPR CCGAAGCCTGCAACTTCTGG CGG (reversed) Intronic
900459611 1:2796548-2796570 CCCAAGCCTGCAACACTTGGGGG + Intronic
901011900 1:6206879-6206901 CCGAAGCCTGCAACTTCTGGCGG - Intronic
902153898 1:14467821-14467843 GCTAAGCCTGGAGCTTCTGGGGG - Intergenic
903332007 1:22601227-22601249 CCTCAGCCTGCTTCTTCTGGGGG + Intronic
903726064 1:25445848-25445870 CCTAATCCTGCCAATTCTGGAGG - Intronic
904152338 1:28452429-28452451 CTGCAGCCTCCAACTCCTGGTGG - Intronic
909928221 1:81463521-81463543 CCCAAGGCTGCAACTGCTGTCGG + Intronic
912861883 1:113220631-113220653 CCGAAGCCAGTAGCTTCTAGTGG + Intergenic
920750854 1:208675420-208675442 CCTAAGCCAGCAATTGCTGGAGG + Intergenic
922329209 1:224558835-224558857 CCAAATGCTGCAACTTCTGAAGG + Intronic
922505939 1:226125675-226125697 CCAAATCCTGCATCTTCTGCAGG - Intergenic
923808006 1:237281662-237281684 CCAATGCCTGCACCATCTGGGGG - Intronic
1062816051 10:500831-500853 CTGAAGCCTGAAACCTATGGGGG - Intronic
1069930886 10:71880911-71880933 CCGCAGACTGTAACCTCTGGAGG - Intergenic
1071238526 10:83677953-83677975 CAGCAGCCAGCAACTCCTGGTGG - Intergenic
1071627582 10:87188423-87188445 CAAAAGCCTTCAACTGCTGGAGG - Intronic
1072657724 10:97342106-97342128 CCTAAGCCTGGCACTTCTGTGGG - Intergenic
1073123201 10:101134269-101134291 CCGAGGCCAGGTACTTCTGGCGG - Exonic
1073329689 10:102661904-102661926 CTGCAGCCTGTAAATTCTGGGGG + Intergenic
1075025985 10:118983416-118983438 CAGAAGCTTGCAACTTCCAGGGG + Intergenic
1076130271 10:128009147-128009169 CAGCAGCCTGCACATTCTGGAGG + Intronic
1078105893 11:8357735-8357757 CTGAAGGCTGCAATTCCTGGGGG - Intergenic
1079054489 11:17194010-17194032 CCAAAGCCTGCATCTTCTTTAGG - Intronic
1079127567 11:17729960-17729982 CTGAAGCCTGGAAGTTTTGGGGG - Intergenic
1084475615 11:69386999-69387021 CGGTGGCCTGCAACTTATGGCGG - Intergenic
1094865673 12:34527728-34527750 CCGAAGCTTGAGTCTTCTGGTGG - Intergenic
1099862565 12:88238699-88238721 CAGAAGCCTGGAGCCTCTGGGGG + Intergenic
1102236972 12:111299479-111299501 CCCAGGCCTGCACCTTCTGGTGG - Intronic
1113867045 13:113533162-113533184 CCCACGTCTGCAACTTCAGGAGG - Intronic
1124475345 15:30028397-30028419 CCCCAGCCAGCCACTTCTGGTGG - Intergenic
1125969241 15:43898733-43898755 CCCAAGCCTACAGCTGCTGGAGG - Intronic
1126112477 15:45183841-45183863 CTGAGGCCTGCAGCTACTGGGGG - Intronic
1135492550 16:22922430-22922452 ACCAAGCTTGCAACTTCTGGGGG - Intergenic
1138519920 16:57565141-57565163 CCAAAGCCTGGTACTGCTGGGGG + Exonic
1140234716 16:73147792-73147814 CTGCAGCCTGGAACTCCTGGGGG - Intergenic
1142835967 17:2586989-2587011 CTCAAGCATGCAACTTCTCGGGG + Intergenic
