ID: 901012583

View in Genome Browser
Species Human (GRCh38)
Location 1:6209957-6209979
Sequence CAGGCTGTGCAGAGGTGAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901012576_901012583 23 Left 901012576 1:6209911-6209933 CCATCTCTCCCAGGACAGGCTGG 0: 1
1: 1
2: 4
3: 52
4: 396
Right 901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG 0: 1
1: 0
2: 3
3: 61
4: 377
901012578_901012583 15 Left 901012578 1:6209919-6209941 CCCAGGACAGGCTGGCAGAGAGG 0: 1
1: 0
2: 8
3: 50
4: 530
Right 901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG 0: 1
1: 0
2: 3
3: 61
4: 377
901012580_901012583 14 Left 901012580 1:6209920-6209942 CCAGGACAGGCTGGCAGAGAGGA 0: 1
1: 0
2: 5
3: 43
4: 388
Right 901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG 0: 1
1: 0
2: 3
3: 61
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901012583 Original CRISPR CAGGCTGTGCAGAGGTGAGT TGG Exonic
900185404 1:1331003-1331025 CAGGCTGTGGAGAGGAGAGGGGG - Intergenic
900464615 1:2819373-2819395 CAGGGTGTGCAGATGTGTGTGGG - Intergenic
900599416 1:3496737-3496759 CAGGCTGTGAACAGCTGTGTGGG - Exonic
901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG + Exonic
902542493 1:17164942-17164964 CAGGCTGTGGACAGGTGGATGGG + Intergenic
902873523 1:19327865-19327887 TAGGCTGTGCAGACGAGAGCTGG + Intronic
903770163 1:25758768-25758790 CAGGGTTTTCAGAGGCGAGTGGG + Intronic
903883977 1:26530558-26530580 CAGGCTGTGGAGACGAGAGTGGG + Intronic
903931473 1:26864701-26864723 CGGGCTGAGGGGAGGTGAGTGGG + Intergenic
904128658 1:28259996-28260018 CAGGCTGTCCGGAGCTGAGTCGG + Intronic
904265175 1:29314460-29314482 AAGGTTGTGCAGAGCTGAGGGGG - Intronic
904397093 1:30229238-30229260 CAGGCTGTACAGTGAGGAGTAGG - Intergenic
904634668 1:31870576-31870598 CAGGCTGGGCAGTGGTGACTGGG + Intergenic
905018954 1:34795293-34795315 AAGGCTCTGCAGAGATGACTGGG + Exonic
905291465 1:36924478-36924500 CTGGCTGTGGAGAGGGGAGGGGG + Intronic
905899761 1:41573781-41573803 CAGGCAGAACAGAGGTAAGTGGG + Intronic
906013058 1:42547728-42547750 GAGGCTGTGAAGAGGGGAATAGG - Intronic
906256599 1:44355251-44355273 CAGAGTGCGCGGAGGTGAGTCGG - Intronic
906415867 1:45621272-45621294 CAGCCTGTGCCCAGGTCAGTAGG - Exonic
906672395 1:47665852-47665874 GAGGCTGTTCTGAGGTGAGCAGG + Intergenic
907281177 1:53348180-53348202 CAGTCTGTGCAGAGTTGGCTGGG - Intergenic
907300490 1:53483791-53483813 CAGCCTCTGCAGAGGTGGGAGGG + Intergenic
908842357 1:68293104-68293126 AAGGCTGTGCAGGGATTAGTGGG - Intergenic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910723617 1:90314665-90314687 CAGGCTGTGCAGAGGAACATGGG + Intergenic
911060686 1:93745243-93745265 TTGGCTGTGCAGATGGGAGTTGG + Intronic
911563667 1:99436309-99436331 GAGGCTGTGCAGAGGAGCCTTGG + Intergenic
914330716 1:146668090-146668112 CAGCCTGTCCAGATGGGAGTTGG + Intergenic
915117761 1:153611144-153611166 CAAGCTGGGCTGAGGTGGGTGGG - Intronic
915215675 1:154339230-154339252 CAGGGTGTGAAGAGGAGAGTTGG + Intronic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916200892 1:162270838-162270860 CAGGATGGGCAGAGGTTGGTTGG + Intronic
916602508 1:166306770-166306792 TAGGCTGTCCAGAGGTGGTTTGG + Intergenic
916672607 1:167036678-167036700 CAGACGGAGCAGAGGTGTGTGGG - Intergenic
918347433 1:183618022-183618044 CAGGCTGTATAGAGGTGGGAAGG - Intergenic
918968205 1:191378433-191378455 CAGGCTGTGCAGAGCTGCGGTGG + Intergenic
919740643 1:200979435-200979457 CGGGCTGTGCTGTGCTGAGTGGG + Intronic
920044019 1:203121901-203121923 GACGCTGTGCAGAGGGGAGGAGG - Intronic
920901198 1:210112050-210112072 CAGACTGTACAGAGGTGGGAAGG + Intronic
921214922 1:212928591-212928613 CAGGCTGAGCTGAGATGAGCAGG + Intergenic
921509595 1:216012538-216012560 CAGACTGTATAGAGGTGAGAAGG - Intronic
922048722 1:221970317-221970339 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
922192746 1:223333701-223333723 CAGGTTCTGCAGAGGTGGGGAGG + Intronic
924809666 1:247389952-247389974 GAGGCTTTGGAGAGGTGATTAGG - Intergenic
