ID: 901018024

View in Genome Browser
Species Human (GRCh38)
Location 1:6242654-6242676
Sequence GCGGGCCCTGCGGTCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 297}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901018011_901018024 6 Left 901018011 1:6242625-6242647 CCAGGCCCGGGTCGGCCCGGATC 0: 1
1: 0
2: 1
3: 19
4: 184
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018010_901018024 7 Left 901018010 1:6242624-6242646 CCCAGGCCCGGGTCGGCCCGGAT 0: 1
1: 0
2: 1
3: 6
4: 66
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018004_901018024 17 Left 901018004 1:6242614-6242636 CCGCCGCCCTCCCAGGCCCGGGT 0: 1
1: 3
2: 4
3: 50
4: 668
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018013_901018024 1 Left 901018013 1:6242630-6242652 CCCGGGTCGGCCCGGATCTGGCC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018008_901018024 10 Left 901018008 1:6242621-6242643 CCTCCCAGGCCCGGGTCGGCCCG 0: 1
1: 1
2: 3
3: 37
4: 294
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901017999_901018024 20 Left 901017999 1:6242611-6242633 CCCCCGCCGCCCTCCCAGGCCCG 0: 1
1: 0
2: 13
3: 113
4: 992
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018017_901018024 -9 Left 901018017 1:6242640-6242662 CCCGGATCTGGCCCGCGGGCCCT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018005_901018024 14 Left 901018005 1:6242617-6242639 CCGCCCTCCCAGGCCCGGGTCGG 0: 1
1: 0
2: 6
3: 35
4: 323
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018018_901018024 -10 Left 901018018 1:6242641-6242663 CCGGATCTGGCCCGCGGGCCCTG 0: 1
1: 0
2: 3
3: 7
4: 184
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018002_901018024 18 Left 901018002 1:6242613-6242635 CCCGCCGCCCTCCCAGGCCCGGG 0: 1
1: 0
2: 8
3: 96
4: 747
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018000_901018024 19 Left 901018000 1:6242612-6242634 CCCCGCCGCCCTCCCAGGCCCGG 0: 1
1: 0
2: 6
3: 95
4: 720
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018007_901018024 11 Left 901018007 1:6242620-6242642 CCCTCCCAGGCCCGGGTCGGCCC 0: 1
1: 0
2: 0
3: 35
4: 309
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297
901018014_901018024 0 Left 901018014 1:6242631-6242653 CCGGGTCGGCCCGGATCTGGCCC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG 0: 1
1: 0
2: 3
3: 45
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901018024 Original CRISPR GCGGGCCCTGCGGTCCGGGC TGG Intergenic
900109283 1:998811-998833 GCGGGCCCGGGGGGGCGGGCTGG - Intergenic
900126710 1:1072009-1072031 GCGGGCCAGGCGGCCCCGGCGGG + Exonic
900180192 1:1307875-1307897 GCGGGACGAGCGGTCCGGGCCGG - Exonic
901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG + Intergenic
901540194 1:9910398-9910420 GCGGGGCCTGCGGGCGGGGCGGG + Intergenic
901836359 1:11926324-11926346 GTGGGCGCCGCGGTCCGGGCCGG - Exonic
902243425 1:15103360-15103382 GCGGGCCCGGCGCTCCTGGAGGG - Exonic
902870733 1:19312262-19312284 GCGGGGCCTGCGGTTCCCGCGGG + Intergenic
903251063 1:22053195-22053217 CCGTGCCCTGCGCTCCGGCCTGG + Intronic
903668280 1:25021204-25021226 GAGGTCCCTGCGGCCCAGGCTGG - Intergenic
905183190 1:36178854-36178876 GCGGGCGCCGCGGGCCGGGAGGG + Intronic
905390808 1:37634478-37634500 GCGGGCCCTCCCGTCGGGGCTGG - Intronic
905639128 1:39576521-39576543 GAGGGCACGGCGGGCCGGGCGGG + Intronic
