ID: 901012100

View in Genome Browser
Species Human (GRCh38)
Location 1:6207793-6207815
Sequence CTGGACTGCCCCTCCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901012100_901012105 4 Left 901012100 1:6207793-6207815 CCTGCACAGGAGGGGCAGTCCAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 901012105 1:6207820-6207842 CAGGCCTGGGCCGACCCTGAAGG 0: 1
1: 0
2: 2
3: 27
4: 223
901012100_901012106 5 Left 901012100 1:6207793-6207815 CCTGCACAGGAGGGGCAGTCCAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 901012106 1:6207821-6207843 AGGCCTGGGCCGACCCTGAAGGG 0: 1
1: 0
2: 2
3: 11
4: 162
901012100_901012102 -10 Left 901012100 1:6207793-6207815 CCTGCACAGGAGGGGCAGTCCAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 901012102 1:6207806-6207828 GGCAGTCCAGTTTGCAGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 192
901012100_901012103 -9 Left 901012100 1:6207793-6207815 CCTGCACAGGAGGGGCAGTCCAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 901012103 1:6207807-6207829 GCAGTCCAGTTTGCAGGCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 164
901012100_901012111 23 Left 901012100 1:6207793-6207815 CCTGCACAGGAGGGGCAGTCCAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 901012111 1:6207839-6207861 AAGGGCCTCTGCTACCCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901012100 Original CRISPR CTGGACTGCCCCTCCTGTGC AGG (reversed) Intronic
900129918 1:1083025-1083047 CTGCACTGTCCCTGCTGTCCAGG - Intronic
900589530 1:3453549-3453571 CTGCCCTGCCCCTCCTGCTCTGG - Intergenic
901012100 1:6207793-6207815 CTGGACTGCCCCTCCTGTGCAGG - Intronic
901068927 1:6507756-6507778 CTGGCCGGCCCCTCCCGCGCCGG + Intronic
903065197 1:20695763-20695785 CTCGACTTCTCCTTCTGTGCTGG + Intronic
904388354 1:30162200-30162222 CTGAGCAGCCCCTCCTGAGCAGG + Intergenic
904469811 1:30729367-30729389 CTGGGCTGCTCCTCCTGCCCAGG + Intergenic
906061948 1:42954653-42954675 CTGGAAGGCCCCTCCTGCTCTGG + Intronic
907675701 1:56515952-56515974 CCTGAGTGCCCGTCCTGTGCCGG - Intronic
908153039 1:61324230-61324252 TTGGACTGCCTGTGCTGTGCAGG - Intronic
908979151 1:69933049-69933071 ATGGACTGCTCATCCTGTGCTGG - Intronic
910337989 1:86155615-86155637 CGGGCCTGCCCCTCCTGCGGAGG - Intronic
910349694 1:86281297-86281319 ATAGACTGCCCCTTCTGTGATGG - Intergenic
910401661 1:86843424-86843446 CTGAACTGCCTCTGCTGAGCTGG + Intergenic
914332325 1:146683707-146683729 CTGGGCTGCCTCTCCTGTTCAGG + Intergenic
915131515 1:153698333-153698355 CTAGACTGCCCCTCCCATGTGGG - Intergenic
915332888 1:155124665-155124687 CTGGATTGCGACTCCTTTGCTGG - Intergenic
917802316 1:178581784-178581806 CCGGACTGCGGCTCCTGAGCTGG - Intergenic
918206999 1:182318326-182318348 CTGGACTGTCTCTCCAGTTCAGG + Intergenic
920250142 1:204617952-204617974 CTGGAGTGCCCCTTCTGTCCGGG - Exonic