924886039 1:248217887-248217909 CAGCCTGTGCAGAAGTCAGATGG - Intergenic
1063087668 10:2834137-2834159 ATGGCTGTGCAGAGCTGAGTTGG - Intergenic
1063424695 10:5942121-5942143 CCAGCTGTGCAGAGGTGCCTTGG - Intronic
1064064397 10:12168689-12168711 CCTGCTGTGCCCAGGTGAGTAGG - Intronic
1066574394 10:36809750-36809772 CAATTTGTACAGAGGTGAGTGGG + Intergenic
1067151880 10:43742593-43742615 AAGGCTGTGCAGAGGTCACATGG + Intergenic
1067684735 10:48459458-48459480 CAGGCTGTGTGGATGTGAGCTGG + Intronic
1067720411 10:48723714-48723736 CAGACTGTGCAGTGGTGGGGAGG - Intronic
1069720183 10:70544807-70544829 CAGGCTGTGCCCAGGGGAGTAGG - Intronic
1069859359 10:71460856-71460878 CAGGAAGAGCAGAAGTGAGTGGG + Intronic
1070368091 10:75755769-75755791 CAGGCTGTGCAGTGGGGAGCAGG + Intronic
1072300667 10:94058603-94058625 CAGGTTAAGCAGAGTTGAGTGGG + Intronic
1073078159 10:100837448-100837470 CAGCCTGTGCAAAGGTCAGAAGG - Intergenic
1073130522 10:101186000-101186022 CAGACTGTACAGAGGTGGGAAGG + Intergenic
1074529835 10:114289476-114289498 GTGGCTGTGTGGAGGTGAGTGGG + Exonic
1075847357 10:125555494-125555516 CAGGCTCTGCAGAGGTGCTGCGG + Intergenic
1077227920 11:1446419-1446441 CAGGCTGGGCAGGGCTGAGCTGG + Intronic
1077284525 11:1759779-1759801 CAGGCTGAGCAGGTGGGAGTGGG - Intronic
1077437769 11:2550974-2550996 GAGGCTGTGCTGAGCTCAGTGGG + Intronic
1077545077 11:3165562-3165584 CGGGGTGGGCAGCGGTGAGTGGG + Intronic
1079006032 11:16791605-16791627 CAGGCTGAGCACTGCTGAGTGGG - Intronic
1079009167 11:16814401-16814423 CAGGCTGTACAGAGGTAGGCAGG - Intronic
1079424442 11:20326807-20326829 CAGGTTGTGCAGATATGGGTGGG - Intergenic
1080608475 11:33884373-33884395 TAGGTGCTGCAGAGGTGAGTGGG + Intronic
1080763366 11:35273748-35273770 CAGGCTGGGCAGGGGAGAATGGG + Intronic
1081806379 11:45893081-45893103 CTGGCTGTGCTGTGGTGAGGAGG - Intronic
1082096887 11:48138191-48138213 CTGGCTTTTCAGTGGTGAGTGGG + Intronic
1083680372 11:64348938-64348960 GAGGCTCAGCAGAGGTGGGTCGG - Intronic
1083741107 11:64712242-64712264 GAGGCTGTGAGGGGGTGAGTGGG - Intronic
1084658161 11:70531415-70531437 CATGCTTGGCAGAGGTGAGCTGG + Intronic
1084857671 11:71999308-71999330 CTGGCTGTGAAGAGGGGAGGCGG + Exonic
1084921645 11:72475590-72475612 CTGGATGTGCAGATGTCAGTTGG + Intergenic
1085376203 11:76063404-76063426 CAGGTGGTGAAGAGGTTAGTGGG - Intronic
1085519618 11:77130434-77130456 CAGGCTGGGCAGTGGTCAGAGGG + Intronic
1086060565 11:82695776-82695798 CAGGCGGGGCAGAGCTGTGTTGG - Intergenic
1088237564 11:107741888-107741910 CAGGCTGTGCAGAGCCTAGAAGG - Intergenic
1088890765 11:114042419-114042441 CAGTCTGTCCAGAGCTGAGGAGG + Intergenic
1090816087 11:130297419-130297441 CTGCTTGTGCAGAGGTAAGTTGG - Intronic
1091309306 11:134561309-134561331 CAGGCTGTGCCCAGGTGGGTAGG + Intergenic
1091390443 12:122980-123002 CAGGCTGTGCTGTGGTGGGAAGG + Intronic
1092047057 12:5439064-5439086 CAGGGTGTGCAGAGCTGAAAGGG + Intronic
1092731420 12:11538596-11538618 CAGGCACTGCAGAGGGGAGCCGG - Intergenic
1094196332 12:27753512-27753534 AAGGCTCTGCAGAGCTGAGTGGG - Intronic
1095530192 12:43177997-43178019 CAGCCTGTGCAGAGGTCACATGG - Intergenic
1095638024 12:44454719-44454741 CAGACTGTACAGAGGTGGGAAGG - Intergenic
1096405161 12:51338637-51338659 CAGGATGTGCACAGGTGATATGG - Intronic
1096495802 12:52038496-52038518 CAGGCTGGGCAGAGGTTGGTAGG + Intronic
1097174560 12:57135361-57135383 AAGGCTCTGCTGAGGGGAGTGGG + Intronic
1097592755 12:61591795-61591817 CAGACTGTACAGAGGTGGGAAGG - Intergenic
1098194278 12:67983456-67983478 CAGGGTGTGCAGAGGTCACATGG - Intergenic
1098621559 12:72607157-72607179 CAGACTGTGGAAAGTTGAGTAGG - Intronic
1099452358 12:82822899-82822921 CAGGCTGTGAAGAGATGAGGAGG - Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1100799031 12:98212215-98212237 CTGGCTGTGCAGCGGTGTGTGGG - Intergenic
1101725522 12:107385356-107385378 CAGGCAATGCAAAGGTGTGTAGG + Intronic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1104897386 12:132171081-132171103 CAGGCTGTGCAGTGCTGCGTGGG + Intergenic
