ID: 901017854

View in Genome Browser
Species Human (GRCh38)
Location 1:6242089-6242111
Sequence GTGGCCCCTTTATGGCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901017842_901017854 19 Left 901017842 1:6242047-6242069 CCTGGGAACGGCGGGTGTCGGGG No data
Right 901017854 1:6242089-6242111 GTGGCCCCTTTATGGCGGCCCGG No data
901017840_901017854 20 Left 901017840 1:6242046-6242068 CCCTGGGAACGGCGGGTGTCGGG No data
Right 901017854 1:6242089-6242111 GTGGCCCCTTTATGGCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901017854 Original CRISPR GTGGCCCCTTTATGGCGGCC CGG Intergenic