920411232 1:205762585-205762607 CTGGACTGCCCTTCCTAGACAGG + Intergenic
921972717 1:221167843-221167865 TTGGACTGCTCCTTCTCTGCAGG - Intergenic
924031472 1:239889705-239889727 CTGGGCTGCCACACCTGGGCTGG + Intronic
1064565102 10:16631840-16631862 CTGGGGTGCCCCCTCTGTGCTGG - Intronic
1066357147 10:34695759-34695781 CCGGGCAGCCTCTCCTGTGCAGG - Intronic
1067099816 10:43326309-43326331 CAGAACTGCCCATCCTGAGCTGG - Intergenic
1067270127 10:44784410-44784432 CTGGACCTTCCCTCCTGTCCTGG + Intergenic
1067845125 10:49713488-49713510 CTCTACTGCCACTCCTGTGTCGG - Intergenic
1069769033 10:70886097-70886119 CTGGACCCCACCTCCTGGGCAGG - Intronic
1069792280 10:71030410-71030432 CTGGGCTGCCTCTCCGGTGCTGG + Intergenic
1069841120 10:71340040-71340062 CTGGGCAGCCACTTCTGTGCAGG - Intronic
1069905888 10:71731859-71731881 ATGGGCTGCCCCACCTCTGCCGG - Intronic
1070130285 10:73651148-73651170 CTGGGCTGCCCCACAAGTGCCGG + Intronic
1070524511 10:77283699-77283721 ATGGAGTGCTCATCCTGTGCTGG + Intronic
1070638943 10:78152226-78152248 CAGAACTGCCCCTCATGAGCTGG - Intergenic
1071917965 10:90317327-90317349 CTGGCATGCCCTTCCTCTGCAGG + Intergenic
1072279268 10:93851270-93851292 CTGTGCTCCCCCTCCTGTGAGGG + Intergenic
1072570518 10:96654233-96654255 ATGGACTGACTCTGCTGTGCTGG + Intronic
1074987136 10:118668613-118668635 CTGGAGTGCATCTACTGTGCTGG - Intergenic
1075351123 10:121726029-121726051 CTGAACTGCCCATCCTGCCCAGG - Intergenic
1075399229 10:122149577-122149599 CTGCCCTTCCCCTCCTGCGCAGG - Intronic
1076620602 10:131784973-131784995 CTGGGCCTCCCATCCTGTGCAGG + Intergenic
1078387308 11:10903815-10903837 CTGCACTGCCTCTGCTGAGCTGG - Intergenic
1079021586 11:16913354-16913376 CTAGAGTGCCCATGCTGTGCGGG - Intronic
1080610442 11:33899573-33899595 CTGGAATGCCTCTCATGTGAGGG + Intergenic
1081568656 11:44276137-44276159 CAGGAGTGCCCCTCCTTTCCTGG + Intronic
1083424373 11:62575527-62575549 CTGGGCTGCCCCTCTTCTCCAGG + Exonic
1084669483 11:70596619-70596641 CTGCACTGGCCCTGCTGTCCTGG - Intronic
1084693120 11:70738477-70738499 CATCACTGCCCCTCGTGTGCGGG + Intronic
1089379718 11:118019379-118019401 CTGGGTTTTCCCTCCTGTGCTGG - Intergenic
1089927627 11:122275251-122275273 CTGAACTGCCCCTACTCTGGAGG - Intergenic
1091279975 11:134376188-134376210 CTGCTCTGCCCCTGCTGTTCGGG - Exonic
1091553352 12:1553649-1553671 CTGGACTCTCACTCCTGAGCCGG + Intronic
1092081334 12:5718838-5718860 CTGGACTGCCCTTCCCTTGGCGG + Intronic
1092106525 12:5925470-5925492 CTGGAGTGCCTCTCCAGAGCTGG - Intronic
1092132903 12:6124865-6124887 CTAGAGTGCCCCACCTGTGTGGG + Intergenic
1093766354 12:22967838-22967860 CTGCACTGCACCTGTTGTGCAGG - Intergenic
1093954298 12:25198329-25198351 TTGGATTGCTCCTCCTGGGCTGG - Intronic
1100594514 12:96060517-96060539 CTGCACTCCCCCTCCTGTGAGGG - Intergenic
