ID: 901014138

View in Genome Browser
Species Human (GRCh38)
Location 1:6218064-6218086
Sequence CCAGCACGCAGCTTCCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 140}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901014124_901014138 28 Left 901014124 1:6218013-6218035 CCTGGCGCCCTGCACCACACACC 0: 1
1: 0
2: 0
3: 24
4: 298
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014125_901014138 21 Left 901014125 1:6218020-6218042 CCCTGCACCACACACCCTTCCCT 0: 1
1: 1
2: 5
3: 62
4: 577
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014131_901014138 2 Left 901014131 1:6218039-6218061 CCCTCCCTCAGCGTGTCTGGCCC 0: 1
1: 0
2: 1
3: 17
4: 211
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014126_901014138 20 Left 901014126 1:6218021-6218043 CCTGCACCACACACCCTTCCCTC 0: 1
1: 8
2: 7
3: 66
4: 632
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014134_901014138 -3 Left 901014134 1:6218044-6218066 CCTCAGCGTGTCTGGCCCGACCA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014132_901014138 1 Left 901014132 1:6218040-6218062 CCTCCCTCAGCGTGTCTGGCCCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014129_901014138 6 Left 901014129 1:6218035-6218057 CCTTCCCTCCCTCAGCGTGTCTG 0: 1
1: 0
2: 2
3: 52
4: 456
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014127_901014138 14 Left 901014127 1:6218027-6218049 CCACACACCCTTCCCTCCCTCAG 0: 1
1: 1
2: 7
3: 121
4: 1378
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014128_901014138 7 Left 901014128 1:6218034-6218056 CCCTTCCCTCCCTCAGCGTGTCT 0: 1
1: 0
2: 3
3: 35
4: 514
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140
901014133_901014138 -2 Left 901014133 1:6218043-6218065 CCCTCAGCGTGTCTGGCCCGACC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG 0: 1
1: 0
2: 2
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901014138 Original CRISPR CCAGCACGCAGCTTCCATGA TGG Intronic
901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG + Intronic
901615083 1:10532551-10532573 CCAGCAAGCAGCTTCGACGGCGG + Intronic
901679035 1:10902550-10902572 GCAGCCAGTAGCTTCCATGAAGG + Intergenic
903005748 1:20297467-20297489 GCAGCTCCCAGCTTCCTTGAAGG - Intronic
903104814 1:21067537-21067559 TCAGCAAGCAGATACCATGATGG + Intronic
904461138 1:30680509-30680531 ACCGCAAGCAGCTTCCATGGCGG - Intergenic
904592716 1:31623995-31624017 CTAGAATGCAGCCTCCATGAAGG - Intronic
905277770 1:36830021-36830043 CAAGCAGGCAGCTTCCAGCAGGG - Intronic
906216166 1:44042019-44042041 ACAACACGCACCTTCCACGAGGG - Intergenic
906235027 1:44201337-44201359 CCGGTACTCAGTTTCCATGAGGG + Intergenic
907389116 1:54145075-54145097 CCAGAATGTAGGTTCCATGAGGG - Intronic
907424398 1:54370168-54370190 CCAGCCACCAGCTTCCAGGAAGG - Intronic
911062130 1:93757727-93757749 CCACCACACAGCTTCCTTGCTGG + Intronic
911178448 1:94840796-94840818 CCAGGACTCTGCTTCCATGCAGG - Intronic
912836373 1:112999998-113000020 CCAGCCCCCAGCTTCCAGGGAGG - Intergenic
915280770 1:154820707-154820729 CCACCAGGCAGCTTCCTTCATGG - Intronic
915799808 1:158778450-158778472 GCAGCAAGCAGCTCACATGAAGG + Intergenic
1064820097 10:19319663-19319685 CAAGCAGGCACCATCCATGAAGG - Intronic
1068191713 10:53660433-53660455 GCAGCAGGCCGCTTCCAAGATGG - Intergenic