905685012 1:39901756-39901778 GCGGGTCCCGCGGTGCGGGCTGG - Intronic
915310217 1:155002692-155002714 GCGGGCCCTGAGGGGGGGGCGGG + Exonic
921472696 1:215567626-215567648 CCGGGCTCGGCGGTCCCGGCTGG + Exonic
922723467 1:227910688-227910710 GCTGGCCCTGCAGCCAGGGCAGG - Intergenic
923490291 1:234478461-234478483 GCGGGCCGTGTGGGGCGGGCTGG - Exonic
923609862 1:235480874-235480896 TCTGGCTCTGCGGTCCAGGCTGG - Intronic
1064014797 10:11763463-11763485 CCTGGCCCTGCGGGACGGGCAGG + Exonic
1064418287 10:15168835-15168857 GCGGGGCCGGCGGGCAGGGCGGG - Intergenic
1065186231 10:23173399-23173421 GCGCGCCCGGTCGTCCGGGCGGG - Intergenic
1066745450 10:38601947-38601969 GAGGGCCCTCCGGACCAGGCGGG + Intergenic
1067066030 10:43104859-43104881 GGGGGCTCTGCGGTCAGAGCGGG - Intronic
1067560371 10:47300763-47300785 GCGGGCAGTGCGGACCAGGCGGG - Exonic
1069709289 10:70478703-70478725 CCGGGACTCGCGGTCCGGGCGGG + Intergenic
1069962731 10:72087948-72087970 CCTGTCCCTGCGGCCCGGGCCGG - Intronic
1070162530 10:73874627-73874649 GCGGGGCCTGGGGGCGGGGCGGG - Intergenic
1074772371 10:116742394-116742416 GCGGGTCCTGCGGCCGCGGCTGG - Intronic
1076175690 10:128366222-128366244 GCAGCCCCTGCGGACCAGGCCGG + Intergenic
1077018507 11:407263-407285 GCGGGGCCTGCGGGGTGGGCGGG + Intronic
1077035824 11:494104-494126 GCGAGCACTGGGCTCCGGGCAGG + Intergenic
1077054041 11:581576-581598 GTCGGCCCTGCGGACCCGGCAGG + Exonic
1077138034 11:1011318-1011340 GGGGGCCCTGCGGGGCCGGCAGG - Exonic
1077237180 11:1487358-1487380 GGGTGCCCTGTGGTCCTGGCTGG - Intronic
1077273637 11:1693399-1693421 GCAGGTCCTGCGGCCCGGGCTGG - Intergenic
1077360791 11:2139427-2139449 GCGGGCCCTGGGCCGCGGGCTGG - Intronic
1077393894 11:2311902-2311924 GAGGGCCCTGGAGGCCGGGCCGG - Intronic
1077466018 11:2734131-2734153 GCGGGCCCTGGGGCCGGAGCAGG - Intronic
1077491377 11:2862428-2862450 GCGGGCCTGGCGGGCGGGGCGGG + Intergenic
1077554420 11:3219042-3219064 GCAGGCCCTGGGCTCCTGGCAGG + Intergenic
1077635767 11:3840734-3840756 GCGGGCGCGGCCGGCCGGGCGGG - Intronic
1078053511 11:7987557-7987579 GCGGGCGCTGGGGTCTGCGCTGG - Exonic
1078334234 11:10451087-10451109 GCGGACCCTGCGGCCCAGGCGGG + Intronic
1080647480 11:34197456-34197478 GCGGGCCTGGCGGGCAGGGCTGG + Exonic
1080802140 11:35618784-35618806 GCGGGGCCGCCGCTCCGGGCCGG - Exonic
1082035584 11:47642659-47642681 GGGGGCGCTGAGGTCGGGGCGGG + Intergenic
1084028526 11:66467302-66467324 CCGCGCCCTGCGCCCCGGGCGGG - Intronic
1084129171 11:67119729-67119751 GCGCTCCCTGCGGCCGGGGCCGG + Exonic
1084961821 11:72720911-72720933 GCCAGCCCTGCTGTCTGGGCAGG + Intronic
1085706336 11:78789519-78789541 GCTGGGCCTGGGGTCAGGGCTGG + Intronic
1086719405 11:90101496-90101518 GGGGAGCCTGTGGTCCGGGCAGG - Intergenic
1089533861 11:119149225-119149247 CCGGTCCCGGCGGCCCGGGCCGG - Exonic
1089533944 11:119149466-119149488 GCGGGCCCGGGGGTGCCGGCGGG + Intronic
1090365698 11:126203543-126203565 GCCTGCCCTGGGGTCCGGGAAGG - Exonic
1090788750 11:130070952-130070974 GCGGGGTCCGCGGTGCGGGCCGG + Intronic
1091175585 11:133554718-133554740 CCGGGCCCTGCAGTGCTGGCAGG - Intergenic
1091936936 12:4441990-4442012 GCTGGCCCTGAGGTCCAGGGAGG + Intronic
1095261773 12:40106062-40106084 GCTGGCGCTGCGGAGCGGGCGGG + Intronic
1100679776 12:96907055-96907077 GCGGGAACTGCGGGCCGGGGCGG - Intergenic
1101144853 12:101831042-101831064 GCGGGCCCTGAGGGCTGGGCTGG + Intergenic