1100888582 12:99099466-99099488 CTGGACCGTGCCTCCTATGCAGG - Intronic
1102453511 12:113057518-113057540 CTGGACTGCGGCTCCGGAGCTGG - Intronic
1102769852 12:115466106-115466128 CTGGGCTGCCCTTCCTCAGCGGG + Intergenic
1103085050 12:118056310-118056332 CTGGAATGCCTCTCCTCGGCTGG + Intronic
1104374118 12:128249104-128249126 CATGACTGCCCCTCCCTTGCAGG - Intergenic
1104713978 12:131004756-131004778 CTGGGGTTCCACTCCTGTGCAGG + Intronic
1104780608 12:131417620-131417642 CCTGACTGCCCCATCTGTGCAGG + Intergenic
1105256174 13:18745154-18745176 TGGGGCTGCCCCTCCTGGGCTGG + Intergenic
1107711399 13:43153715-43153737 CTGGACTGCCACTCTAGTCCTGG - Intergenic
1107856315 13:44618651-44618673 CTGGATTGCCCAGCCTGTGTGGG + Intergenic
1113586932 13:111472147-111472169 CTTCACTGCCCCTCCAGGGCTGG - Intergenic
1114574417 14:23699509-23699531 CTGTGCTCCCCCTCCTGTGAGGG - Intergenic
1117035987 14:51729755-51729777 CTGTGCTGTCCCTCCTGTGCTGG + Intronic
1118601063 14:67471773-67471795 CTGCCCTGCCCATACTGTGCAGG - Exonic
1119169437 14:72523072-72523094 CTGAACTGCACCTACTTTGCTGG - Intronic
1121115868 14:91342326-91342348 GTGGACTGCTGCTCCTGTGGTGG - Intronic
1121625564 14:95383361-95383383 CTGGACGGCCTCTGCTTTGCAGG - Intergenic
1122617486 14:103029982-103030004 CTGGAGAGCCCCTCAGGTGCTGG - Intronic
1122627040 14:103090113-103090135 CTGGACTGGCCAGCCTGGGCTGG - Intergenic
1202835840 14_GL000009v2_random:76874-76896 AGGGGCTTCCCCTCCTGTGCTGG - Intergenic
1124235872 15:27989045-27989067 GTGGACTGCCCCTGCTGCCCAGG + Intronic
1129371221 15:75096872-75096894 CAGCACCTCCCCTCCTGTGCTGG - Intronic
1132507585 16:319388-319410 CTGGACTTTCCCTTCTGTGATGG - Intronic
1132786518 16:1659925-1659947 ATCGACTGCTCCTCCTGGGCGGG - Exonic
1132832143 16:1933620-1933642 AGGCACTGCCCCTCCTGTGGGGG + Intergenic
1135024663 16:18989776-18989798 CTGGACCACCCCACCTGAGCAGG - Intronic
1138261882 16:55629655-55629677 CTCTAATGGCCCTCCTGTGCAGG + Intergenic
1140001228 16:71027212-71027234 CTGGGCTGCCTCTCCTATTCAGG - Intronic
1141703220 16:85651767-85651789 CTGGACTCCCCCTCCCAGGCTGG - Intronic
1141717712 16:85736288-85736310 CAGGCCTGGCCCTCATGTGCAGG + Intronic
1141881594 16:86863780-86863802 CTGGAATGCTCTTCCTCTGCTGG - Intergenic
1142143546 16:88483224-88483246 CCAGCCTGCCCCTCCTGTCCAGG + Intronic
1142957179 17:3529996-3530018 CTGCCCTTCCCCGCCTGTGCAGG + Intronic
1144659564 17:17059457-17059479 CTGCACTGCCCCTCCTATAGAGG - Intronic
1145883847 17:28369566-28369588 CTGCACAGCTCCTCCTCTGCTGG + Exonic
1146373904 17:32281562-32281584 CTAGCCTGGCCCTCCTGTTCTGG - Intronic
1148154259 17:45413687-45413709 CTGGCCTGCTCCTCCAGGGCGGG + Intronic
1148593811 17:48836726-48836748 CGGGACTGCCCCTCATACGCTGG - Intronic
1151475382 17:74342040-74342062 CTGGAGGGCCCCTCCTGAGTGGG - Intronic
