ID: 901019483

View in Genome Browser
Species Human (GRCh38)
Location 1:6248641-6248663
Sequence ACCTCCACAAAGGCCGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901019480_901019483 -6 Left 901019480 1:6248624-6248646 CCACATGCTGAAAACGGACCTCC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
901019476_901019483 13 Left 901019476 1:6248605-6248627 CCTAGGGAGCCACACCAGGCCAC 0: 1
1: 0
2: 3
3: 26
4: 226
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
901019479_901019483 -1 Left 901019479 1:6248619-6248641 CCAGGCCACATGCTGAAAACGGA 0: 1
1: 0
2: 0
3: 10
4: 227
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
901019474_901019483 20 Left 901019474 1:6248598-6248620 CCTCAGGCCTAGGGAGCCACACC 0: 1
1: 0
2: 1
3: 28
4: 297
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
901019477_901019483 4 Left 901019477 1:6248614-6248636 CCACACCAGGCCACATGCTGAAA 0: 1
1: 0
2: 7
3: 47
4: 609
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901019483 Original CRISPR ACCTCCACAAAGGCCGCAGA GGG Exonic