1101865281 12:108515645-108515667 GCGGGTCCAGGGGTCTGGGCGGG - Intronic
1101876185 12:108598137-108598159 GCTGGCCCTGCGGCCCAGCCGGG - Intronic
1103363899 12:120369003-120369025 GCGGGCCAAGCAGGCCGGGCCGG + Intronic
1104376267 12:128267349-128267371 GCGGGCGCTGCGCTTCGGGCTGG + Intergenic
1104633511 12:130424282-130424304 GCGGCCTCTCCGGGCCGGGCTGG + Intronic
1104857115 12:131907561-131907583 GCGGGCCCTGTGGGACCGGCTGG - Intronic
1104882743 12:132083988-132084010 GCGGGCCCTACAGTCTAGGCGGG - Intergenic
1104891895 12:132144201-132144223 GCGGGCCCTGCCGTGCGCCCCGG + Exonic
1105486055 13:20833896-20833918 GTGGGCGCTGGGGTCCGGGGCGG - Intronic
1106157385 13:27171447-27171469 GCGGCCCGGGCGGCCCGGGCGGG - Intronic
1106241924 13:27919962-27919984 GCCGGCCCGCCGGTCCGCGCTGG + Intergenic
1106308377 13:28532759-28532781 GAGCGCCCTGAGGTCAGGGCCGG + Intergenic
1107605210 13:42049158-42049180 GCGGGGCCTGGGGCGCGGGCGGG + Intronic
1109007732 13:56900778-56900800 GCGGGCCCCGCACTCCGGGCGGG + Intergenic
1110318250 13:74134488-74134510 CCCAGCCCGGCGGTCCGGGCGGG - Intergenic
1112091753 13:96090662-96090684 CCGGGGCCTGCGAGCCGGGCGGG - Intergenic
1113082775 13:106535348-106535370 GCGGGCGCTGCGCCCCGAGCGGG + Intergenic
1113656646 13:112072241-112072263 GGGGGCGCTGGAGTCCGGGCTGG - Intergenic
1113789230 13:113018783-113018805 GTGGCCTCTGCGTTCCGGGCAGG - Intronic
1113927865 13:113951335-113951357 GTCGTCCCTGCGGGCCGGGCTGG + Intergenic
1113936906 13:113999696-113999718 GCGGGCCCCGCTGTCCCGGCTGG + Intronic
1114485155 14:23057637-23057659 GCGGGCCCGGCTGGCCGGGGAGG - Intergenic
1114671796 14:24415467-24415489 GCGGACCCTGAGGTGCGGGAGGG + Exonic
1115576290 14:34714821-34714843 GCGAGCCCTGCAGGCCGGGGGGG + Intronic
1117131978 14:52695762-52695784 GCGGGCGCAGCGGACCGGGCGGG - Intronic
1117315158 14:54566193-54566215 GCGGGCCATGCCGTCGGGGCGGG - Intergenic
1122688772 14:103521986-103522008 GCGGGCCGGGCGGGCGGGGCCGG - Intronic
1122834622 14:104424695-104424717 TGGGACCCTGCGGTCCGGGGCGG - Intergenic
1123630741 15:22258202-22258224 GCGGGCGCCGCGGGCCGGGCGGG - Intergenic
1123697868 15:22892027-22892049 CCGGGCTCTGCGGTGGGGGCAGG - Intronic
1124500864 15:30225470-30225492 GGAGTCCCTGCGATCCGGGCTGG - Intergenic
1124742706 15:32313197-32313219 GGAGTCCCTGCGATCCGGGCTGG + Intergenic
1126767116 15:52019785-52019807 GCCCGCCCTCCGGTCCGGTCCGG - Intronic
1128498418 15:68210994-68211016 GCGGGCACTGAGGGCTGGGCGGG + Intronic
1130540372 15:84817423-84817445 GCGGGGCCGGCGGTCGGGGAGGG + Exonic
1130980313 15:88807799-88807821 GCGGGCCCTGCGGGCTGGCCAGG + Intronic
1132348445 15:101122423-101122445 AGGGGTCCAGCGGTCCGGGCAGG - Intergenic
1132598983 16:765566-765588 GCGGGGCCTGCTGCCCGTGCTGG + Exonic
1132699906 16:1217880-1217902 GCGGGCTCGGCTGACCGGGCGGG + Intronic
1132748997 16:1448760-1448782 ACAGGCCCTGCGGGCGGGGCGGG + Exonic
1132891493 16:2207019-2207041 CCGGGACCTGCGGGCCGGGCCGG - Exonic
1134531995 16:14990247-14990269 GTGGGCGCCGCGGTCTGGGCCGG - Intronic
1136153055 16:28364803-28364825 CCGGGCCCTGCGGCCCTGGGAGG + Intergenic
1136210028 16:28750470-28750492 CCGGGCCCTGCGGCCCTGGGAGG - Intergenic
1136549725 16:30976528-30976550 ACGGGCCCTGGGGTCTGGGCAGG + Intronic
1136737623 16:32477702-32477724 GAGGGCCCTCCGGACCAGGCGGG - Intergenic