1152113376 17:78369807-78369829 CTGGACTCCTCCTCCTGGCCAGG - Intergenic
1152170022 17:78739719-78739741 CTGGTCTCCAGCTCCTGTGCTGG - Intronic
1152553025 17:81039256-81039278 CTGGGCTGCCCAGCCTGTGTGGG + Intronic
1152642270 17:81454217-81454239 CTGGGCTCCCCCTCTTGTGTGGG - Intronic
1152768688 17:82154594-82154616 CTACACTGTCTCTCCTGTGCAGG + Intronic
1153424200 18:4944910-4944932 CTGGGCAGAACCTCCTGTGCTGG + Intergenic
1153579405 18:6557201-6557223 CTGGAATGCCGCTCCTGGCCTGG + Intronic
1154434860 18:14335524-14335546 TGGGGCTGCCCCTCCTGGGCTGG - Intergenic
1160518934 18:79493602-79493624 CTCGCCCGCCCCTCCTGAGCCGG + Intronic
1160723956 19:609315-609337 CGGGTCAGCCCCTCCTGAGCAGG - Intronic
1161073806 19:2275442-2275464 CTGGCCAGCGCCTCCTGTGTTGG - Exonic
1161330396 19:3684043-3684065 CTGCTCTGCCTCTCCTGTGCTGG - Intronic
1161338575 19:3728335-3728357 CTGGACTCCCCACCCTGAGCTGG + Intronic
1161399244 19:4060145-4060167 CTGGCAGGCCCCTCCTGGGCTGG + Intronic
1161627228 19:5334273-5334295 CTGGAGAGCCCCTCTTGGGCAGG + Intronic
1161736349 19:5994538-5994560 CTGGACAAACCCTCCTCTGCTGG - Exonic
1161816756 19:6503955-6503977 CTGTGCTGCCCCTCATGTGAAGG + Intergenic
1162528540 19:11222063-11222085 CTGGACTGTCCCACCTGTCCTGG + Intronic
1163768587 19:19177291-19177313 CTGGACTGCACCTTCTCTACAGG - Exonic
1165110177 19:33497772-33497794 CTGGACTGAACCCCCTGAGCTGG - Intronic
1167502749 19:49856890-49856912 CTGGACCGCCCCACCTGTAGGGG - Intronic
1202636799 1_KI270706v1_random:50489-50511 AGGGGCTGCCCCTCCTGGGCTGG + Intergenic
925072167 2:978175-978197 CTGGAGTGCCCTTGCTGAGCTGG + Intronic
925362540 2:3289514-3289536 CTGGCCTTCCGCTTCTGTGCTGG + Intronic
927053332 2:19350257-19350279 CTGGGCCGCCCCTCCAGGGCTGG + Intergenic
927109233 2:19852283-19852305 CTGGGCGGGCCCCCCTGTGCAGG + Intergenic
927431560 2:23030586-23030608 CTAGACTGCTCTTCCTGTGGAGG + Intergenic
929945572 2:46369278-46369300 CTGGACTCCCTCTCACGTGCTGG + Intronic
931813638 2:65878940-65878962 CTGGACTGGCCCACCTGGTCAGG + Intergenic
932127608 2:69157994-69158016 CTTACCTTCCCCTCCTGTGCAGG + Intronic
932468665 2:71939912-71939934 CTGGAGTCCCCGTCCTGGGCAGG - Intergenic
933299414 2:80525378-80525400 CTGGATTTCCCCTTCTGTGTTGG + Intronic
934490712 2:94760576-94760598 CTGGATTGCCCCACCTGCCCTGG + Intergenic
934491169 2:94762783-94762805 AGGGGCTGCCCCTCCTGGGCTGG + Intergenic
935152384 2:100449583-100449605 CTCGAATGCTCCTCCTCTGCAGG + Intergenic
938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG + Intergenic
939595851 2:144121360-144121382 CTGGTCTGTCCCTCATGTACAGG - Intronic
941427537 2:165367790-165367812 CTGCGCTCCCCCTCCTGTGAGGG - Intronic
941894194 2:170613014-170613036 GTGGACTGGCCATCCTGAGCAGG + Intronic
942045868 2:172099145-172099167 CTGCCCTGCCCCTCCGGCGCCGG - Intergenic