1068227067 10:54118937-54118959 CCAGCAAACAGCTCCCACGATGG + Intronic
1073125616 10:101146993-101147015 CCAGCTCGCAGCCTCCCTGAAGG + Intergenic
1075904668 10:126070692-126070714 ACAGCAGGCAGCCTCCATGTGGG - Intronic
1076052403 10:127346231-127346253 CCAGCACACAGCTGCCCTGCTGG - Intronic
1076239676 10:128894919-128894941 CCAGGACACAGCATCCCTGAGGG + Intergenic
1077463460 11:2722367-2722389 CCAGCACTCAGCTCCCAGGATGG - Intronic
1079075203 11:17381189-17381211 CCAGGAAGCAGCTTTCAAGATGG - Intergenic
1079135537 11:17774287-17774309 CCAGGCCCCAGCTTCCATGTGGG + Intronic
1079981690 11:27157726-27157748 CCAGCACGCAGCTTGAGAGATGG - Intergenic
1080368461 11:31607395-31607417 CCAGCACTCTGCTTCCAAGATGG + Intronic
1084348478 11:68575187-68575209 CTGGCAAGCAGCTTCCATAAAGG - Intronic
1084573038 11:69970947-69970969 CCAGGGGGCAGCTTCCAAGAAGG - Intergenic
1085234817 11:75006254-75006276 CCAGCAGGCAGCCTCCAAGGGGG - Exonic
1086482715 11:87259918-87259940 CCAGCACTCAGCCACCATCAAGG - Intronic
1090752796 11:129762276-129762298 CCAGGACACAGCTTCCAGAATGG - Intergenic
1091601930 12:1923007-1923029 CTAGCACGCAGCCTCCATAAGGG + Intergenic
1095334798 12:41011736-41011758 CCAGCACGCTTCCTCCATTAAGG - Intronic
1095779885 12:46048089-46048111 CCAGCAAACAGCTTCCATGATGG + Intergenic
1099746265 12:86708409-86708431 CCAGCAGGCATTCTCCATGAGGG - Intronic
1100025510 12:90122723-90122745 CCATCATGCAGGTTCCAGGAAGG + Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104425808 12:128677359-128677381 CTAGCATGCTGCTTCCTTGAGGG - Intronic
1108044186 13:46367261-46367283 CCAGCACGCAGACTCCTTGAGGG + Intronic
1108249703 13:48551830-48551852 ACTGCACGCAGCTTCCACTATGG - Intergenic
1113294193 13:108939419-108939441 CCAGCAAACAGCCTCAATGATGG - Intronic
1113693498 13:112328447-112328469 CCTCCACCCAGCTTCCCTGAAGG - Intergenic
1114838615 14:26234652-26234674 AGAGCAAGCAGCTTCTATGATGG - Intergenic
1118904711 14:70015511-70015533 CCAACAAGCAGTTTCCAAGACGG - Intronic
1120856900 14:89220477-89220499 CCAGCACACAGCTTGCATTGCGG - Intronic
1120922346 14:89766362-89766384 CCAGCACCCCTCTTCCATGATGG + Intergenic
1121442223 14:93956490-93956512 CCAGCACTCAGGTCCCATGCTGG + Intronic
1121511447 14:94515962-94515984 CCAGCCCGCAGCATCCAAGGTGG + Exonic
1122374574 14:101249292-101249314 CCAGGATGCAGGTGCCATGAGGG + Intergenic
1124036310 15:26056827-26056849 CCAGCCCGCAGCTGCAATGTGGG + Intergenic
1128525329 15:68408410-68408432 TCAGGACGCAGGCTCCATGAGGG + Intronic
1128909152 15:71496470-71496492 CCAGCATGCAGCTTTCATCCAGG + Intronic
1131075604 15:89493318-89493340 TAAGCACGCAGCTTCCCTGTGGG - Intronic
1131383287 15:91981908-91981930 CCAGCAAGCAGCTGCTTTGAGGG - Intronic
1135351893 16:21736275-21736297 TCTGCAAGCAGCTTCCAAGATGG + Exonic
1135450379 16:22552398-22552420 TCTGCAAGCAGCTTCCAAGATGG + Intergenic
1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG + Intronic
1137672241 16:50285716-50285738 CCAGCAGGAACCTTGCATGAAGG - Intronic
1139285592 16:65810776-65810798 CCAGGACTCTGCTTCCAAGATGG + Intergenic
1142903875 17:3029671-3029693 CCAGCCAGCAGCTTCCAGGAAGG + Intronic
1143290023 17:5821409-5821431 CCTCTGCGCAGCTTCCATGAAGG - Intronic