1137640567 16:50025235-50025257 GTTGGCGCTGCGGGCCGGGCGGG + Exonic
1139207824 16:65046280-65046302 CCGGGCCCTGTGGTCCAGGGTGG - Intronic
1139633694 16:68245508-68245530 GCGGACCCAGCGCTCCCGGCCGG + Exonic
1141132257 16:81444644-81444666 GCGGAGTCCGCGGTCCGGGCGGG - Intergenic
1141972304 16:87492371-87492393 GCGGGCGCCGCGGGCCGGGCGGG + Intergenic
1142011055 16:87714370-87714392 GCAGGCCCTCCGCTCCGGGCAGG + Intronic
1142173496 16:88634671-88634693 GCGGGACCTGCGGACTGGGCGGG - Intergenic
1142279770 16:89141729-89141751 GCCGGCCCTGTGGTGCTGGCTGG + Intronic
1142358623 16:89615792-89615814 GGGGGCCCCGGGGTCCTGGCCGG + Intronic
1142412366 16:89923219-89923241 GCGGAGCCTGCGGGCCGGGCGGG + Intronic
1203015448 16_KI270728v1_random:351875-351897 GAGGGCCCTCCGGACCAGGCGGG + Intergenic
1203033783 16_KI270728v1_random:625033-625055 GAGGGCCCTCCGGACCAGGCGGG + Intergenic
1142611055 17:1109370-1109392 GCGGGCCCTGCGGGGCCGGGCGG - Intronic
1142727962 17:1830144-1830166 GCTGGGCCGGCGGTCCGGGGTGG + Intronic
1142858918 17:2749437-2749459 GCGGGGCCCTGGGTCCGGGCCGG + Intergenic
1143449009 17:7024553-7024575 GCAGGCCTTGGGGTCAGGGCTGG - Exonic
1143830367 17:9645869-9645891 GCTGGGGCTGGGGTCCGGGCGGG - Exonic
1144784379 17:17823693-17823715 GCGGGACCTGCAGGCGGGGCGGG - Intronic
1146057701 17:29589451-29589473 GCGGCCCCTGCTGCCCGGCCCGG + Exonic
1146276925 17:31522131-31522153 GCGACCCCTGCTGTCTGGGCAGG + Intronic
1147994738 17:44354461-44354483 GCGGGCGCTGGGGGTCGGGCTGG + Exonic
1148082716 17:44976486-44976508 GCGGGCCATGCTGGCCAGGCGGG - Intergenic
1148157148 17:45431013-45431035 GGGGGCGGTGCGGGCCGGGCTGG - Intronic
1148818272 17:50346115-50346137 GCGCGCCCCGCGTCCCGGGCAGG + Exonic
1149626596 17:58084157-58084179 CCGGGGCCTGCGGACCTGGCCGG + Intronic
1150643553 17:66964862-66964884 GCGGGCGCGGCGGGCCGGGCCGG + Intergenic
1150778750 17:68101965-68101987 GGGGGCGCGGCGGGCCGGGCTGG + Intergenic
1151370600 17:73644402-73644424 GCGGCCTCTGCGATCCGGCCGGG + Intergenic
1151491003 17:74432366-74432388 GCAGGCCCTGCGTCCCGGCCCGG + Intronic
1151555309 17:74843476-74843498 GCTGGCCGTGAGGTCCGGGCTGG + Exonic
1151890413 17:76947964-76947986 GCACGCCCTGCGGGCCTGGCTGG + Exonic
1152069802 17:78128835-78128857 GGGGGCGCCGCGGGCCGGGCCGG - Intronic
1152349792 17:79778170-79778192 GGGCGCGCGGCGGTCCGGGCGGG + Exonic
1152353974 17:79797881-79797903 CCGGGCCCTGCGAGCCGGGCTGG + Intronic
1152414055 17:80147489-80147511 GAGGGGCCTCCGCTCCGGGCGGG + Intergenic
1152460517 17:80439798-80439820 ACGGGCCCTGTGGACAGGGCTGG + Intergenic
1152527072 17:80894355-80894377 GAGGGCCCTGCGGTCGGGCTGGG + Intronic
1152627876 17:81396552-81396574 GTGGGGCCTGCAGGCCGGGCTGG - Intronic
1152697519 17:81804364-81804386 GCGGTCTCCGGGGTCCGGGCTGG + Intronic
1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG + Intergenic
1152782144 17:82231270-82231292 GCCGTCCCTCCGGCCCGGGCGGG + Intronic
1152927618 17:83094622-83094644 GTGGGCGCTGCGGTCCTGGTGGG + Exonic
1154214754 18:12407936-12407958 GCGGGCTCTGCGATCCGGGCCGG - Exonic
1156331584 18:36129000-36129022 CCGGATCCTGCGGACCGGGCAGG - Intronic
1156449551 18:37259258-37259280 TCGGGCCCTGCGGTGAGGGGAGG + Exonic
1157639927 18:49203024-49203046 GCCGGCCGTGCCGTCCGGGAGGG + Intronic
1159040679 18:63320397-63320419 GCGGGCGCAGCGGAGCGGGCGGG - Intergenic