948911236 2:241003716-241003738 CTGCACTGCCCCACCTCTGCAGG + Intronic
1169022027 20:2337217-2337239 CTGGACTGACTTTCCTGTGCAGG - Intronic
1171249243 20:23636184-23636206 AGGGAATGGCCCTCCTGTGCAGG + Intronic
1171255724 20:23687934-23687956 AGGGAGTGCACCTCCTGTGCAGG + Intronic
1171278566 20:23878629-23878651 AGGGAATGCCCCTCCTGTGCAGG + Intronic
1171283647 20:23921133-23921155 AGGGAGTGCCCCTCCTGTGCAGG + Intergenic
1171391558 20:24804706-24804728 CAGGGCTGCTCCGCCTGTGCTGG - Intergenic
1173733356 20:45343397-45343419 CTGGGGTCACCCTCCTGTGCTGG - Intronic
1173816176 20:45989916-45989938 CTGGACTCCCTATCCTGTCCTGG + Intergenic
1173851258 20:46219899-46219921 CTGTACAGCCCCTGCTGTCCAGG - Intronic
1173979314 20:47210965-47210987 CTGACCTGCCCCTCCTGCACAGG + Intronic
1175465821 20:59191040-59191062 CTGCCCTGCCCCTCCTGCGAGGG + Exonic
1175572542 20:60034859-60034881 CTGGCCTTCCCCACCTGTGCCGG - Intergenic
1175930342 20:62490786-62490808 CTGCCCTTCCCCTCCTGTGATGG + Intergenic
1176033859 20:63026932-63026954 CTGAGCTGCCCCAGCTGTGCGGG - Intergenic
1176038065 20:63049968-63049990 CTGCACAGCCCCTCCTGGCCTGG + Intergenic
1176065104 20:63190396-63190418 CTGGACGTCCCCTCCTGTCTGGG + Intergenic
1176237423 20:64060157-64060179 CTGGGCTGCACCTCCTGCCCAGG + Intronic
1176246616 20:64100348-64100370 CTGGGCTGCTCCTCCTGCTCTGG + Exonic
1176727599 21:10453472-10453494 CTAGACTGCCCCTCTTGTTTGGG + Intergenic
1176841724 21:13848042-13848064 CTGGATTGCCCCACCTGCCCTGG + Intergenic
1176842176 21:13850178-13850200 TGGGGCTGCCCCTCCTGGGCTGG + Intergenic
1178075083 21:29007943-29007965 CTGGACTGTGCTTCCTGTGGTGG + Exonic
1178582464 21:33848114-33848136 CTGGACTTCCCCACCTGTTAGGG + Intronic
1179937385 21:44614010-44614032 AGGGACTGCCCCTGCTCTGCTGG + Intronic
1180223497 21:46375163-46375185 CTGCCCTGCCCCGCCTGTGCTGG + Intronic
1180286794 22:10753559-10753581 CTAGACTGCCCCTCTTGTTTGGG - Intergenic
1180364072 22:11923824-11923846 AGGGGCTGCCCCTCCTGGGCTGG - Intergenic
1182257525 22:29049619-29049641 GGGGACTGCCCCTCCTGCTCCGG - Exonic
1183192122 22:36328289-36328311 CATTACTGCCCCTCCTGTACTGG - Intronic
1183352016 22:37339836-37339858 GTGGACCTCCCCTACTGTGCGGG + Intergenic
1183415260 22:37678139-37678161 CTGGTGTGCCCCACTTGTGCTGG + Intronic
1183541390 22:38431249-38431271 CTGGACTTCCCCACCTCTGGAGG + Intronic
1185279709 22:49964824-49964846 CTCAACTGCCCACCCTGTGCTGG + Intergenic
1185289370 22:50015945-50015967 CTGGACTGCCCCTCTGGGGTGGG - Intronic
1185367216 22:50442182-50442204 CAGGCCTGCCCCACCTGTGGGGG - Intronic
950108251 3:10402027-10402049 CTGGCCTGTCCCACCTCTGCCGG + Intronic
950485282 3:13269655-13269677 CTGTCCTGCCCCTGCTGAGCTGG - Intergenic
952808679 3:37381790-37381812 CTGGACTTCCACCCCTGTGAAGG - Intergenic
952902864 3:38121323-38121345 CTTCACTGCTCCTCCTGTGGTGG - Intronic