1144586356 17:16490132-16490154 CCAGAGCGAAGCTTGCATGATGG - Intronic
1148903890 17:50899342-50899364 CCAGGGCACAGCTTCTATGAAGG + Intergenic
1150290243 17:63977040-63977062 ACAGCAAGCAGCTTCCATGGAGG - Intergenic
1152189331 17:78878971-78878993 CCAGCACGCCGCAGACATGAAGG + Intronic
1153402110 18:4692327-4692349 GCAGCAGGCCGCTTCCAAGATGG - Intergenic
1157424127 18:47570530-47570552 CCAGCAAGGACCTTCCTTGAGGG - Intergenic
1160340821 18:78087401-78087423 CCAGCACCCAGCATCTATGGAGG - Intergenic
1162893697 19:13751790-13751812 CCAGTAGGCAGCTCCCAAGATGG + Exonic
1163560977 19:18019259-18019281 CCAGCATGCAGCAGGCATGAGGG + Intergenic
1164303155 19:23979830-23979852 CCTGCACCCAGCTTTCAGGAGGG - Intergenic
1166658338 19:44628385-44628407 CCAGGATGCAAGTTCCATGAGGG - Intronic
925628153 2:5862650-5862672 GCTGCAAGCAGCTTCCATGTTGG - Intergenic
926037034 2:9643839-9643861 CCAGAACACAGCTTTCAAGAGGG - Intergenic
926692986 2:15750052-15750074 CCAGCACGCTGCTCCTTTGAAGG - Intergenic
927495623 2:23549835-23549857 CCAGCAGGCTGCTTGCATGGCGG + Intronic
940082845 2:149824023-149824045 ACAGTACTCACCTTCCATGAGGG - Intergenic
947760489 2:232600309-232600331 CCAGACCGCAGCTGCCAGGATGG + Intergenic
1171078554 20:22154603-22154625 CCAGTGCACAGCTTCCATCAAGG - Intergenic
1171994116 20:31719115-31719137 ACAGCATGCCGTTTCCATGAAGG + Intronic
1173527917 20:43746998-43747020 CCAGCTCCCAGCTTCCTGGAAGG + Intergenic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1175811963 20:61863305-61863327 CCAACTCGCTGCTTCCTTGATGG + Intronic
1177513618 21:22121026-22121048 CCAGCACGCTGCTTCTGTTAGGG + Intergenic
1179531029 21:42019844-42019866 CAAGCACGGAGACTCCATGAGGG - Intergenic
1179828682 21:43982660-43982682 CCAGAACTCCGCTTCCAAGAGGG + Exonic
1180854707 22:19038662-19038684 CCTGCACCGAGCTTCCTTGAGGG - Exonic
1180920524 22:19519401-19519423 CCAGCACACAGCTGTCCTGAGGG + Intronic
1182511643 22:30824370-30824392 CCAGAACTCAGCTACCATGTCGG + Intronic
1185048958 22:48543801-48543823 CCAGCAGGCAGCTTCCCTCCAGG + Intronic
1185105078 22:48864163-48864185 CCAGCAATCGGCTTCCAGGAGGG + Intergenic
949606157 3:5656660-5656682 CCAAGATGTAGCTTCCATGAGGG - Intergenic
950630142 3:14276758-14276780 CCAGCAGGCAGCTGACCTGAGGG + Intergenic
950686647 3:14623086-14623108 CCAGAAAGCAGCCTCCCTGAGGG - Intergenic
954314657 3:49794638-49794660 CCAGCATGCAGCCTCCATCCTGG - Exonic
963277029 3:143342122-143342144 CCAACAAGCAGCTTCAATGATGG - Intronic
966692046 3:182751960-182751982 GCAGCAGCCAGCTTCCAAGATGG + Intergenic
968744005 4:2349652-2349674 GCAGCATGCAGATGCCATGAGGG - Intronic
970890772 4:21042026-21042048 CCAGCACAATGCTTCCATCAGGG + Intronic
972853891 4:43082541-43082563 GCAGCACGCCACTTCCAAGATGG - Intergenic
976963560 4:91008797-91008819 GCAGCAGGCTGCTTCCAAGATGG + Intronic
981747903 4:148068711-148068733 CCAGGACGCAGCCTCCCTGTGGG + Intronic
985916405 5:2921989-2922011 CCAGCAGGAAACCTCCATGATGG - Intergenic
988069483 5:26267771-26267793 CCAGCAAACAGCCCCCATGATGG - Intergenic
992031660 5:72727628-72727650 CCAGCAGGGAGGTTCCAAGATGG + Intergenic
996666890 5:126070466-126070488 CCATCAGGCAGCTTCCACAATGG - Intergenic
999258627 5:150223714-150223736 CCTGCACACAGCTTCCCTGGTGG + Intronic
1000486254 5:161848241-161848263 GGAGCACGCAGAGTCCATGATGG + Exonic