1160594657 18:79965010-79965032 GGGGACCCTGCGGTCCTGGGGGG + Intronic
1160680271 19:408969-408991 GCGGTCCCCGCAGACCGGGCGGG + Intronic
1160725522 19:616380-616402 CGAGTCCCTGCGGTCCGGGCTGG - Exonic
1160862304 19:1242545-1242567 GCAGGTCCTGCGGCCGGGGCTGG + Exonic
1160863841 19:1248830-1248852 GCGGGGGCTGAGGTCCGGCCAGG - Intronic
1160930656 19:1568172-1568194 GCGGGCACGGGGGGCCGGGCGGG + Intergenic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161194438 19:2978248-2978270 GGGGGCCCTTGGGTCTGGGCTGG - Exonic
1161264863 19:3359512-3359534 GAGGGTCCTGCGGGCCGGGGGGG + Intergenic
1161428565 19:4217647-4217669 GCGGGGCCTGCGGGCCGAGCTGG + Exonic
1161443313 19:4304705-4304727 GCGGGGCCCGCGGGCCGGGCCGG + Exonic
1161570062 19:5025603-5025625 GTGGGCCCTGGGGGCTGGGCTGG - Intronic
1161580433 19:5077777-5077799 GCAGGCCCTGCTGACCTGGCAGG + Intronic
1161959556 19:7516212-7516234 GCGGGCGCGGCGGGCCGGGCAGG + Exonic
1161973505 19:7596434-7596456 GCGGGGTCTGCGGGCCGGGTGGG + Intronic
1161984926 19:7647801-7647823 GCGGGGCCAGGGGTCAGGGCAGG - Exonic
1162024997 19:7888705-7888727 GCCGGCCCTGTGGCCGGGGCAGG + Intronic
1162532136 19:11242107-11242129 CCGGCCCCTGGGGTCCGGGTAGG + Exonic
1163138641 19:15331950-15331972 GCGGGGCCGGCGGTCGGGGGCGG - Intronic
1163464074 19:17455953-17455975 GAGGTCCCTGCGGAGCGGGCAGG + Exonic
1163665905 19:18604061-18604083 GAGGGGCCTGGGGTCTGGGCAGG - Intronic
1163700879 19:18785931-18785953 GCGGGGCCTGCGGTGGGGGCGGG - Intronic
1164639050 19:29811768-29811790 GCGGGGCCGGCGGACAGGGCGGG - Intergenic
1164669045 19:30062727-30062749 GCGGTCCCTGCTGTCAGAGCAGG + Intergenic
1165058767 19:33194863-33194885 GTGGGCCGCGCGGGCCGGGCAGG + Intronic
1165450599 19:35879907-35879929 GCGGGTCCTGCGGGAAGGGCTGG + Intergenic
1165481624 19:36067898-36067920 GTGTGGCCTGCGGTCGGGGCCGG + Exonic
1165489334 19:36114309-36114331 GCGGGCCCTGAGCTGGGGGCGGG - Intronic
1166360299 19:42250320-42250342 CCGGGCCCTGCGGTGAGGACGGG - Exonic
1167145600 19:47679665-47679687 GCGGGCCCTGCAGCCCCAGCAGG - Exonic
1167334211 19:48874645-48874667 GTGGGCCCTCTGGTCCGGGTGGG - Exonic
1167570656 19:50286634-50286656 CCGGGCCCTGCGGGCTGAGCTGG + Exonic
1167706857 19:51086300-51086322 GCAGGTGCTGAGGTCCGGGCTGG - Intergenic
1168255148 19:55160980-55161002 GCGGGGCCTGCTGTGGGGGCGGG + Intronic
925149466 2:1605332-1605354 GCGGCCTCTGCGCGCCGGGCAGG + Intergenic
925552307 2:5089796-5089818 GGGGGCCCTGTGTTCTGGGCAGG + Intergenic
925730591 2:6917501-6917523 GCGGGCCGTGCGGGCTGCGCGGG + Exonic
926120599 2:10239421-10239443 GCTGGCCGTGCTGGCCGGGCTGG + Intergenic
926139511 2:10359898-10359920 GCGGGCGCTGTGGACCCGGCGGG - Intronic
926139517 2:10359916-10359938 GCGGGCGCTGTGGACCCGGCGGG - Intronic
926718626 2:15942707-15942729 GCGGGCCCTGCGGTCGCCTCGGG + Exonic
927211644 2:20642531-20642553 GCCTGCTCTGCGGGCCGGGCTGG - Intronic
927606430 2:24491055-24491077 GCGGGCCCGGCAGGCCCGGCGGG + Intergenic
927714120 2:25341644-25341666 GCGGGGACGGCGGGCCGGGCTGG - Intronic
929584961 2:43107762-43107784 TCAGGCCCTGAGGCCCGGGCAGG - Intergenic
930651656 2:53970511-53970533 CCCGGGCCTGCGGGCCGGGCCGG - Intronic
931036668 2:58251656-58251678 GCGGGCGCTGGGGTCTGCGCTGG - Intergenic
931711145 2:64989689-64989711 GCGGGGCCTGCGGCCGGGCCCGG + Exonic
931762658 2:65431533-65431555 GCGAGCCCTGCAGTCCGCTCCGG - Intronic