952959362 3:38579978-38580000 CCGGAATTCCCCTCCTGTGCTGG + Intronic
953958065 3:47246746-47246768 TGGGACTGCCCCTCCTGTGAAGG + Intronic
954751164 3:52814442-52814464 CTGGGCTTCCCCTCTTGTCCAGG + Intronic
955393035 3:58535094-58535116 CTGGGCTGCCCATCCTATCCTGG + Exonic
956398953 3:68856066-68856088 CTGGACTACCCGTCCAGAGCTGG + Intronic
963773484 3:149414697-149414719 CAGGTCTGCCCTTCCTGTGTGGG + Intergenic
964142713 3:153421909-153421931 CTGCACTGTAGCTCCTGTGCTGG + Intergenic
965258249 3:166444629-166444651 CTGGTCTGCAGCTCCTGGGCAGG - Intergenic
966129031 3:176615341-176615363 CTAGATTGCCTCTCCTGTGCTGG - Intergenic
968625133 4:1623552-1623574 CTGGCCGGCCCCTCCTGCGGTGG + Intronic
969340348 4:6536610-6536632 GGGGAAAGCCCCTCCTGTGCAGG + Intronic
973394003 4:49578576-49578598 AGGGGCTGCCCCTCCTGGGCTGG - Intergenic
974240356 4:59238298-59238320 CTGTCCTGCCACTCCTGTGGTGG - Intergenic
980088456 4:128416537-128416559 CTTGCCTGCCCCTCCTTGGCTGG + Intergenic
985080662 4:186261020-186261042 CTGGCCTTGCCCTCCTGTGGCGG + Intergenic
988518022 5:31921554-31921576 CTGGTCTGCCCCTGCGGTCCCGG + Intronic
990343588 5:54849410-54849432 CTGGACTTCACCCCATGTGCTGG + Intergenic
991041686 5:62182709-62182731 CTGGAGTGACTCTCCAGTGCAGG - Intergenic
992326304 5:75663506-75663528 CAGGAAAGCCCCTGCTGTGCTGG - Intronic
996849762 5:127938895-127938917 ATGGACTCCCTCTCCTGGGCTGG + Intergenic
997199652 5:132002194-132002216 CTGGCCAGGCCCTCCTGTGCAGG + Intronic
997432916 5:133853657-133853679 CCACACTGCCCTTCCTGTGCAGG - Intergenic
999382084 5:151128357-151128379 CAGCCCTGGCCCTCCTGTGCTGG + Intronic
1002283982 5:178150071-178150093 CGGGACAGCCCCTGCTGGGCTGG - Exonic
1002695907 5:181088441-181088463 CTGGTCTGCCCCTGCTGGACGGG + Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006385985 6:33731192-33731214 CTGGTGTGCCGGTCCTGTGCAGG + Intronic
1010291724 6:74145446-74145468 CTGGAGTGCTCCACCTGTGTCGG + Intergenic
1016590064 6:145735026-145735048 CTGGGCTGACCCTGCTCTGCCGG - Intronic
1019276921 7:180496-180518 CGGGACGGCCCCTCTTGTGGCGG - Intergenic
1019301613 7:307046-307068 CCTGACTGCCCCTCCTCTCCAGG + Intergenic
1019667656 7:2259789-2259811 CTGAACTCCCCCTCTTCTGCTGG - Intronic
1022659705 7:32355356-32355378 GTGCACTGCCCCTCTTGGGCAGG - Intergenic
1023868712 7:44251513-44251535 CTGGAGAGCCCCTCCTGGGTTGG - Intronic
1024136315 7:46412567-46412589 CTGCACATCCCCTCCTGTGATGG - Intergenic
1028447792 7:90944768-90944790 TTGGTCTGCCCCACCTGTGTGGG + Intronic
1028733589 7:94180923-94180945 CTGGACTGCCCCATTTGTGTAGG + Intergenic
1029459150 7:100685436-100685458 CTGGACTTCTCCTCCTGAGGAGG + Exonic
1032765814 7:134991924-134991946 CTGGACTCACCTTCCTGTGGGGG + Intronic
1034602497 7:152274521-152274543 CTAGACTGCCCCTCTTGTTTGGG - Intronic
