ID: 901013291

View in Genome Browser
Species Human (GRCh38)
Location 1:6212940-6212962
Sequence TGACCTCTAATTAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901013291_901013296 -7 Left 901013291 1:6212940-6212962 CCTCCCTCTTTAATTAGAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 193
Right 901013296 1:6212956-6212978 GAGGTCATCATGGAAATGGTCGG 0: 1
1: 0
2: 3
3: 14
4: 178
901013291_901013299 13 Left 901013291 1:6212940-6212962 CCTCCCTCTTTAATTAGAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 193
Right 901013299 1:6212976-6212998 CGGGATATTTACGTGGTGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 49
901013291_901013297 -6 Left 901013291 1:6212940-6212962 CCTCCCTCTTTAATTAGAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 193
Right 901013297 1:6212957-6212979 AGGTCATCATGGAAATGGTCGGG 0: 1
1: 0
2: 1
3: 11
4: 147
901013291_901013298 6 Left 901013291 1:6212940-6212962 CCTCCCTCTTTAATTAGAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 193
Right 901013298 1:6212969-6212991 AAATGGTCGGGATATTTACGTGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901013291 Original CRISPR TGACCTCTAATTAAAGAGGG AGG (reversed) Intronic
901013291 1:6212940-6212962 TGACCTCTAATTAAAGAGGGAGG - Intronic
903421886 1:23223820-23223842 TGACCTCAAATTCACCAGGGTGG + Intergenic
907988794 1:59558702-59558724 TGACCTCAAATTTACCAGGGTGG + Intronic
909082836 1:71134559-71134581 TGACCTCAAATTCACTAGGGTGG + Intergenic
909824559 1:80111033-80111055 TGACCTCAAATTTACCAGGGTGG + Intergenic
910449325 1:87330221-87330243 TTACCTCTCACTAAAGATGGGGG + Intronic
910638790 1:89438563-89438585 TGACCTCAAATTCACCAGGGTGG - Intergenic
911030212 1:93479452-93479474 TGACCTCAAATTCACCAGGGTGG + Intronic
912112347 1:106358606-106358628 TGACCTCAAATTTACCAGGGTGG + Intergenic
912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG + Exonic
916746661 1:167690069-167690091 TGACCTTGAATTTAGGAGGGTGG - Exonic
917381136 1:174409814-174409836 TGACCTCAAATTTACCAGGGTGG - Intronic
918461769 1:184784007-184784029 TGACCTCAAATTCACCAGGGTGG - Intergenic
918536288 1:185578558-185578580 TGACCTCAAATTTACTAGGGTGG - Intergenic
919301020 1:195766007-195766029 TGACCTCTGATAAAATATGGGGG + Intergenic
920087125 1:203425658-203425680 TGACCTCTATACAAAGAGAGGGG + Intergenic
921433693 1:215091769-215091791 TGACTTTTAAGTAAAGAGTGAGG + Intronic
923242596 1:232100024-232100046 TGACCTCAAATTCACCAGGGTGG + Intergenic
923543327 1:234905636-234905658 TGAGCTGTAATAAAATAGGGAGG - Intergenic
924279199 1:242419117-242419139 TGATCTGTAACCAAAGAGGGTGG + Intronic
1063853683 10:10222544-10222566 TGAGCTCTCATTAAAGTGTGTGG - Intergenic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1064522977 10:16222966-16222988 TGACCTCAAATTCACCAGGGTGG + Intergenic
1065475918 10:26137861-26137883 TGACCTCAAATTTACCAGGGTGG - Intronic
1067546999 10:47199514-47199536 TCATCTCTAATTAAAGAGATAGG - Intergenic
1067781121 10:49208304-49208326 TGAGCTCTAATTAAAGTTGGGGG + Intergenic
1068754628 10:60637900-60637922 TGATCCCTAAGTGAAGAGGGAGG + Intronic
1069198436 10:65583112-65583134 TGACCTCAAATTCACCAGGGTGG - Intergenic