1104966883 12:132512343-132512365 CAGGCTGTGCAGAGGATGCTGGG - Intronic
1105005999 12:132720953-132720975 CAGGCTGAGAAGGGGAGAGTTGG + Exonic
1106842244 13:33696296-33696318 CCTGCTGTGCAGAGATGAGGTGG - Intergenic
1110500552 13:76223092-76223114 CAGGCTGGACAGAGGAGAATAGG + Intergenic
1112547109 13:100381851-100381873 GAGGGAGTGCACAGGTGAGTGGG + Intronic
1112580435 13:100673385-100673407 AAGGCTGGGCAGAGGTCAGCAGG - Intronic
1114258961 14:21024306-21024328 CAGGCTGCGCGGAGGAGAGAAGG + Exonic
1114957317 14:27839570-27839592 CATGCTTTGAAGAGGTGATTAGG + Intergenic
1116534457 14:46013757-46013779 CAGACTGTATAGAGGTGAGAAGG + Intergenic
1116866862 14:50038351-50038373 CAGGCTGTTCAGAGTTGGATGGG + Intergenic
1117746838 14:58878459-58878481 CAGGAGGTTAAGAGGTGAGTGGG - Intergenic
1118968074 14:70606868-70606890 CAGTGTGTGCAGTGGTGATTTGG - Intergenic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1119327814 14:73771960-73771982 GAGGCAGCCCAGAGGTGAGTGGG + Intronic
1120146029 14:80979354-80979376 AAGGCTGTGCAGAGGGTAGGGGG + Intronic
1120708663 14:87771246-87771268 CAGGCTGTGCACAGGTGGCCTGG + Intergenic
1121005563 14:90488663-90488685 CAGGCTGTGCAAATGTGACCTGG + Intergenic
1121124928 14:91399884-91399906 CAGGCTGTGCTTAGGTGCTTAGG - Intronic
1121285104 14:92729183-92729205 CAGGATGGGCAGAGGTGCGCAGG - Intronic
1121523230 14:94600372-94600394 CAGGCTGGGCACAGGTCAGCTGG + Intronic
1122159877 14:99775249-99775271 CAGGGAGTGCAGAGCTCAGTGGG + Intronic
1122627061 14:103090174-103090196 CAGGCTGGGCAGGGCTGAGCTGG + Intergenic
1122782217 14:104148577-104148599 CAGCCTGTGCAGAGGTTGGAAGG + Intronic
1123067096 14:105624226-105624248 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123071119 14:105642953-105642975 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123076078 14:105667995-105668017 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123090779 14:105741223-105741245 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123096414 14:105768987-105769009 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123760326 15:23427014-23427036 CAGGCTGTGGAAAGGTGATTTGG + Intergenic
1123898464 15:24851580-24851602 GAGGCTGTGAAGGGGAGAGTGGG + Intronic
1124012655 15:25851026-25851048 GAGGCTGGGGAGGGGTGAGTGGG + Intronic
1124445203 15:29724256-29724278 CAGGCTGGGCTGGGGAGAGTGGG + Intronic
1124925610 15:34067534-34067556 CAGGCCATGCAAAGGTGTGTGGG - Intergenic
1125130570 15:36279433-36279455 CAGGCTGTTGACAGGTGAATGGG + Intergenic
1125212897 15:37237525-37237547 CAGACTGTATAGAGGTGAGAAGG + Intergenic
1127365370 15:58284428-58284450 CTGGGTGAGCAAAGGTGAGTTGG + Intronic
1128356981 15:66935034-66935056 ATGGCTGTGCAGAGGAGAGTGGG - Intergenic
1128370074 15:67033923-67033945 CAGGGTGTGCACAGGTGGGTGGG - Intergenic
1128577213 15:68784314-68784336 TTGGCTTTGCAGAGGTGGGTGGG - Intronic
1128844301 15:70876382-70876404 CAGGCTGTGTAGAGTCTAGTGGG + Intronic
1129047608 15:72750321-72750343 CAGATTATGCAGAGGTGAGTTGG - Intergenic
1129182931 15:73888282-73888304 CAGGCTGGGGAGAGGTCAGGTGG + Intronic
1129743221 15:78000316-78000338 CAGGAGGAGCGGAGGTGAGTGGG - Intronic
1129784407 15:78299553-78299575 CTGGCAGTGCAGTGGTGAGTTGG - Exonic
1131032117 15:89195152-89195174 CAGGAGGTGCAGAGGTGAGCTGG - Intronic
1131107739 15:89746194-89746216 GATGCTGTGTGGAGGTGAGTAGG - Intergenic
1131512636 15:93057673-93057695 CAGCTTCTGCAGAGGTGACTTGG - Intronic
1131825048 15:96313939-96313961 CCACCTATGCAGAGGTGAGTAGG - Intergenic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132860844 16:2071056-2071078 CAGGCTGAGCAGAGGTGACTGGG + Intronic
1133402016 16:5495092-5495114 CAGGCTGTGCATGGCTGAGGAGG + Intergenic
1136588333 16:31202098-31202120 CAGGCTGTGCAGGAGTGCGGTGG + Intronic
1136757284 16:32695386-32695408 CTGGGTAGGCAGAGGTGAGTAGG + Intergenic
1140002836 16:71042813-71042835 CAGCCTGTCCAGATGGGAGTTGG - Intronic
1141560810 16:84866635-84866657 CAGGCTGCCCAGAGGTTAGCAGG - Intronic