932771632 2:74503693-74503715 GTGGGCTTTGCGGTCCGGGCGGG - Intergenic
933791680 2:85888621-85888643 CCGGGCCGTGTGGACCGGGCGGG - Intronic
933985110 2:87584367-87584389 GCGCGCGCTGCGGTCGGTGCGGG - Intergenic
934307845 2:91841138-91841160 GAGGGCCCTCCGGACCAGGCGGG + Intergenic
936308731 2:111366444-111366466 GCGCGCGCTGCGGTCGGTGCGGG + Intergenic
937820783 2:126308196-126308218 GCAGGCCCTGGGATGCGGGCAGG - Intergenic
937987940 2:127647003-127647025 GCACGCCCTTCGGCCCGGGCAGG + Intronic
938277107 2:130037001-130037023 GCGGCGCTTGCGGTACGGGCTGG - Intergenic
938328079 2:130427774-130427796 GCGGCGCTTGCGGTACGGGCTGG - Intergenic
938438276 2:131300388-131300410 GCGGCGCTTGCGGTACGGGCTGG + Intronic
940243521 2:151589294-151589316 TCTGGCCCTGCGGCCCAGGCTGG - Intronic
940244477 2:151599847-151599869 TCTGGCCCTGCGGCCCAGGCTGG - Intronic
940911008 2:159210056-159210078 GAGGGCACTGCGGGCAGGGCAGG - Intronic
942083996 2:172427729-172427751 GGCCGCCCTGCGCTCCGGGCTGG - Intronic
944645924 2:201780964-201780986 GCGGGGCCTCCGGACAGGGCGGG + Exonic
945241706 2:207682110-207682132 GGGGGCCCTGCGGCCAGGCCTGG + Intergenic
946382612 2:219359003-219359025 GCGGTCGCTGCGGTGCAGGCGGG - Intergenic
946407422 2:219499004-219499026 GCGGGCTCCGAGGTCCTGGCTGG + Exonic
947399122 2:229714587-229714609 GCGGGGCCTGCGGGGCGGGGCGG + Intergenic
948150429 2:235740168-235740190 GCTGGCCTAGCGGGCCGGGCTGG + Intronic
948839511 2:240642150-240642172 GCGGGCCCTGCTGTGAGGGAGGG + Intergenic
948983875 2:241508470-241508492 GCGGGCGCTGCAGAGCGGGCCGG - Exonic
1169386904 20:5157476-5157498 GCGGGACCTGGGGCCTGGGCAGG + Intronic
1170998659 20:21391696-21391718 GCGGGGTCTGCGGGCTGGGCCGG - Intergenic
1171947801 20:31393719-31393741 GGGGGACCTGCGATCAGGGCTGG + Intergenic
1172083240 20:32358723-32358745 GCGGGACCTCCGGGCTGGGCGGG - Exonic
1172252536 20:33490034-33490056 GCGTGCCCGGCGGGCGGGGCGGG + Intergenic
1172404358 20:34676795-34676817 GCGGGGCCTGAGGGCGGGGCTGG - Intronic
1172528636 20:35616296-35616318 GCGGGGCCTCGGGTGCGGGCGGG + Exonic
1173548097 20:43914679-43914701 GGGGGCCCGGGGGCCCGGGCCGG - Intergenic
1174357835 20:50010134-50010156 GGGGGCTGTGCGGCCCGGGCCGG + Intergenic
1176030286 20:63008297-63008319 GGGGCCCCTGCGCTCCTGGCGGG - Intergenic
1176061691 20:63175453-63175475 GCGGACTCTGCGGGGCGGGCGGG + Intergenic
1179438124 21:41375878-41375900 GCTGGGCCTGTGCTCCGGGCAGG - Intronic
1179728553 21:43354384-43354406 GCGGCCCCTCCGGTCAGGGCAGG + Intergenic
1179728585 21:43354468-43354490 GCGGCCCCTAGGGTCAGGGCAGG + Intergenic
1179784222 21:43720366-43720388 GCGGGGCCTGCGGTGCGGGCTGG + Intronic
1180037550 21:45257545-45257567 GCGGGCTCTGCGGTCTGTGGCGG - Intergenic
1180699618 22:17774288-17774310 GCGGGCCCTGAGCTCCACGCCGG + Intronic
1181175504 22:21032585-21032607 GCGGGCCCTGCGCTCGGCGCCGG - Intronic
1183076552 22:35431040-35431062 GCTGGCCCTGCAGGCCAGGCCGG - Intergenic
1184668016 22:45998638-45998660 GTGGGCTCTGCGGGCCGGGCAGG - Intergenic
1184724497 22:46335682-46335704 GCGGACCCTACGGCCGGGGCGGG + Exonic
1184820656 22:46907350-46907372 GGGGGCCCTGAGGTCCTGACTGG + Intronic
1185397645 22:50600948-50600970 GCGGGGACGGGGGTCCGGGCCGG - Intronic
950417435 3:12876406-12876428 GCGGGCCGTGCTGTCCAGGCTGG + Intergenic
950509919 3:13420015-13420037 GCGGGCGCCGTGGGCCGGGCTGG - Intronic