1069812044 10:71168684-71168706 TGACCTCTATTTTAAGAGGCAGG + Intergenic
1072295905 10:94009383-94009405 TGACCTCTAATATTAGAGGTGGG - Intronic
1076085754 10:127629438-127629460 TGACCACAAATTTACGAGGGTGG + Intergenic
1078804536 11:14684582-14684604 TGACCTCAAATTCACCAGGGTGG + Intronic
1081140587 11:39493970-39493992 TGACCTCAAATTCACCAGGGCGG - Intergenic
1082062938 11:47875968-47875990 TGACCTCAAATTTACCAGGGCGG + Intergenic
1085480206 11:76815794-76815816 TGACCTCAAATTTACCAGGGTGG + Intergenic
1085947174 11:81285533-81285555 TGACCTCAAATTTACCAGGGTGG - Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1096468743 12:51863613-51863635 TGACCTATGATTTAAGAGGTCGG + Intergenic
1097312879 12:58140487-58140509 TCACCTTTAATTATATAGGGAGG - Intergenic
1097664414 12:62463522-62463544 TGACCTCAAATTTACCAGGGTGG - Intergenic
1099318856 12:81119422-81119444 TGACCTCAAATTTACCAGGGTGG + Intronic
1099800960 12:87455814-87455836 TGACCTCAAATTTACCAGGGTGG + Intergenic
1100867369 12:98871018-98871040 TGACCTCAATTCAAAGAGGTGGG - Intronic
1103049531 12:117767502-117767524 TGAAGTCTAGTTAAAGAGGCTGG + Intronic
1103817485 12:123670714-123670736 TGGCTTCTAAATAAAAAGGGTGG - Intergenic
1110080113 13:71298957-71298979 TGACCTCAAATTAACCAAGGTGG + Intergenic
1110953676 13:81525177-81525199 TGACCTCAAATTTACCAGGGTGG - Intergenic
1111089221 13:83420627-83420649 TTACCTATACGTAAAGAGGGAGG - Intergenic
1114850088 14:26373295-26373317 TGTCCTCCAATGAAAGAGAGAGG - Intergenic
1116757530 14:48966288-48966310 TGACCTTGAATGAAAGAGAGGGG - Intergenic
1116935150 14:50732122-50732144 TGATCTTTAATTACAGTGGGGGG + Intronic
1117098601 14:52322574-52322596 TGACCTCAAATTAACCAGGGTGG + Intronic
1117201514 14:53394660-53394682 TGACCTCAAATTTACCAGGGTGG + Intergenic
1118216339 14:63812056-63812078 TGACCTCAAATTTACCAGGGTGG + Intergenic
1122844243 14:104482178-104482200 TGACCTCAAATTCACCAGGGTGG + Intronic
1127092374 15:55479849-55479871 TGACCACAAATTTACGAGGGTGG - Intronic
1129043251 15:72708864-72708886 TGACCTCAAATTTACCAGGGTGG - Intronic
1129089051 15:73129559-73129581 TCATCGCTAATGAAAGAGGGGGG + Intronic
1129454847 15:75671098-75671120 TGTCCCCTAATTAAAGGGTGAGG + Intergenic
1130179936 15:81615464-81615486 TGTCCTTTTATTAAAGAGGGAGG + Intergenic
1131883024 15:96878590-96878612 TGAATTCTAATTAAAGATTGAGG - Intergenic
1131978455 15:97970725-97970747 TTACCTCTGAATAAAGAGGTGGG - Exonic
1134511360 16:14850334-14850356 TGACTTCTAGAGAAAGAGGGAGG + Intronic
1134699004 16:16248831-16248853 TGACTTCTAGAGAAAGAGGGAGG + Intronic
1134972833 16:18545842-18545864 TGACTTCTAGAGAAAGAGGGAGG - Intronic
1136505032 16:30697928-30697950 TGATCTGTAAATAAAAAGGGAGG + Intergenic
1138200513 16:55084828-55084850 TGAACACTAAATAAACAGGGTGG + Intergenic
1141262335 16:82465137-82465159 TGACCTCTAATACAGGAGGGAGG - Intergenic
1144365274 17:14537887-14537909 TGACTTCTAATTTTAGAGAGAGG + Intergenic
1147330375 17:39695831-39695853 TGACCTCTAAGTCAACAGGCTGG - Intronic
1148653064 17:49263518-49263540 TGCCCTCAAATAAAAGAGAGAGG + Intergenic
1149079646 17:52638959-52638981 CTACCTCTCATTCAAGAGGGAGG + Intergenic
