ID: 901011903 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:6206903-6206925 |
| Sequence | AGTTAAGCTGATCTATAAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 265 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 20, 4: 243} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901011903_901011905 | 2 | Left | 901011903 | 1:6206903-6206925 | CCATTTTATAGATCAGCTTAACT | 0: 1 1: 0 2: 1 3: 20 4: 243 |
||
| Right | 901011905 | 1:6206928-6206950 | AGCCTGGAGATTGCAGTTACTGG | 0: 1 1: 0 2: 1 3: 6 4: 156 |
||||
| 901011903_901011909 | 30 | Left | 901011903 | 1:6206903-6206925 | CCATTTTATAGATCAGCTTAACT | 0: 1 1: 0 2: 1 3: 20 4: 243 |
||
| Right | 901011909 | 1:6206956-6206978 | GACCTCCCATCAAAAGTCAGAGG | 0: 1 1: 0 2: 0 3: 7 4: 123 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901011903 | Original CRISPR | AGTTAAGCTGATCTATAAAA TGG (reversed) | Intronic | ||