ID: 901011904

View in Genome Browser
Species Human (GRCh38)
Location 1:6206912-6206934
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011898_901011904 12 Left 901011898 1:6206877-6206899 CCCCGCCAGAAGTTGCAGGCTTC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011899_901011904 11 Left 901011899 1:6206878-6206900 CCCGCCAGAAGTTGCAGGCTTCG 0: 1
1: 0
2: 1
3: 10
4: 89
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011894_901011904 28 Left 901011894 1:6206861-6206883 CCCGGTCCTTAGCTCTCCCCGCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011900_901011904 10 Left 901011900 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011902_901011904 7 Left 901011902 1:6206882-6206904 CCAGAAGTTGCAGGCTTCGGTCC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011896_901011904 22 Left 901011896 1:6206867-6206889 CCTTAGCTCTCCCCGCCAGAAGT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
901011895_901011904 27 Left 901011895 1:6206862-6206884 CCGGTCCTTAGCTCTCCCCGCCA 0: 1
1: 0
2: 1
3: 12
4: 162
Right 901011904 1:6206912-6206934 AGATCAGCTTAACTGAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type