1149207479 17:54265039-54265061 TGACCTCAAATTCACCAGGGTGG + Intergenic
1151237404 17:72731229-72731251 TGAGCTCTAATTGAAGACAGGGG - Intronic
1155030626 18:21980638-21980660 GGACCTCTAATTTCTGAGGGTGG + Intergenic
1157645037 18:49259947-49259969 AGACCTCTAATTAAAGAGAGAGG + Intronic
1159347729 18:67228346-67228368 TGACCTCAAATTTACCAGGGTGG - Intergenic
1159815723 18:73071874-73071896 TGACCTCAAATTTACCAGGGCGG - Intergenic
1164262224 19:23577840-23577862 TAACCTCTAATTATATAAGGAGG - Intronic
1164642991 19:29840071-29840093 TGACCTGCAATTAAAAATGGGGG + Intergenic
1166426862 19:42686756-42686778 TGACCTCAAATTTACCAGGGCGG + Intronic
1166504805 19:43364528-43364550 TGGCATCTGATTACAGAGGGAGG - Intergenic
1166505735 19:43370386-43370408 TGGCATCTGATTACAGAGGGAGG + Intergenic
1168712189 19:58507876-58507898 TGACCTCAAATTTACCAGGGCGG - Intronic
925974710 2:9133851-9133873 TGACCTCAAATTTACCAGGGCGG + Intergenic
926586495 2:14691580-14691602 TGACCTCAAATTTACCAGGGTGG + Intergenic
927079723 2:19615517-19615539 TGACCTCAAATTCACCAGGGTGG + Intergenic
927905765 2:26855116-26855138 TGATTTCTAATTTAAAAGGGAGG - Intronic
930434226 2:51319538-51319560 TGAACTCTCATTCAAGAGAGAGG - Intergenic
931739261 2:65227679-65227701 TGAGCTCCAATAAAAGATGGAGG - Intergenic
932395585 2:71445137-71445159 TGACCTCAAATTCACCAGGGCGG - Intergenic
933508854 2:83214315-83214337 GGACCTCAAATCAAAGAGGAGGG - Intergenic
935537015 2:104307051-104307073 TGGCCTCAAATCAAAGTGGGTGG + Intergenic
937616485 2:123928843-123928865 TCACCTCTAATTAAACAAGATGG + Intergenic
942166771 2:173248499-173248521 TGATTTCTAATTACAGAGTGTGG + Intronic
944174799 2:196817600-196817622 TGACCTCAAATTTACCAGGGTGG + Intergenic
946621037 2:221563402-221563424 TGATCCTTACTTAAAGAGGGCGG - Intronic
947129321 2:226905100-226905122 TGACCTCTCATTCCAGAAGGTGG - Intronic
947176586 2:227373322-227373344 TGGCCTCTAAATAAGGAGGGTGG - Intronic
947993106 2:234502583-234502605 TGACCACACATTAGAGAGGGTGG - Intergenic
948986232 2:241526085-241526107 TGACCTCAAATTTACCAGGGTGG - Intergenic
1169363149 20:4968627-4968649 TGACCTCTAAGAAAAGAGCCAGG + Intronic
1169367651 20:5003799-5003821 TGACATCTGATAAAACAGGGAGG - Intronic
1169604564 20:7302287-7302309 TGACCTCTGCTTAAAGAGCTTGG - Intergenic
1171054797 20:21895824-21895846 TGACCTCCAATTCTAGAGGTGGG - Intergenic
1174624650 20:51904051-51904073 TGAGTGCTAATTAAACAGGGTGG + Intergenic
1176885440 21:14249798-14249820 TGACCTCAAATTTACCAGGGCGG - Intergenic
1177903961 21:26952501-26952523 TGACCTCAAGTTAACTAGGGAGG - Intronic
1182572725 22:31250741-31250763 TATCCTATAATAAAAGAGGGAGG - Intronic
949231321 3:1754442-1754464 TGACCTCCAATTTACCAGGGTGG + Intergenic
950231252 3:11277762-11277784 TGACCTCAAATTTACCAGGGTGG + Intronic
950978305 3:17274243-17274265 TGACCTCTGATTAAACAAGGAGG - Intronic
951978490 3:28540846-28540868 TGACCTCAAATTCACCAGGGTGG + Intergenic
953987924 3:47459821-47459843 TGACCTCAAATTTACCAGGGCGG + Intronic
954217526 3:49132838-49132860 TGACCTCAAGGGAAAGAGGGAGG - Exonic
958417323 3:93890194-93890216 TGACCTCAAATTTACCAGGGTGG - Intronic
958621892 3:96573144-96573166 TGACCTCAAATTTACCAGGGTGG + Intergenic