1148852597 17:50562038-50562060 CCGAAGCTTCCCACATCTGGAGG - Intronic
1150733739 17:67717814-67717836 TCGCAGCCTGCGACCTCTGGCGG - Exonic
1151715310 17:75828060-75828082 CCCAATCCTGCAGCTGCTGGAGG - Exonic
1155843794 18:30679886-30679908 CAGAAGCCTTGGACTTCTGGAGG + Intergenic
1156208406 18:34911093-34911115 CCCTATCCTGCAATTTCTGGAGG + Intergenic
1160411794 18:78680034-78680056 ACAAAGCCTCCAAATTCTGGCGG + Intergenic
1161414053 19:4134851-4134873 CCAAAGCCAGCTCCTTCTGGTGG + Intergenic
1161584097 19:5095806-5095828 CTCAAGCCTGCAGCTGCTGGGGG - Intronic
1164378027 19:27706658-27706680 CCGAAGCTTGAATCTTCTGGTGG + Intergenic
1164579454 19:29425526-29425548 CCCAAGCCAGCAACTTCTGGTGG - Intergenic
1165340262 19:35206324-35206346 TCTAAGCCTGGAACTGCTGGAGG + Intergenic
927431954 2:23034383-23034405 CCTAAGCCAGAACCTTCTGGTGG - Intergenic
927856727 2:26532373-26532395 CTGAAGCCTGGTACTGCTGGGGG + Intronic
932907907 2:75773858-75773880 CCAATGCCTGCAGCTTCTGAGGG + Intergenic
935568795 2:104637208-104637230 CCAAAGCCTGCAACTTCCCATGG + Intergenic
936146812 2:109985994-109986016 GCCCAGCCAGCAACTTCTGGTGG - Intergenic
936197880 2:110385485-110385507 GCCCAGCCAGCAACTTCTGGTGG + Intergenic
938260741 2:129893434-129893456 CTGGAGCCTGCGGCTTCTGGAGG - Intergenic
942533786 2:176941498-176941520 CCGAAGCCCTGAACTTCTAGTGG - Intergenic
945748259 2:213746251-213746273 CAGAACTCTGCAACTTCAGGCGG - Intronic
1172167712 20:32909006-32909028 CCCAAGCCTCCACCTTCTTGTGG - Intronic
1172507601 20:35475118-35475140 CTGAAGCCTCAAACTCCTGGGGG - Intronic
1172666687 20:36605332-36605354 CCTAACCCTGCAAGTTCTGTAGG - Intronic
1173499292 20:43540544-43540566 CCGAAGCCTGCCTCTCCTGCTGG - Intronic
1177241046 21:18457728-18457750 CCTAAGCCTTCTACTTCTAGGGG + Intronic
1179417194 21:41208354-41208376 CAGGTGCCTGCACCTTCTGGGGG + Intronic
949808684 3:7982778-7982800 CTGAAGTCTCCAACTTCTCGTGG - Intergenic
960260295 3:115560250-115560272 TGGAAGCCTGCATCTTTTGGGGG + Intergenic
963275722 3:143327924-143327946 TCTAAGTCTGCAACTTCTAGTGG - Intronic
966688749 3:182723253-182723275 CCGAAGTGTCCAACTTCAGGAGG + Intergenic
969970354 4:11040582-11040604 TTGAACGCTGCAACTTCTGGAGG + Intergenic
974297465 4:60020545-60020567 CCTGAGACTGCCACTTCTGGTGG + Intergenic
974780141 4:66543863-66543885 CTGAAGCCAGCAACTTTTGGAGG - Intergenic
984358509 4:178696680-178696702 CTGCAGCCTGGAACCTCTGGAGG + Intergenic
986581161 5:9267228-9267250 CAGAAGCCTGCAAAGTGTGGCGG - Intronic
986873736 5:12081192-12081214 CAGCAGCCTGCAGCTGCTGGAGG - Intergenic