1141677143 16:85523892-85523914 CAGGCTGAGCAGAGGTGGGAGGG + Intergenic
1142126322 16:88412300-88412322 CAGGCTGTGGAGAGGGCACTGGG - Intergenic
1142220456 16:88851876-88851898 CAGGCTTTGCAGAGCTGCGGTGG - Intronic
1142757524 17:2024844-2024866 CATGCTTCGCAAAGGTGAGTTGG - Exonic
1142995445 17:3757346-3757368 CAGCATGTGCAGAGGTGAGGAGG - Intronic
1143382962 17:6507907-6507929 CAGGATGTCCAGAGGTGGGGAGG + Intronic
1143894733 17:10127320-10127342 CAGGCTGTGCAAAAGTGAGAGGG - Intronic
1145718695 17:27048344-27048366 CAGGATGTGCAGGGGAGAGAGGG - Intergenic
1146567364 17:33924837-33924859 CAGACTCTGCAGAGGTGTGGTGG + Intronic
1146570601 17:33949384-33949406 CAGGCTATGCAGATTTGAGTTGG - Intronic
1146651817 17:34611851-34611873 CAATGTGTGCAGAGGTGACTGGG - Intronic
1147986865 17:44311928-44311950 CAGGCAGTGCAGAGCTGGGCGGG - Intronic
1148049652 17:44763461-44763483 CAGGCTGGACAGAAGTGAGGGGG - Intronic
1148050162 17:44766172-44766194 CAGGCTGTGCAGATGAGGGTGGG + Intronic
1148344198 17:46892464-46892486 AAGGCTGAGCAGGAGTGAGTTGG - Intergenic
1149131032 17:53302795-53302817 CAGCCTGTGCAGAGCCCAGTTGG + Intergenic
1149363121 17:55914425-55914447 CAGGCTGTGCAGAGATCAGAGGG - Intergenic
1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151236872 17:72727001-72727023 CAGGCTGTGCACAGCAGAGGAGG - Intronic
1151572062 17:74931420-74931442 GGGGCTGGGCAGAGGTGAGAGGG + Intronic
1151676472 17:75601393-75601415 CAGCCTGTGCAGAGGCGTGAAGG + Intergenic
1151698270 17:75729246-75729268 CAGCCTGGGCAGAGGTGGGAGGG - Exonic
1152375974 17:79919245-79919267 GAGGGTGTGCAGAGGTCAGCGGG - Intergenic
1152540376 17:80971662-80971684 CAGGCTGTGGGGATCTGAGTGGG - Intergenic
1152946045 17:83197811-83197833 CAGGCTTTTGAGAGGTGATTTGG - Intergenic
1153347153 18:4039265-4039287 CAGGCTGTACAGAGGATAGTGGG - Intronic
1154470454 18:14695037-14695059 CAGGATGTGCAGGGGAGAGAGGG + Intergenic
1156457605 18:37303568-37303590 TAGGCTGGGCAGAGGTGAGGCGG + Intronic
1157272797 18:46289593-46289615 TAGGCTGTGGGGAGGGGAGTAGG - Intergenic
1157824072 18:50796645-50796667 CAGACTGAGCAAAGGTGAGGGGG + Intronic
1158394328 18:57067963-57067985 CAGACTGTATAGAGGTGAGAAGG + Intergenic
1158725730 18:59969760-59969782 CAGGCTGTGCAGGGGGGCGGCGG + Intergenic
1159609911 18:70513678-70513700 CCGGCCGTGCAGCGGTGGGTGGG - Intergenic
1159871074 18:73760155-73760177 CAGGGTGGGGAGAGGTGAGCTGG - Intergenic
1160389139 18:78517440-78517462 CAGGCTGTAGAGAAGTGAGCTGG + Intergenic
1160521178 18:79509120-79509142 CAGCCTCCGCAGAGGTGTGTGGG + Intronic
1160662356 19:307037-307059 CAGGCTGAGCAGAGGAGGGTGGG - Intronic
1160826040 19:1081051-1081073 CTGAGTGTGAAGAGGTGAGTGGG + Exonic
1160839653 19:1140458-1140480 AAGGCTGAGCAGAAGTGAGGGGG + Intronic
1161949247 19:7458677-7458699 AGGGCTGTGGAGAGGTGAGGAGG + Exonic
1162418372 19:10552019-10552041 CAGGGGGTGCAGGTGTGAGTGGG - Intronic
1162897241 19:13772282-13772304 CAGGCTAGGGAGAGCTGAGTTGG - Exonic
1164781025 19:30892990-30893012 CAGACGGAGCAGAGCTGAGTGGG - Intergenic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166395075 19:42433650-42433672 CAGGCTGTGGAGAGGGGAATGGG + Intronic
1166903003 19:46080845-46080867 CAGGCTGCCCATTGGTGAGTGGG + Intergenic
1168339451 19:55614964-55614986 CAGGCTCTGCGGAGCCGAGTAGG - Exonic
1168468210 19:56620934-56620956 CAGGCTCTGCAAACCTGAGTAGG - Intronic
1168686864 19:58354144-58354166 CAGGCTGTGGTGAGGAGAGGGGG - Intergenic
926171428 2:10555243-10555265 CAGGATGTGCAGAGCGGGGTGGG + Intergenic
926188073 2:10707199-10707221 CAGGCTGTGGAGGGCTGAGGAGG + Intergenic
926681186 2:15665272-15665294 CAGGACCAGCAGAGGTGAGTGGG + Intergenic
927121562 2:19968979-19969001 CAGCAAGTGGAGAGGTGAGTTGG + Intronic
927514255 2:23662719-23662741 CAGGCTGGGGAGAGGTGGCTCGG - Intronic
928827311 2:35438221-35438243 CAGACTGTACAGAGGTGGGAAGG + Intergenic
929080877 2:38121050-38121072 CACGGTGTGCACAGGTGAGATGG + Intergenic
