ID: 901016703

View in Genome Browser
Species Human (GRCh38)
Location 1:6235991-6236013
Sequence CGCCGATGCCGGCCCGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901016696_901016703 0 Left 901016696 1:6235968-6235990 CCGGCTGCGCCTGCGCACTGTGC 0: 1
1: 0
2: 3
3: 21
4: 169
Right 901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 66
901016694_901016703 14 Left 901016694 1:6235954-6235976 CCCGGAGAAACGCGCCGGCTGCG 0: 1
1: 0
2: 1
3: 5
4: 58
Right 901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 66
901016692_901016703 24 Left 901016692 1:6235944-6235966 CCGGCTGTAGCCCGGAGAAACGC 0: 1
1: 0
2: 1
3: 1
4: 47
Right 901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 66
901016695_901016703 13 Left 901016695 1:6235955-6235977 CCGGAGAAACGCGCCGGCTGCGC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 66
901016697_901016703 -9 Left 901016697 1:6235977-6235999 CCTGCGCACTGTGCCGCCGATGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901016703 Original CRISPR CGCCGATGCCGGCCCGGGAA GGG Intergenic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
900947649 1:5840390-5840412 CCCCGATGCCTACCTGGGAAGGG + Intergenic
901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG + Intergenic
902645227 1:17793124-17793146 AACAGATGCCGGCCTGGGAATGG + Intronic
906214324 1:44030366-44030388 GGCCGGTGCCGGCCCGGGGGCGG - Intronic
907341456 1:53738818-53738840 CGCCGAGGCACGCCCGGGGACGG + Intergenic
915517551 1:156421892-156421914 CTCCCCGGCCGGCCCGGGAAGGG - Intronic
921162547 1:212483402-212483424 CGCTAATGCCGGCCAGGAAACGG - Intergenic
924772225 1:247088286-247088308 AGCCGATGCAGGCTGGGGAATGG + Intergenic
1070967037 10:80536133-80536155 CGCGGATGGCAGCCCGGGAGCGG - Intergenic
1071997733 10:91163556-91163578 CGCGGCTGCCGGCGGGGGAAGGG - Intronic
1077048247 11:555526-555548 GGCGGCGGCCGGCCCGGGAAAGG + Intronic
1084128772 11:67118454-67118476 CGCCGGGGCCTGCCCGGGAATGG + Intergenic
1084494736 11:69497378-69497400 CACAGAGGCCGGCCCGGCAAAGG + Intergenic
1088522075 11:110711676-110711698 CGGCGATGTCTGCCCGGGAGCGG - Intronic
1095752818 12:45729726-45729748 CGCCGCCGCCGGCCGAGGAATGG + Exonic
1096435897 12:51591078-51591100 GGCCGGGGCCGGCCCGGGCAGGG + Intronic
1108541503 13:51451742-51451764 CGCCGCTGCCGGGCCGGGCCGGG + Intronic
1123024930 14:105420017-105420039 CGCCGCCGCCGGCCCGGACATGG + Exonic
1125535987 15:40441401-40441423 CGCCCCCGCCAGCCCGGGAAGGG + Intronic
1126846657 15:52766606-52766628 CACCCATGCTGGCCTGGGAAAGG + Intronic
1132807806 16:1783096-1783118 CAGCGAGGCCGCCCCGGGAAGGG - Intronic
1132828957 16:1918331-1918353 CGCCGCTCCAGGCCCGGGAGCGG + Exonic
1143656286 17:8295569-8295591 CGCCGACTCCGGCTCCGGAAGGG + Intergenic
1144584101 17:16477619-16477641 GGCAGAAGCCGGCCCAGGAAGGG + Intronic
1145234581 17:21199742-21199764 GGCTGCTGCCGGCCCAGGAAGGG - Intronic
1148560609 17:48603933-48603955 CGCCGAGGCCGGCGAGGGAGAGG - Intronic
1151662135 17:75524913-75524935 CTCCGACGCAGGCCCGGGAAAGG - Intergenic