1035082965 7:156233083-156233105 CTGCTCTGCCGCTCCTGTCCGGG - Intergenic
1035108964 7:156464463-156464485 CTGGACAGCTCCTCCTGCCCTGG + Intergenic
1036643673 8:10599325-10599347 CTGGCCTGCACCCCCTGGGCTGG - Intergenic
1036688938 8:10929074-10929096 CCTGCCTGCCCCTCCTGTGATGG - Intronic
1036710710 8:11076779-11076801 CGGGACTGCCTGTCCTCTGCGGG - Intronic
1037561487 8:20078908-20078930 CTGGAGTCTCCTTCCTGTGCAGG - Intergenic
1039742469 8:40395164-40395186 GTGGCCTTCCCCTCCTCTGCTGG - Intergenic
1039898301 8:41731860-41731882 CTGACCTGCCCCGCGTGTGCCGG - Intronic
1040696624 8:50007272-50007294 CTGGGCTGCTCCTCCAGTTCTGG + Intronic
1040998966 8:53430927-53430949 CTGGACTCACCATCCTGTGTTGG + Intergenic
1041027615 8:53703340-53703362 CTTGAATGCCCCTGCTGGGCGGG - Intergenic
1043718415 8:83512201-83512223 TTGCACAGCCTCTCCTGTGCTGG - Intergenic
1045251207 8:100484761-100484783 CTGGACAGCCTCTCAGGTGCTGG - Intergenic
1049311579 8:141936466-141936488 CTTGACCGCCCCCACTGTGCAGG - Intergenic
1049687240 8:143943910-143943932 CAGGGCTGCCCTTCCTGCGCTGG + Intronic
1052880589 9:33599085-33599107 TGGGGCTGCCCCTCCTGGGCTGG - Intergenic
1053438168 9:38091445-38091467 CTGGGCTGCCTCTCATGTTCAGG - Intergenic
1053495381 9:38545126-38545148 TGGGGCTGCCCCTCCTGGGCTGG + Intronic
1053666806 9:40322898-40322920 AGGGGCTGCCCCTCCTGGGCTGG - Intronic
1053916862 9:42950223-42950245 CTGGATTGCCCCACCTGCCCTGG - Intergenic
1054377957 9:64462926-64462948 AGGGGCTGCCCCTCCTGGGCTGG - Intergenic
1054517804 9:66053385-66053407 AGGGGCTGCCCCTCCTGGGCTGG + Intergenic
1054818695 9:69500147-69500169 CTGGGCTGCCCATCCTGGTCAGG - Intronic
1054969060 9:71063250-71063272 CTGGAATGCTGCTCCTATGCAGG + Intronic
1055423287 9:76166556-76166578 CAAGACTGCCCCTCATGTGATGG + Intronic
1056585496 9:87924944-87924966 TGGGGCTGCCCCTCCTGGGCTGG + Intergenic
1056611385 9:88127999-88128021 TGGGGCTGCCCCTCCTGGGCTGG - Intergenic
1057203425 9:93156178-93156200 CTGGGCTGCCCCCTCTGCGCAGG - Intergenic
1057448799 9:95138142-95138164 CTCGGCTGCCTCTTCTGTGCGGG - Intronic
1057675276 9:97132483-97132505 TGGGGCTGCCCCTCCTGCGCTGG + Intergenic
1059463044 9:114447247-114447269 CTGCACGGCCCTTCCTGTGCTGG - Intronic
1061988934 9:134147308-134147330 TTGGACTCCCCCTCCTGGACTGG + Intronic
1062460383 9:136660351-136660373 GTGGAGTGCCCCTCCTGTGGTGG + Intronic
1062556573 9:137115611-137115633 CTGCCCTGCCCATCCTGTGTGGG + Intergenic
1185809251 X:3089867-3089889 CTTGACTGCGTCTCCAGTGCTGG + Intronic
1188625190 X:32276018-32276040 CTGCACTGCACGTCCAGTGCTGG - Intronic
1190649832 X:52557929-52557951 CTGGATTGCCCCTCCTGTCCCGG + Intergenic
1195722394 X:107879001-107879023 CTGCACTCCCCGTCCTGTGATGG - Intronic
1195939904 X:110159434-110159456 TTGAACTGCCCCGCCTCTGCTGG - Intronic
1200092455 X:153642341-153642363 CTACAGTGCCCCTCCTGGGCAGG + Intergenic