929084911 2:38158576-38158598 CAGGATGTGGAGAGGTGGGGAGG - Intergenic
929440681 2:41963959-41963981 CAGGATGTGCAGAGAGCAGTGGG + Intergenic
929984131 2:46709518-46709540 AAGGCTGTGCAGAGAAAAGTAGG + Intronic
930245488 2:48979454-48979476 CAGCATGTTCAGAGTTGAGTAGG - Intronic
931714392 2:65017563-65017585 CGGGCTCTGCAGAGGTTAGTTGG - Intronic
934604899 2:95687179-95687201 GAGGCTGGGAAGAGGTGACTGGG - Intergenic
934946834 2:98548383-98548405 CTGGCTGTGCAGAGCTGCGGTGG - Intronic
935619751 2:105118423-105118445 GAGGCTGGGGAGAGGGGAGTAGG + Intergenic
935673436 2:105574463-105574485 AAGCCTGTGCACTGGTGAGTGGG + Intergenic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936252188 2:110875505-110875527 CAGGCTGTGCACATGGGTGTGGG + Intronic
936377006 2:111949296-111949318 CTGGCAGTGCAGAGGTGAATGGG - Intronic
936510004 2:113137613-113137635 GAGGCGGTGCACAGGTGACTGGG + Intergenic
936538349 2:113329719-113329741 GAGGCTGGGAAGAGGTGACTGGG - Intergenic
936796034 2:116204767-116204789 CAGTCTGTGCAGAGCTCAGAAGG - Intergenic
937329906 2:121019946-121019968 CAGGCTGAGCCGAGCTCAGTGGG + Intergenic
938370174 2:130763632-130763654 CAGGCTGCCCAGGGGTGGGTGGG - Exonic
938564817 2:132509021-132509043 CAGGCTGTGCTGAAGGGAGACGG + Intronic
938589032 2:132719684-132719706 GAGGCAGTGCTGGGGTGAGTGGG + Intronic
939247533 2:139645122-139645144 CAGGCTCTGCACAGAAGAGTGGG + Intergenic
940989888 2:160086305-160086327 CAGGCTGGACAGAGTTGAGGTGG + Intergenic
941460875 2:165770126-165770148 CAGGCTTTGCAGGGGAGAGAGGG - Intronic
941527975 2:166629300-166629322 CAGGTTCTGGAGAGGTGACTAGG - Intergenic
942132847 2:172898029-172898051 CAGGCTGAGCACAGCTGTGTGGG + Intronic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
943066401 2:183091033-183091055 CAGGCTATACAGAGGGGACTAGG - Intronic
944387833 2:199184307-199184329 CAGACTGTACAGAGGTGGGAAGG - Intergenic
947700394 2:232229500-232229522 CAGGCTTTTCAGCAGTGAGTGGG - Intronic
947863724 2:233381106-233381128 CTGGCTCTGCAGAGCTGAGCGGG + Intronic
948426025 2:237886985-237887007 CAGGCTGTGCAGACGGGACTTGG + Intronic
1168932598 20:1636119-1636141 CAGCCTGGGGAGAGGGGAGTGGG + Intronic
1169210935 20:3765976-3765998 CATGCTGACCAGAGGTGAATGGG - Intronic
1170136419 20:13079231-13079253 CAGGCAGGGTAGAGGTGGGTGGG + Intronic
1170732088 20:18984580-18984602 CAGGCTGAACAGAGCTGAGCTGG + Intergenic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1173603177 20:44310584-44310606 CAGGCAGGACAGAGGTGAGATGG + Intronic
1173791178 20:45828691-45828713 CAGGCTGGGCACTGGGGAGTAGG + Intronic
1173867256 20:46320315-46320337 CATGCTGTGTTGAGGGGAGTTGG + Intergenic
1175215076 20:57388037-57388059 CAGGCTGGGCAGAGGTGACTTGG - Intergenic
1175542139 20:59754581-59754603 CGGTGGGTGCAGAGGTGAGTTGG + Intronic
1175720231 20:61281275-61281297 GGGGCTGTGGGGAGGTGAGTAGG + Intronic
1175913005 20:62413598-62413620 CCGGCTGTCCAGGGCTGAGTTGG - Intronic
1176804032 21:13462830-13462852 CAGGATGTGCAGGGGAGAGAGGG - Intergenic
1179272926 21:39865662-39865684 CAGGCTGTGCAGAGGGCATGTGG - Intergenic
1179554181 21:42162202-42162224 GTGGCTGTGCGGGGGTGAGTCGG + Intergenic
1179554190 21:42162236-42162258 GTGGCTGTGCAGGGGTGAATGGG + Intergenic
1179554207 21:42162302-42162324 ATGGCTGTGCAGGGGTAAGTTGG + Intergenic
1179554216 21:42162336-42162358 ATGGCTGTGCAGGGGTGAGTTGG + Intergenic
1179554224 21:42162370-42162392 ACGGCTGGGCAGTGGTGAGTAGG + Intergenic
1179554232 21:42162404-42162426 ATGGCTGTGCAGGGGTGAGCTGG + Intergenic
1179554265 21:42162580-42162602 AAGGCTGGGCAGGGGTTAGTAGG + Intergenic
1179554275 21:42162614-42162636 ATGGCTGGGCAGAGGTGAGTGGG + Intergenic
1179554302 21:42162717-42162739 ATGGCTGGGCAGGGGTGAGTTGG + Intergenic
1179554337 21:42162854-42162876 GTGGCTGTGCAGGGGTGAGTCGG + Intergenic
1179554344 21:42162887-42162909 ATAGCTGTGCAGGGGTGAGTGGG + Intergenic
1179554351 21:42162921-42162943 GTGGCTGTGCAGGGGTGAGTGGG + Intergenic
1179554392 21:42163128-42163150 ACGGCTGGGCAGAGGTGAGTCGG + Intergenic