950569914 3:13793434-13793456 GCGAGCCTTGCGGGCCTGGCTGG - Intergenic
954295924 3:49674438-49674460 GTGGTCCCTGCAGCCCGGGCCGG + Intronic
968065438 3:195756352-195756374 GAGGGCCCTGCGGTGTGGGGTGG - Intronic
968510484 4:993356-993378 GAGGGCCCTGCGGTCCTCGGTGG - Exonic
968512274 4:1001000-1001022 GCAGGCCCTGGGGCCCTGGCCGG + Intronic
968583552 4:1405793-1405815 GCAGGCCCTGCAGTCCGGGTCGG + Intronic
968636568 4:1684089-1684111 CGGGGCCCTGCGCTCCGAGCTGG - Intronic
968660024 4:1795001-1795023 GCGGGCGCGGCGGGCCGGGGAGG + Intronic
968965113 4:3765819-3765841 GCGGGCCCTGGGGAGCTGGCCGG - Intergenic
969379424 4:6783701-6783723 GCGGGCCTGGCGGGCGGGGCCGG + Intronic
972484244 4:39527243-39527265 GCTGGCCCCGCCGCCCGGGCGGG - Intronic
974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG + Intronic
975779013 4:77819760-77819782 GCGGGGCGGGCGGGCCGGGCCGG + Intergenic
979674521 4:123397675-123397697 CCGGGCACTCCGGTCCCGGCAGG - Exonic
983940257 4:173529465-173529487 GCGGGCCCGGCTGGCCAGGCGGG - Exonic
984928389 4:184826108-184826130 GCGGGGCCTGCGGGCGGGGCGGG - Intronic
984966366 4:185143513-185143535 GCGGGCGCGGCGGGCCGGGCGGG + Intronic
985780043 5:1865723-1865745 GCTGTCCCTGAGGGCCGGGCTGG - Intergenic
985791756 5:1931805-1931827 CCGGGCCCTGCGGAGTGGGCGGG - Intergenic
988547659 5:32173785-32173807 GCGGGCGCGGCGGGCTGGGCGGG - Intronic
988595393 5:32585866-32585888 GCGGGCGCTGCGGCCCGGGGCGG + Intronic
989480546 5:41925535-41925557 GAGGTCCCTCCGGCCCGGGCCGG - Intronic
992067401 5:73120504-73120526 GCGGGCGCGGCGGCCCGGGGAGG - Exonic
992106297 5:73451488-73451510 GCGGGCCCTCGCGCCCGGGCCGG + Intergenic
992530214 5:77645654-77645676 GCGCCCCCTGGGGGCCGGGCGGG - Intergenic
995379048 5:111512219-111512241 GCGGGCCCCGGCGTCCGGGCGGG - Intronic
996670734 5:126114029-126114051 GAGGGACCTGGGGTCGGGGCAGG + Intergenic
997582799 5:135028050-135028072 GCGGGCAGTGCGGGCCTGGCGGG - Exonic
997654430 5:135544767-135544789 GCACGCCCCGCGGCCCGGGCTGG + Intergenic
998383353 5:141741615-141741637 GCAGGCCCTGCGGGCCCTGCAGG - Intergenic
1000351296 5:160354879-160354901 GTGGGCCCTGGGGGCCAGGCAGG + Exonic
1001506455 5:172283953-172283975 GCGGGCGCTGCGGCCCGCCCGGG - Exonic
1002064982 5:176647450-176647472 GCGGTCCCTGAGGGGCGGGCGGG + Exonic
1002140218 5:177133495-177133517 GCCGGCCCGGCTGCCCGGGCGGG - Intronic
1002184267 5:177446970-177446992 GCGGCGGCTGCGGGCCGGGCGGG + Intronic
1002570313 5:180136292-180136314 GAGGGCCCTGGGGTGCGGGCCGG + Intronic
1004233061 6:13850244-13850266 GAGGGCCCTGCTGTCCTGGGAGG + Intergenic
1005886369 6:30100902-30100924 GCGGGCCCAGGTGTCGGGGCGGG - Intergenic
1006366903 6:33621355-33621377 GCGGGCCGGGCGGGGCGGGCGGG + Exonic
1006472301 6:34235882-34235904 GCGCGCCCTGCAGGCCGGCCCGG - Intergenic
1006794297 6:36722043-36722065 GCGGGCCCAGCGGTGCAGGAGGG + Exonic
1010568593 6:77449900-77449922 GCCGGCTCTGGGGTCCGGGCCGG - Intergenic
1010926637 6:81752794-81752816 GCGTGCCCTGCGGGCGGGGGAGG - Intergenic
1018727976 6:166627905-166627927 GCGGGCCCTGCAGCTCGGCCAGG + Intronic
1019421815 7:954302-954324 GTGGGCCCCGGGGACCGGGCGGG - Intronic
1019518742 7:1451156-1451178 AAGGGCCCTGCTGTCCAGGCTGG - Intronic
1020235093 7:6348991-6349013 GCGGGGCCTGTGGGCCGCGCAGG - Intergenic
1021653598 7:22854144-22854166 CCGGGCCCCGCGGGCGGGGCGGG + Intergenic
1026898066 7:74021981-74022003 GCGGGTCCTGCAGGGCGGGCAGG - Intergenic