1001313963 5:170629751-170629773 CCAGCACGCAGCATCTAGTAAGG + Intronic
1001515933 5:172355348-172355370 CTAGCCTGCAGCTTCCGTGAAGG - Intronic
1004871990 6:19914536-19914558 CCAGCAAGCAGCTCCCATGATGG + Intergenic
1005354266 6:24967636-24967658 CCAGCATAAAGCTTCCATTAGGG + Intronic
1005566852 6:27104853-27104875 CCAGCATGCCTCTTTCATGAAGG + Intergenic
1007228674 6:40332797-40332819 CAAACAAGCAGCTTCCATCATGG - Intergenic
1014449201 6:121564213-121564235 CCAGAATGTAGTTTCCATGAGGG - Intergenic
1015634589 6:135263237-135263259 CCGGCACCCAGCTTCCAGAATGG - Intergenic
1017463393 6:154672379-154672401 CCAGAAAGCAGCTTGGATGATGG - Intergenic
1019109953 6:169701922-169701944 ACAGCACCCAGCTCCCAGGAGGG + Intronic
1022024229 7:26430764-26430786 CCAGCACTCATCTTGCATGTTGG + Intergenic
1022340199 7:29460422-29460444 CCAGCAGGGAGCTTCTAAGAGGG + Intronic
1027267306 7:76501471-76501493 CCAGCACGCAGCTTGGATCATGG + Intronic
1027319117 7:77001336-77001358 CCAGCACGCAGCTTGGATCATGG + Intergenic
1028614973 7:92755801-92755823 CCAACAGTCAGCTTCCAGGAAGG + Intronic
1029601546 7:101566444-101566466 CCAGCACGCAGGCTCCCTAAAGG + Intergenic
1029792303 7:102857566-102857588 CCAGCACGCAGCTTTGGGGAGGG - Intronic
1035697010 8:1605713-1605735 CGAGCCCACAGCGTCCATGATGG + Intronic
1037396853 8:18452280-18452302 CTAGCATGCAGATTCCAAGAAGG + Intergenic
1039502737 8:38030393-38030415 CCAGGACGCTGCTTCCACGTGGG - Exonic
1046297602 8:112242107-112242129 TCAGCTCTCAGCTTCCATGTTGG - Intronic
1046753685 8:117951535-117951557 GCAGCAGGTATCTTCCATGAAGG - Intronic
1047585562 8:126268586-126268608 GCAGCACTCAGCCTGCATGAGGG + Intergenic
1049818438 8:144619342-144619364 CCGGCACGCAGCATGCATGTGGG + Intergenic
1052894354 9:33733535-33733557 CCAGGACGCAGCTTCCAGAATGG - Intergenic
1055752548 9:79522795-79522817 CCAGCACTCAGCCACCAAGAAGG + Intergenic
1055933690 9:81585526-81585548 ACAGCACGCAGCTCTCATGCAGG + Exonic
1057271961 9:93656539-93656561 CCAGCACGCAGTTTCAAAGTTGG - Exonic
1058682654 9:107453669-107453691 CCAGCACTCAGATTGCCTGAAGG - Intergenic
1058805998 9:108592602-108592624 CCAGCACTCTACTTCCTTGAGGG - Intergenic
1060065975 9:120501430-120501452 CCAGAATGCAAGTTCCATGAGGG + Intronic
1060884924 9:127144285-127144307 CCTGCACGAATCGTCCATGAGGG - Intronic
1061178479 9:129010848-129010870 CCAGCCCCCAGCTCCCATGCCGG - Intronic
1061497194 9:130981771-130981793 CCAGCACCCTCCTTCCATGGAGG - Intergenic
1061887888 9:133601959-133601981 CCAGCCCCCAGCTTCCCTGCTGG - Intergenic
1203489426 Un_GL000224v1:89463-89485 ACAGCACCAAGCATCCATGAGGG + Intergenic
1203502047 Un_KI270741v1:31351-31373 ACAGCACCAAGCATCCATGAGGG + Intergenic
1186089224 X:6026157-6026179 CCAGCATTCCGCTTCCATTATGG + Intronic
1195649867 X:107273221-107273243 CCAGAAAGCTGCTTCCAAGAAGG + Intergenic
1196258104 X:113546816-113546838 GCAGCAGGCAGCTCCCAAGATGG + Intergenic
1199953346 X:152723051-152723073 CCAGCCCCCAGCATGCATGAAGG - Intergenic
1199956336 X:152745399-152745421 CCAGCCCCCAGCATGCATGAAGG + Intergenic
1200060248 X:153480821-153480843 CCAGGCCACAGCTGCCATGAGGG + Intronic
1200975387 Y:9207229-9207251 GCTGCACTCAGCTTCCATTATGG + Intergenic
1202135763 Y:21659299-21659321 GCTGCACTCAGCTTCCATTATGG - Intergenic