1179895241 21:44358165-44358187 GAGTCTGTGCAGAGCTGAGGAGG - Intronic
1180629983 22:17221785-17221807 CAGGCTCTGCAGAGGTGCAGGGG + Intronic
1180723147 22:17924294-17924316 CTGGCTGTGCCCTGGTGAGTTGG - Intronic
1181276147 22:21688509-21688531 CAGGCGGGGCTGGGGTGAGTGGG + Intronic
1181584347 22:23844945-23844967 CAGGCCAGGCAGAGGTGTGTCGG + Intergenic
1182257379 22:29048960-29048982 CAGGCAGAGCAGTGGGGAGTTGG + Intronic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1183967213 22:41448942-41448964 CAGGATGTGCAGAGGCAATTTGG - Intergenic
1184548497 22:45190265-45190287 CACGCTGGGGAGAGGTGTGTGGG - Intergenic
1185041906 22:48508424-48508446 CAGGGTGTGCCCAGGTGAGGGGG + Intronic
949876323 3:8628227-8628249 CAGGCAGTGCAGGAGTGAGCTGG + Intronic
949878610 3:8644006-8644028 CAGGCAGTGCAGAGGGGTGGTGG - Intronic
949889566 3:8723755-8723777 CTGGCTCTGCAGAGGTGAGGAGG - Intronic
949959756 3:9302317-9302339 CAGGCTGGGGAGGGGTGAGGGGG - Intronic
950004072 3:9680137-9680159 CAAGCTGTCCAGAGTAGAGTTGG + Intronic
950121622 3:10485681-10485703 GATTCTCTGCAGAGGTGAGTAGG - Intronic
950534810 3:13572600-13572622 AAGGCTGTGCAGAGGCTGGTAGG + Intronic
950777334 3:15362036-15362058 GAGACTGTGCAGCGGTGAGGAGG - Intergenic
951680059 3:25285409-25285431 CAGGCTGTGCAGGGGTTTGTAGG + Intronic
952822685 3:37498677-37498699 GAGGGTGGGCAGTGGTGAGTGGG + Intronic
953076810 3:39579139-39579161 CAGACTGTATAGAGGTGAGAAGG + Intergenic
953586630 3:44207064-44207086 CTGGCTGTGCAGCTGTGCGTGGG - Intergenic
956651018 3:71504863-71504885 CAGGCTTTGCACATGTTAGTTGG - Intronic
956902844 3:73734815-73734837 AAGGGTGTGCAGAGCTGAATAGG + Intergenic
957169579 3:76720766-76720788 CAGGCTTTGCAAAAGAGAGTGGG - Intronic
957188272 3:76971883-76971905 CAGGCAGTGCAGAGGTGAGCAGG + Intronic
957602508 3:82356259-82356281 GAGACTGTGCAGATGTGATTAGG - Intergenic
958183187 3:90085441-90085463 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
960234951 3:115271404-115271426 CAGGGGGTGCAGAGGTGCCTTGG + Intergenic
961021577 3:123511956-123511978 CAGCCTGTGCAGAGGTCACATGG - Intronic
961372630 3:126440806-126440828 CAGCCTGGGCAGAGGTGGGCTGG - Intronic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
961555049 3:127691585-127691607 CAGGCTTTGCAGAGGGGCGGGGG - Exonic
961618793 3:128206788-128206810 CAGACAGTGCAGAGCTGGGTTGG + Intronic
962192621 3:133327448-133327470 CTGGCTGAGCAGAGCTGACTGGG - Intronic
962251760 3:133840161-133840183 CAGGCTCTGCAGATGAGAGGAGG + Intronic
962352025 3:134663415-134663437 CAGGCTCTGCAGCAGTGAGAAGG - Intronic
962872481 3:139509688-139509710 GGGGCTGTTCAGAGGTGTGTGGG - Intergenic
963451758 3:145490788-145490810 CAGGGAGTACACAGGTGAGTGGG - Intergenic
963456353 3:145552525-145552547 CAGACTGTATAGAGGTGAGAAGG + Intergenic
964445120 3:156750496-156750518 CTGGCTGTACAGATGTGAGTAGG + Intergenic
965622161 3:170652797-170652819 CAGGCTGTGTAGATGTAAGCTGG - Intronic
965899397 3:173619928-173619950 CAGGATGTGCAGGGATGAGTGGG + Intronic
965904247 3:173683405-173683427 CAGGCTGAGGAGAGCTTAGTGGG - Intronic
966966677 3:185001668-185001690 CAACCTGTGCAGAGGGGAGAGGG - Intronic
967243860 3:187467605-187467627 CAGACTGTATAGAGGTGAGAAGG + Intergenic
967910003 3:194534837-194534859 CAGAGTGTAGAGAGGTGAGTGGG - Intergenic
968619673 4:1598174-1598196 CCGGCTGTGGGGAGGTAAGTGGG + Intergenic
968670940 4:1851207-1851229 CAGGCTGTGCAGAGGCTAGGCGG + Intronic
969451830 4:7278252-7278274 CAGGCTGCTCAGAGGAGAGAGGG - Intronic
969526774 4:7707852-7707874 CTGGCTGGGGAGAGGTGAGCTGG + Intronic
969590084 4:8117007-8117029 CAGGCTGTGCAGAGATGGTGAGG - Intronic
969921393 4:10543591-10543613 CAGGCGGTGCAGTGGAGAGCGGG - Intronic
971188228 4:24401794-24401816 AAGGCTGATGAGAGGTGAGTGGG + Intergenic
973835780 4:54807565-54807587 CAGGCCTTGCAGAGCTGTGTGGG - Intergenic
974827655 4:67151548-67151570 CTGGCTGTGCAGCTGTGCGTGGG - Intergenic
975839525 4:78458744-78458766 CAATCTGTGCAGAGGTGGGGTGG - Intronic
