ID: 901011905

View in Genome Browser
Species Human (GRCh38)
Location 1:6206928-6206950
Sequence AGCCTGGAGATTGCAGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901011900_901011905 26 Left 901011900 1:6206879-6206901 CCGCCAGAAGTTGCAGGCTTCGG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 901011905 1:6206928-6206950 AGCCTGGAGATTGCAGTTACTGG 0: 1
1: 0
2: 1
3: 6
4: 156
901011903_901011905 2 Left 901011903 1:6206903-6206925 CCATTTTATAGATCAGCTTAACT 0: 1
1: 0
2: 1
3: 20
4: 243
Right 901011905 1:6206928-6206950 AGCCTGGAGATTGCAGTTACTGG 0: 1
1: 0
2: 1
3: 6
4: 156
901011902_901011905 23 Left 901011902 1:6206882-6206904 CCAGAAGTTGCAGGCTTCGGTCC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 901011905 1:6206928-6206950 AGCCTGGAGATTGCAGTTACTGG 0: 1
1: 0
2: 1
3: 6
4: 156
901011899_901011905 27 Left 901011899 1:6206878-6206900 CCCGCCAGAAGTTGCAGGCTTCG 0: 1
1: 0
2: 1
3: 10
4: 89
Right 901011905 1:6206928-6206950 AGCCTGGAGATTGCAGTTACTGG 0: 1
1: 0
2: 1
3: 6
4: 156
901011898_901011905 28 Left 901011898 1:6206877-6206899 CCCCGCCAGAAGTTGCAGGCTTC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 901011905 1:6206928-6206950 AGCCTGGAGATTGCAGTTACTGG 0: 1
1: 0
2: 1
3: 6
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901011905 Original CRISPR AGCCTGGAGATTGCAGTTAC TGG Intronic