1028641177 7:93043637-93043659 GCGGGGGCTGCGGAGCGGGCGGG + Intergenic
1031088082 7:117323189-117323211 GTGGGCGAGGCGGTCCGGGCTGG - Exonic
1032092176 7:128916388-128916410 GTGGTCCCTCCGGTCGGGGCCGG - Intergenic
1034228049 7:149497882-149497904 TCGGGCCCCGCGGGCGGGGCTGG - Intergenic
1034268309 7:149791590-149791612 GTGGGCCCTGGGGCCAGGGCCGG + Intergenic
1034426810 7:151018333-151018355 GCGGTCCCTGCCGCCGGGGCCGG + Exonic
1034618079 7:152436041-152436063 GCGGGCGGTGCGGGGCGGGCGGG + Intergenic
1034878819 7:154748569-154748591 GCGAGCCCTGCGGGGCGGGGAGG + Intronic
1035045801 7:155964586-155964608 GCGAGCCCTGTGCTGCGGGCTGG + Exonic
1035252116 7:157604260-157604282 GTGGGCCCTGGAGCCCGGGCAGG - Intronic
1035534038 8:377699-377721 GCGGGCCCCGAGGTCTGTGCGGG - Intergenic
1035553078 8:544855-544877 GCGGGCCCAGTGGGCCGGGCGGG + Intronic
1035555477 8:564329-564351 GCAGGCCCTGCAGGCTGGGCGGG + Intergenic
1035747511 8:1973233-1973255 TCGGGCCCTGCGGTGCAGACGGG - Intergenic
1037876532 8:22551564-22551586 GCCAGCCCTGCGGTAGGGGCCGG + Intronic
1042837725 8:73092972-73092994 CCGGGCGCTGCTGTCCCGGCCGG - Exonic
1042859036 8:73294998-73295020 CCGGGCGCTGCGGGACGGGCGGG + Exonic
1044734797 8:95268741-95268763 GCGGGCTCTGCGGGCGGGGCGGG + Intronic
1049496782 8:142939293-142939315 GCGGGGTCTGCAGTCGGGGCAGG + Intergenic
1049604065 8:143521015-143521037 GAGAGCCCTGTGGGCCGGGCGGG - Intronic
1049657799 8:143806435-143806457 GAAGGCCCTGCGGCCCGGGCTGG - Exonic
1049746820 8:144266527-144266549 GCGGGCCTCGCGGGCCGGCCGGG - Intronic
1049798380 8:144506668-144506690 GCGGGGCCTGCGGGGTGGGCAGG + Intronic
1052893195 9:33722183-33722205 GTGGGCCCTGCAGCCCGTGCTGG + Intergenic
1053166024 9:35844429-35844451 GCGGTCCCTGCTCTCAGGGCTGG - Intronic
1057075425 9:92135896-92135918 GAGGGCCCTGCAGGCTGGGCTGG + Intergenic
1057361223 9:94374996-94375018 GCGAGCCCGCCGCTCCGGGCAGG + Intronic
1057662140 9:97013168-97013190 GCGAGCCCGCCGCTCCGGGCAGG - Intronic
1057772715 9:97982967-97982989 GCTGGGCTTGCGGCCCGGGCTGG - Intergenic
1059145697 9:111897177-111897199 GCGGCCGCAGCGGGCCGGGCCGG + Exonic
1060814360 9:126626919-126626941 GCGGACGCTGCGGGCCCGGCCGG - Intronic
1061089923 9:128420795-128420817 GCGGGGCCTGGGGCCCGGGCGGG - Exonic
1061843933 9:133376271-133376293 GCAGGCCCTGCGGTCCCTCCCGG + Intergenic
1062430620 9:136525472-136525494 GCGGCCCCAGCGGCCCGGGAAGG + Intronic
1062472490 9:136712586-136712608 GCGGCCGCTGCGGGCCGGGCCGG + Exonic
1185877684 X:3713526-3713548 GCGGGGGCCGCGGCCCGGGCTGG + Exonic
1187887762 X:23905358-23905380 TCTGGCCCTGTTGTCCGGGCTGG - Intronic
1189054591 X:37685796-37685818 GCGGGCCCGGCCGACCGGCCTGG - Exonic
1190862626 X:54358638-54358660 GCGCGCACTGCGGTCCTGGGGGG - Intronic
1192186745 X:68952237-68952259 GCGGGCCCTGCACTGTGGGCTGG + Intergenic
1192259800 X:69498504-69498526 GCGGGCCTTGCAGTCAGGGGTGG + Intergenic
1197776110 X:130119656-130119678 CCGGGCTCTGAGGTCTGGGCGGG + Intergenic
1198480219 X:137033916-137033938 GCGGGCGCTGCGGGCGCGGCAGG + Intergenic
1200084790 X:153598885-153598907 GCGGGCCCGGCTGGCCAGGCCGG - Intronic
1200107747 X:153724307-153724329 GCGGGCTCCGCGCGCCGGGCTGG - Intronic
1200107809 X:153724501-153724523 GCCGGCCCTCCGCTCCGGGGCGG - Intronic
1200244548 X:154516084-154516106 GCTGGCGATGCGGGCCGGGCCGG + Exonic