976593952 4:86876440-86876462 CAGGCTGCGCAAAGGAGAGGGGG + Intronic
976975857 4:91165555-91165577 CAGGCCTTGCAGAGCTGAGGTGG + Intronic
978395207 4:108271636-108271658 CAGGCTGTGAAGAACTCAGTGGG + Intergenic
978696721 4:111589221-111589243 TAGTCTGTGCAGAGGTGTTTGGG - Intergenic
979894854 4:126146468-126146490 CAGACTGTGTAGAGGTGGGAAGG + Intergenic
982326309 4:154132561-154132583 CAGGCTGTGGAGGAGAGAGTTGG + Intergenic
983024196 4:162713475-162713497 CAGACTGTGTAGAGGTGGGTAGG - Intergenic
985616051 5:922641-922663 CAGGCGGTGCAGAGGCGGGGGGG + Intergenic
985819446 5:2149692-2149714 CAGGCAGGGCAGAGGTCAGCAGG - Intergenic
986670652 5:10140071-10140093 TAGGCTGTGGGGAGGTGATTAGG + Intergenic
987282313 5:16424096-16424118 CAGACTGTACAGAGGTGGGAAGG - Intergenic
987452198 5:18099681-18099703 CAGGATGAACAGAGGTTAGTGGG + Intergenic
987487802 5:18542689-18542711 CAGACTGTACAGAGGTGGGAAGG - Intergenic
990431352 5:55738088-55738110 CAAGCCGCGGAGAGGTGAGTGGG + Exonic
990978276 5:61578238-61578260 CTGGCTGTAGAGAGGTGAGCTGG - Intergenic
994557231 5:101319283-101319305 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
995296984 5:110534211-110534233 CAGACTGTATAGAGGTGAGAAGG - Intronic
996202946 5:120698922-120698944 CAGACTGTACAGAGGTGGGAAGG + Intergenic
997487647 5:134245209-134245231 CTGGCTGTGCAGCTGTGTGTGGG - Intergenic
998109265 5:139488505-139488527 CAGGCTGTGGAGCGGAGTGTGGG - Intergenic
999359482 5:150970946-150970968 CAGGCTTTTGAGGGGTGAGTTGG + Intergenic
999636616 5:153629544-153629566 CTAGCTGTGCAGTGGTGACTAGG + Intronic
999673431 5:153976804-153976826 CAGGCTGTGCAGTGCTTAGCAGG - Intergenic
999727306 5:154446916-154446938 CCGGCTCTGCAGAACTGAGTTGG + Intronic
999886524 5:155929756-155929778 AAGGCTGTGGAGCAGTGAGTAGG - Intronic
1001137874 5:169117423-169117445 CAGGCTGGGAAGAGGTGAGGGGG - Intronic
1001192232 5:169641806-169641828 AAGGTTGTGCAGAGATGGGTGGG - Intronic
1001259064 5:170211276-170211298 CAGGTTGTGGAGAGGTGAAAAGG + Intergenic
1002276839 5:178109374-178109396 TGGGCTGGGCAGAGGTGAGGAGG - Intergenic
1003402753 6:5804353-5804375 AAGGCTCTGCAGAGATGACTGGG - Intergenic
1005911865 6:30317573-30317595 TGGGCTCTGCAGAGGTGTGTTGG - Intergenic
1006784883 6:36659706-36659728 CGGGGTGTGCAGTGGTGTGTGGG + Intergenic
1009281868 6:61762570-61762592 CAGCATGTGCAGAGATGACTTGG - Intronic
1015837124 6:137432506-137432528 CAAGCTCAGCAGAGGGGAGTTGG + Intergenic
1016857453 6:148685114-148685136 CAGGTTGGGCAGAGGTGGGGTGG + Intergenic
1017198632 6:151729117-151729139 GAGGCTGTTGAGAGGTGATTAGG + Intronic
1017779025 6:157701989-157702011 CAGACTGTGTAGAGGTGGGAAGG + Intronic
1019324075 7:429504-429526 CAGGTTGTGCAGGGTTCAGTGGG - Intergenic
1019503411 7:1377083-1377105 CAGGGGCTGCAGAGGTGGGTGGG + Intergenic
1021527525 7:21605459-21605481 CAGGGAGAGCAGAGTTGAGTTGG + Intronic
1021530485 7:21639220-21639242 GAGGCTGTGCAAAAGGGAGTAGG + Intronic
1021992734 7:26152940-26152962 CAGGCTGTGCAGGGGGGCGGCGG + Exonic
1022589689 7:31649909-31649931 CAATTTGTGCAGAGGTGATTTGG + Intronic
1022787233 7:33650742-33650764 CAGCCAGTGCTGAGGTGAGCTGG + Intergenic
1023629975 7:42154304-42154326 GAGGGTGTGCAGTGCTGAGTGGG - Intronic
1023937308 7:44748978-44749000 CAGGCCGGGCGGAGGTGAGCGGG + Exonic
1024240677 7:47433040-47433062 CAGGGTGTGGAGGGGTGAGGAGG + Intronic
1024675755 7:51636625-51636647 CTGGCTGTGCAGAGGAGAGGAGG + Intergenic
1027948484 7:84780968-84780990 CAGCCTGTGCAGAGCTCAGAGGG - Intergenic
1028046792 7:86130515-86130537 GAGGGAGTGCACAGGTGAGTGGG + Intergenic
1029638871 7:101805454-101805476 GAAGCTGTGCAGAGCTCAGTGGG + Intergenic
1029957245 7:104652823-104652845 CAATCTGTGCAGAGGTGACTGGG + Intronic
1030345624 7:108430065-108430087 CAGGGGCTGCAGAGCTGAGTTGG + Intronic
1030617814 7:111756792-111756814 CAAGCTGTGCTGAGATGAATAGG + Intronic
1032110532 7:129071689-129071711 CATGCAGAGCAGAGGTGAGATGG + Intergenic
1032395713 7:131588365-131588387 CAGCCTGTGCAGAGGAGACCAGG - Intergenic