959220050 3:103506796-103506818 TGACCTCAAATTTACCAGGGTGG + Intergenic
960646373 3:119888929-119888951 TGACCTCAAATTTACCAGGGCGG - Intronic
960666758 3:120116880-120116902 TGACCTCAAATTCACCAGGGCGG - Intergenic
962422980 3:135244233-135244255 TGGGATCTAATTAAAGAGGCAGG - Intronic
963344012 3:144071987-144072009 TGACCTCAAATTTACCAGGGTGG + Intergenic
963361306 3:144275270-144275292 TCACATCTATTTGAAGAGGGTGG + Intergenic
965330435 3:167367289-167367311 TGACCTAAAATTACAGAGGTAGG + Intronic
966258522 3:177947942-177947964 TGATAGTTAATTAAAGAGGGAGG + Intergenic
966498211 3:180604979-180605001 AGGCCTCTCATTAAAGATGGTGG - Exonic
967206940 3:187132442-187132464 TGAACTCTCATTGAAGAGGTGGG - Intronic
967778838 3:193413722-193413744 TGACCTCAAATTCACCAGGGTGG - Intronic
968342415 3:197967679-197967701 TGACCTCAAATTCACCAGGGTGG + Intronic
972940708 4:44191689-44191711 TGACCTCAAATTTACCAGGGCGG - Intronic
975790619 4:77946009-77946031 TGACCTCAAATTCACCAGGGTGG + Intronic
979027226 4:115592835-115592857 TGACCTCAAATTTACCAGGGTGG - Intergenic
979503594 4:121468000-121468022 TGACCTCAAATTCACCAGGGTGG + Intergenic
980473373 4:133278050-133278072 TGACCTCAAATTCACCAGGGTGG + Intergenic
981424540 4:144588037-144588059 TGACCTCAAATTCACCAGGGCGG + Intergenic
982661309 4:158210303-158210325 TTACCTCCACTTAAGGAGGGTGG - Exonic
983032261 4:162817649-162817671 TGACCTCAAATTTACCAGGGCGG - Intergenic
985332286 4:188851435-188851457 TGACCTCAAATTTACCAGGGTGG - Intergenic
985957435 5:3276076-3276098 TGACCCCAAATGAAGGAGGGAGG + Intergenic
990411885 5:55549283-55549305 TCACCTTTAACCAAAGAGGGTGG - Intergenic
990787161 5:59434579-59434601 TGAACTCTGAATAAAGAGGTGGG - Intronic
991264113 5:64696703-64696725 TGACCTCAAATTCACCAGGGTGG - Intronic
992464890 5:76993958-76993980 TGACCTCTCAATAAAAAGGCTGG - Intergenic
994615430 5:102098914-102098936 TGACCTCAAATTTACCAGGGTGG + Intergenic
997115729 5:131123911-131123933 TGACCTCAAATTTACCAGGGTGG - Intergenic
997737004 5:136220522-136220544 TGACCTCAAATTTACCAGGGTGG - Intronic
998518051 5:142773084-142773106 TGACCTCTAAAAATAGAGGGTGG + Intronic
1000880623 5:166692983-166693005 TGACCTCAAATTCACCAGGGTGG + Intergenic
1000909493 5:167005090-167005112 AGACATCTAATTAAATGGGGGGG - Intergenic
1004000532 6:11593057-11593079 TGCCCTCTAATTTCAGATGGAGG - Intergenic
1005477265 6:26219956-26219978 TGACCTGCAATTAAACAAGGTGG - Intergenic
1005815582 6:29549518-29549540 TGACCACTACTTTAAGAGGAAGG - Intergenic
1006292702 6:33152254-33152276 TGACCTCAAATTCACCAGGGTGG + Intergenic
1006686830 6:35842171-35842193 TGACCTCTAAATAAATTTGGAGG + Intronic
1008167202 6:48152900-48152922 TGACCTCAAATTTACCAGGGTGG - Intergenic
1008951935 6:57171325-57171347 TGATCTCTGATTAAAGGTGGTGG + Intergenic
1012138111 6:95584481-95584503 TGACCTCAAATTCACCAGGGTGG - Intronic
1012543661 6:100392729-100392751 TGACTTTTAATGAAATAGGGAGG + Intronic
1012591046 6:100981614-100981636 TGGCGTCTACTTGAAGAGGGAGG - Intergenic
1012704440 6:102503475-102503497 TGACCTCAAATTTACCAGGGTGG + Intergenic
1013489524 6:110632311-110632333 AGACCTCTGGTTAAAAAGGGAGG - Intronic