1152713112 17:81884756-81884778 AGCCCATGCCGGCCAGGGAAAGG + Intergenic
1159040650 18:63320309-63320331 CGCCGCGGCAGGCCCGGGAGTGG + Intergenic
1162445186 19:10718448-10718470 CGCGGAGGGCGGACCGGGAATGG + Intronic
1165167721 19:33868942-33868964 CGACGCTGCCTGCCCGGGAGCGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165307948 19:35013658-35013680 CGTCGCTGCTGGCTCGGGAAAGG - Exonic
1165477404 19:36039386-36039408 CGCAGCTGCAGGCCCTGGAACGG - Exonic
1167645596 19:50703494-50703516 CCCCGAGGCCGGCCCAGGTAGGG - Exonic
1168696834 19:58408541-58408563 GGCCAATGGCGGCCCAGGAACGG - Intronic
929982998 2:46698902-46698924 CGCCGTGTCCGGCCGGGGAAAGG - Intergenic
1176232270 20:64038558-64038580 CGCCCGGCCCGGCCCGGGAAGGG - Intronic
1185299731 22:50073045-50073067 GGCCCACGCCTGCCCGGGAACGG - Intronic
1185299748 22:50073094-50073116 GGCCCACGCCTGCCCGGGAATGG - Intronic
952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG + Exonic
955298736 3:57757019-57757041 AGCGGAGGCCGCCCCGGGAAGGG - Exonic
964265343 3:154889332-154889354 AGCCCATGGCGGCCGGGGAATGG + Intergenic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
967157838 3:186709917-186709939 CACCGCGCCCGGCCCGGGAATGG - Intergenic
968542901 4:1177425-1177447 CCCCGATGCCTGACTGGGAAAGG - Intronic
969812585 4:9659993-9660015 AACCGATGCCGGCCGGGAAAGGG + Intergenic
973907675 4:55547102-55547124 CGCCGTTCCCGGCCGGGGCAGGG - Intronic
983940445 4:173530280-173530302 CGCCCCTGCCGCCCCGGGATTGG - Intergenic
992663342 5:78983339-78983361 CACCGTTCCCGGCCCAGGAATGG + Intronic
1002541191 5:179907601-179907623 CGCCGAGGCCGGGCCGGAACCGG + Intronic
1002664264 5:180810904-180810926 CGCCGTCGCCGGCGCGTGAACGG + Intronic
1015502832 6:133952077-133952099 GGCCGATGCCGGCCTGAGAGTGG + Intergenic
1017520090 6:155194410-155194432 CCCCGGTGCCAGCCAGGGAAGGG + Intronic
1026557361 7:71420123-71420145 CTCCGAGGCAGGCGCGGGAAGGG - Intronic
1029640416 7:101816433-101816455 CGCCGTTGCCGCCGCGGGACCGG + Intronic
1032037370 7:128530885-128530907 CGCCGAGGCGGATCCGGGAACGG + Intergenic
1036375898 8:8199221-8199243 AACCGATGCCGGCCGGGAAAGGG + Intergenic
1038540474 8:28386239-28386261 CCCGGATTCCCGCCCGGGAAGGG + Intronic
1041919837 8:63168987-63169009 CGCCGCTGCCGGCCCCATAACGG + Intronic
1049082936 8:140457244-140457266 CGCCGCGGACGGCCCGGGAGGGG + Intronic
1049411362 8:142475370-142475392 CGCCGAGGCCGGCCCGGGTGGGG - Intronic
1049665438 8:143840793-143840815 CGCCGAGGCGGGCCCGGGAACGG - Exonic
1049784505 8:144444117-144444139 CCCCGATCCCGGCCCGGGCCCGG + Intronic
1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG + Intronic
1056773950 9:89498086-89498108 CGCTGAGGCCGGCGCGGGGACGG + Intronic
1059375199 9:113876088-113876110 CGGCGAGGCCGGCCCGGGGGCGG + Intergenic
1062674226 9:137730799-137730821 AGCCGATTCCGGCCCTGGGAAGG - Intronic
1199772660 X:150984197-150984219 CGCCGCTGCGGGCCCTGGAGCGG + Intronic
1200214721 X:154362655-154362677 CGCCGAGGCTGGCCAGGGTAAGG - Exonic
1201240628 Y:11954197-11954219 CCTCGCTCCCGGCCCGGGAAAGG + Intergenic