1033453459 7:141481882-141481904 CAGCCCGGGCAGGGGTGAGTAGG + Intergenic
1033495121 7:141886472-141886494 CTGGCTGTTCAGAGCAGAGTGGG + Intergenic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1034295962 7:149972680-149972702 CTGGCTGTGCAGTGATGAGCTGG - Intergenic
1034411383 7:150944105-150944127 CAGGCTGTGCCCAGCTGGGTGGG - Intergenic
1034430043 7:151036636-151036658 CAGACAGTGCAAAGGTAAGTGGG + Exonic
1034810089 7:154124222-154124244 CTGGCTGTGCAGTGATGAGCTGG + Intronic
1034995950 7:155577450-155577472 GAGGCTGTGCAGGGCTGAGGAGG + Intergenic
1035381780 7:158445307-158445329 CAGTCAGGGCAGAGGTGAGCAGG - Intronic
1035613130 8:982054-982076 CATGCTGTGCAGAGGAGACATGG - Intergenic
1035658197 8:1327280-1327302 GAGGCTGTGCAGTGGAGGGTGGG - Intergenic
1036207793 8:6818040-6818062 CAAGTTGTGCAGAGGTGACAGGG - Intronic
1036562467 8:9908229-9908251 CAGGCTCTGCAGGCCTGAGTGGG + Intergenic
1037761258 8:21743249-21743271 AAAGCTGTGCAGAGGAGTGTCGG - Intronic
1039060149 8:33566532-33566554 CGCGCTGTGCAGAGCAGAGTGGG + Intronic
1039577325 8:38633886-38633908 GAGGCTGTGGGGAGGTGAGATGG + Intergenic
1039969495 8:42309012-42309034 CAGCCCGTGCAGTGGTGAGTGGG + Exonic
1041358970 8:57030239-57030261 CAGTTTGTGCAGAGGTGACTGGG - Intergenic
1042526473 8:69769722-69769744 CAGGCTGGGGAGATGGGAGTTGG + Intronic
1043309244 8:78837830-78837852 CTGACTGTCCACAGGTGAGTGGG - Intergenic
1044738747 8:95304409-95304431 CAGGCTTTCCAGCGTTGAGTGGG - Intergenic
1046198792 8:110894585-110894607 CAGGCTGTGTAGCTGTGTGTGGG - Intergenic
1047311216 8:123694030-123694052 CAGTCTGCTCAGAGGTCAGTGGG - Intronic
1047419861 8:124698538-124698560 CAGCCTGGGCAACGGTGAGTTGG - Intronic
1047802186 8:128321487-128321509 GAGGGTGTGCAGGGGTGAGGGGG + Intergenic
1047934615 8:129764612-129764634 CTGGCTATGCAGAGGTGGGAAGG + Intronic
1049578700 8:143401139-143401161 GAGGCTGTGCAGGGGTGAGAGGG + Intergenic
1049623737 8:143610937-143610959 AAGGCTGTGGGGAGGTGAGAGGG + Intergenic
1050842862 9:10174369-10174391 CAGCCTGTGCAGAGGTCACTTGG - Intronic
1053287140 9:36856992-36857014 CAGGTTCTGCAGAGTTGAGTAGG + Intronic
1057182138 9:93035957-93035979 CAGGCTGGGCAGAGGCGGGGTGG - Exonic
1058531701 9:105912301-105912323 CAGGCTGGGCAGAGGAGTCTAGG - Intergenic
1058826913 9:108783295-108783317 CAGGCTGTGTCTAGGTGTGTAGG - Intergenic
1059669562 9:116479401-116479423 CAGGCTGTGCCCAGGAGAGGTGG + Intronic
1059676787 9:116547953-116547975 CAGGGTGTGTGGGGGTGAGTTGG - Intronic
1061751939 9:132784602-132784624 GAGGCTGTGCAGAAGGGATTTGG + Intronic
1062070665 9:134553502-134553524 CAGGCTGGGGAGAGGAGAGCAGG + Intergenic
1062399556 9:136366453-136366475 CACGGGGTGCAGAGGTGAGCAGG - Intronic
1062526435 9:136979773-136979795 CAGGCTGTGCAGGCGAGAGCAGG + Intronic
1186876101 X:13819840-13819862 AAAGCTTTGCAGAGTTGAGTTGG + Intronic
1188182465 X:27072932-27072954 GAGGGTGAGCACAGGTGAGTGGG - Intergenic
1189155269 X:38750324-38750346 CAGGCTGAGGAGAGGTCAGAGGG - Intergenic
1190333432 X:49249271-49249293 CAGGTTGGGCGGGGGTGAGTGGG + Intronic
1192125397 X:68497270-68497292 CAGGCAGTGCTCAGGTTAGTTGG - Intergenic
1192148549 X:68697823-68697845 CAGGCTGTGGTGAGGTGGGTGGG - Intronic
1193427242 X:81354908-81354930 CAGGCTCTAGGGAGGTGAGTGGG - Intergenic
1193886242 X:86986179-86986201 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
1196193761 X:112819343-112819365 CAGGCTCTGCAATGGTGAATCGG + Intronic
1196282009 X:113832965-113832987 CAGGCTTTTCAGAGGTGGTTAGG - Intergenic
1197889947 X:131259524-131259546 GAGGCTGAGAAGAGGTGAGTGGG + Intergenic
1198000731 X:132433180-132433202 CAGGCTGTGCATATGTGACCAGG - Intronic
1198579580 X:138048935-138048957 CAGCCTGTGCAGAGCTCAGAGGG + Intergenic
1200005970 X:153084459-153084481 CAGTCTGTTCAGGGGTGAGCTGG + Intergenic
1200073829 X:153541650-153541672 CAGGCTGTGCGGAGGACAGAAGG - Exonic
1200385029 X:155881541-155881563 GAGGCAGTGCAGGGGTGACTTGG + Intronic
1200405903 Y:2811263-2811285 CAGGCCTTGCAGAGCTGAGGTGG + Intergenic