988752033 5:34197691-34197713 CCGAAGCCTTTAACTTGTGTTGG + Intergenic
989318598 5:40109553-40109575 CCGAAGCTTGAGTCTTCTGGTGG - Intergenic
992007251 5:72490110-72490132 TTGAAGCCTGGAACTTGTGGAGG - Intronic
994492725 5:100468027-100468049 TGGAGGCTTGCAACTTCTGGGGG + Intergenic
996974309 5:129412303-129412325 CTGAAGCCTTGAACTCCTGGGGG + Intergenic
1001561502 5:172672289-172672311 CAGAAACCTGCATCTCCTGGAGG - Intronic
1002128560 5:177065094-177065116 GGAAAGCCTGCACCTTCTGGGGG - Exonic
1006112996 6:31760015-31760037 CCAAAGGCTACATCTTCTGGGGG + Intronic
1008215040 6:48778215-48778237 CTGAAGCCAGCAACTTTTAGAGG + Intergenic
1011705902 6:90001369-90001391 ACCAAGCCTGCAGCTTCAGGAGG + Intronic
1018105037 6:160477709-160477731 CCAAAGCCTTAAGCTTCTGGTGG + Intergenic
1018113149 6:160556605-160556627 CCAAAGCCTTAAGCTTCTGGTGG + Intronic
1018148200 6:160913032-160913054 CCAAAGCCTTCAGCTTCTGGGGG - Intergenic
1018480072 6:164181222-164181244 CCAAAGCCAACAAATTCTGGTGG + Intergenic
1018652146 6:166001601-166001623 CCCAACCCTGCAAACTCTGGCGG - Intergenic
1019438766 7:1036242-1036264 CCGAAGTCCGCAGCTTATGGGGG - Intronic
1020481630 7:8669119-8669141 CTGAAGCCTGTATCTGCTGGAGG + Intronic
1022803593 7:33799356-33799378 CCCAAGCCTGCATCTTCGGTTGG + Intergenic
1024305340 7:47924183-47924205 CCCCAGCCTCCAAATTCTGGGGG - Intronic
1024481149 7:49864663-49864685 CAGAGGCCTGCATCTTCTGTTGG + Intronic
1024809826 7:53195741-53195763 CCGGAGCCTGCACCTTCCAGTGG - Intergenic
1026374295 7:69735047-69735069 CAGAATCCTGGAGCTTCTGGAGG - Intronic
1028786616 7:94801631-94801653 CCCAAGCTTGCAGCTTCAGGAGG - Intergenic
1031885646 7:127243272-127243294 CCTGAGGCTGCACCTTCTGGAGG + Exonic
1032931593 7:136678469-136678491 CCAAAGCCTGGTAGTTCTGGTGG + Intergenic
1034407079 7:150911752-150911774 CCCCAGCCTGCCACTTCTGCAGG - Intergenic
1037831315 8:22191350-22191372 CCTAAGCCTGGAGCTTCTTGAGG + Intronic
1039280190 8:35976199-35976221 CTGAAGGCTACAACTTCTGTTGG + Intergenic
1040546820 8:48404536-48404558 GCAAAGCCTGCAACTACAGGGGG - Intergenic
1042984852 8:74572019-74572041 CTGAAGCTAGCAACTTCTAGCGG - Intergenic
1057024004 9:91722275-91722297 CTGGAGCCTGGCACTTCTGGGGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057528334 9:95822373-95822395 CAGCAGCTTGCAACTTCTTGGGG + Intergenic
1058068956 9:100582421-100582443 CTGCAGCCTCCAACTGCTGGGGG + Intronic
1187446928 X:19368666-19368688 CCAAACCCTGCTACTTCTGCAGG + Intronic
1187750901 X:22463870-22463892 CTGAAGGCTGGAAATTCTGGGGG - Intergenic
1198403213 X:136287582-136287604 CTGAAGCCAGCAATTTCTGGAGG - Intergenic