1014320717 6:119925038-119925060 TGACCTCAAATTTGCGAGGGTGG + Intergenic
1016291026 6:142528104-142528126 TGACATCTAATGACAGAGGCTGG + Intergenic
1017177564 6:151519083-151519105 TGACCTCAAATTCACCAGGGTGG + Intronic
1018102145 6:160450102-160450124 TGACCTCAAATTTACCAGGGCGG + Intronic
1028191491 7:87858105-87858127 TGACCTCAAATTTACCAGGGTGG - Intronic
1029470313 7:100750457-100750479 AGACATCTAACTAAAGAAGGTGG - Intronic
1034050253 7:147976399-147976421 AGACTTCTAATAAAAGAGGGTGG + Intronic
1036532973 8:9613624-9613646 TCAGGTCTAATTAAAGAGGTAGG + Intronic
1038006096 8:23431677-23431699 TGACTTTTAATTAAGGGGGGTGG + Exonic
1039501673 8:38022573-38022595 TGACCTCAAATTTACCAGGGTGG + Intergenic
1040426045 8:47287410-47287432 TGACCTCAAATTCACCAGGGTGG + Intronic
1040842677 8:51801269-51801291 TGACCTCAAATTTACCAGGGCGG - Intronic
1041367410 8:57123021-57123043 TGTCTTCTTATTAAAGAGGTGGG - Intergenic
1041907747 8:63052284-63052306 TGACCTCAAATTTACCAGGGTGG - Intronic
1042022866 8:64388726-64388748 TGATCTCTAATGAAAGAGACAGG + Intergenic
1043750808 8:83931331-83931353 TGACCTCAAATTTACGAGGGTGG - Intergenic
1044307796 8:90657653-90657675 TGACCTCAAATTCACCAGGGTGG + Intronic
1044385032 8:91577972-91577994 GGACATCTGATTAAACAGGGAGG + Intergenic
1046253554 8:111666247-111666269 TGACCTCCAATTTACCAGGGTGG + Intergenic
1050918236 9:11164365-11164387 TACCTACTAATTAAAGAGGGAGG - Intergenic
1052243756 9:26308012-26308034 TCACCTCTAGTTATGGAGGGTGG - Intergenic
1052400462 9:27993642-27993664 TAACCTATATTTAAAGAGGCAGG - Intronic
1053532838 9:38898930-38898952 TAACTTCTAATTAAAGCTGGAGG - Intergenic
1054205064 9:62123359-62123381 TAACTTCTAATTAAAGCTGGAGG - Intergenic
1054633295 9:67465011-67465033 TAACTTCTAATTAAAGCTGGAGG + Intergenic
1055048063 9:71951466-71951488 TGACTTCTAATTAAGGGTGGTGG - Intronic
1055451479 9:76434938-76434960 TGACCTCAAATTTACCAGGGTGG - Intronic
1057629529 9:96707979-96708001 TGACCTCTATTCGAAGATGGTGG + Intergenic
1059580878 9:115547094-115547116 TGACCTCAAATTCACCAGGGTGG + Intergenic
1186834136 X:13420553-13420575 TGACCTCTAACTAAAAATGGTGG + Intergenic
1187718061 X:22123400-22123422 TCACCTCAAATGAAAGAAGGAGG - Intronic
1188986281 X:36771276-36771298 TGACCTACAATTAGAGAGGTTGG - Intergenic
1190801898 X:53796824-53796846 GGACCTCTAATTACAGAATGTGG - Intergenic
1193708431 X:84851448-84851470 TGACCTCAAATTCACCAGGGTGG - Intergenic
1194071116 X:89327529-89327551 TGACCTCAAATTCACCAGGGTGG - Intergenic
1194743773 X:97606583-97606605 TGACATCTTTTTGAAGAGGGAGG + Intergenic
1195490287 X:105460630-105460652 TGACCTTTAATTTCAGAGTGAGG - Intronic
1196597810 X:117565383-117565405 TGACCTCAAATTCACCAGGGCGG + Intergenic
1196944259 X:120808521-120808543 TGACCTCAAATTCACCAGGGTGG - Intergenic
1198001341 X:132441213-132441235 TGGCCTCTAATTAAAGACTTGGG + Intronic
1200725345 Y:6663274-6663296 TGACCTCAAATTCACCAGGGTGG - Intergenic
1201331886 Y:12832541-12832563 TGACAGCAAATTAAAGAGAGAGG - Intronic
1201553157 Y:15239967-15239989 TGAGCTATAATTAATGAAGGAGG - Intergenic
1201860451 Y:18591982-18592004 TGACCTCAAATTCACCAGGGTGG - Intergenic
1201872872 Y:18728399-18728421 TGACCTCAAATTCACCAGGGTGG + Intergenic