ID: 901011901

View in Genome Browser
Species Human (GRCh38)
Location 1:6206879-6206901
Sequence CCGCCAGAAGTTGCAGGCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011895_901011901 -6 Left 901011895 1:6206862-6206884 CCGGTCCTTAGCTCTCCCCGCCA 0: 1
1: 0
2: 1
3: 12
4: 162
Right 901011901 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 7
4: 92
901011894_901011901 -5 Left 901011894 1:6206861-6206883 CCCGGTCCTTAGCTCTCCCCGCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 901011901 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 7
4: 92
901011890_901011901 29 Left 901011890 1:6206827-6206849 CCAACTTCAGGCAGAACGACTGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 901011901 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901011901 Original CRISPR CCGCCAGAAGTTGCAGGCTT CGG Intronic