ID: 901018024

View in Genome Browser
Species Human (GRCh38)
Location 1:6242654-6242676
Sequence GCGGGCCCTGCGGTCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901018011_901018024 6 Left 901018011 1:6242625-6242647 CCAGGCCCGGGTCGGCCCGGATC No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018007_901018024 11 Left 901018007 1:6242620-6242642 CCCTCCCAGGCCCGGGTCGGCCC No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018017_901018024 -9 Left 901018017 1:6242640-6242662 CCCGGATCTGGCCCGCGGGCCCT No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018014_901018024 0 Left 901018014 1:6242631-6242653 CCGGGTCGGCCCGGATCTGGCCC No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018008_901018024 10 Left 901018008 1:6242621-6242643 CCTCCCAGGCCCGGGTCGGCCCG No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018010_901018024 7 Left 901018010 1:6242624-6242646 CCCAGGCCCGGGTCGGCCCGGAT No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901017999_901018024 20 Left 901017999 1:6242611-6242633 CCCCCGCCGCCCTCCCAGGCCCG No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018004_901018024 17 Left 901018004 1:6242614-6242636 CCGCCGCCCTCCCAGGCCCGGGT No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018000_901018024 19 Left 901018000 1:6242612-6242634 CCCCGCCGCCCTCCCAGGCCCGG No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018013_901018024 1 Left 901018013 1:6242630-6242652 CCCGGGTCGGCCCGGATCTGGCC No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018018_901018024 -10 Left 901018018 1:6242641-6242663 CCGGATCTGGCCCGCGGGCCCTG No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018005_901018024 14 Left 901018005 1:6242617-6242639 CCGCCCTCCCAGGCCCGGGTCGG No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data
901018002_901018024 18 Left 901018002 1:6242613-6242635 CCCGCCGCCCTCCCAGGCCCGGG No data
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901018024 Original CRISPR GCGGGCCCTGCGGTCCGGGC TGG Intergenic