ID: 901019483

View in Genome Browser
Species Human (GRCh38)
Location 1:6248641-6248663
Sequence ACCTCCACAAAGGCCGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901019474_901019483 20 Left 901019474 1:6248598-6248620 CCTCAGGCCTAGGGAGCCACACC 0: 1
1: 0
2: 1
3: 28
4: 297
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
901019479_901019483 -1 Left 901019479 1:6248619-6248641 CCAGGCCACATGCTGAAAACGGA 0: 1
1: 0
2: 0
3: 10
4: 227
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
901019477_901019483 4 Left 901019477 1:6248614-6248636 CCACACCAGGCCACATGCTGAAA 0: 1
1: 0
2: 7
3: 47
4: 609
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
901019480_901019483 -6 Left 901019480 1:6248624-6248646 CCACATGCTGAAAACGGACCTCC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
901019476_901019483 13 Left 901019476 1:6248605-6248627 CCTAGGGAGCCACACCAGGCCAC 0: 1
1: 0
2: 3
3: 26
4: 226
Right 901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901019483 Original CRISPR ACCTCCACAAAGGCCGCAGA GGG Exonic
900669486 1:3841913-3841935 CTCTCCACAAAGACCGCAGCTGG - Intronic
901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG + Exonic
901095111 1:6672368-6672390 AGCTTCACAAAGGCTGCAGCAGG + Intronic
903347945 1:22699719-22699741 ACCTCCACCAAGGCTACAGCTGG - Intergenic
903808956 1:26023956-26023978 ACCTCATCAAATGCCTCAGAAGG + Intronic
905103188 1:35543787-35543809 ACCTCTACAGAGACTGCAGATGG - Intronic
906478463 1:46185366-46185388 TCCTCCAGAGAGGCCTCAGATGG - Intronic
922866839 1:228867845-228867867 ATCTTCACAAAGGCCTGAGAAGG + Intergenic
1065138817 10:22700668-22700690 ACCTGCACAAAGGCTCCAGGTGG - Intronic
1071508727 10:86248143-86248165 ACTTCCACAAAGTAGGCAGACGG + Intronic
1075469681 10:122678614-122678636 ACCTCCACCAGGGCAGCAGGTGG - Intergenic
1075731820 10:124640885-124640907 AGCCCGGCAAAGGCCGCAGAGGG + Intronic
1076531571 10:131148742-131148764 ACCTCCCCATAGGCTCCAGAAGG + Intronic
1076617415 10:131765092-131765114 ATGTCCACAAAGGCCTGAGAAGG - Intergenic
1081904294 11:46657454-46657476 GCCCCCACAAAGTCCTCAGAGGG - Intronic
1083675116 11:64320883-64320905 ACCTTCCCAAAGGCCCCAGTGGG - Exonic
1085243187 11:75075355-75075377 ACCTCCTCCAAGGCCTCACATGG - Intergenic
1086176606 11:83899358-83899380 ACCTCCAGAAATGCAGGAGAGGG - Intronic
1092059646 12:5537961-5537983 ACCTCCACACAGGCTGTGGAGGG + Intronic
1092786780 12:12033554-12033576 ACATCCACAAGAGCCCCAGAAGG - Intergenic
1104781158 12:131421467-131421489 CTCTCCACCAAGGACGCAGATGG - Intergenic
1104917756 12:132274586-132274608 AGCTCCATAAAGGCCACACATGG - Intronic
1118839428 14:69499946-69499968 ACCCTCACAAAGGCCTCAGCTGG - Intronic
1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG + Intergenic
1122803669 14:104245753-104245775 ACCTTCACAAAGGCTGAAGTGGG + Intergenic
1123782222 15:23639838-23639860 ACCTCCACATTGGCTGCACAGGG - Intergenic
1126252989 15:46590237-46590259 ACCTCCACCTAGGTCCCAGATGG - Intergenic
1126779747 15:52129291-52129313 AGTTCCACAAAAGCCGCAGGAGG + Intronic
1128530358 15:68440982-68441004 ACCTTCAGAAAGGCAGCTGAGGG + Intergenic
1129227581 15:74179026-74179048 ACCTCCACCAAGCCCCCAGTAGG + Intergenic
1131512471 15:93056888-93056910 TCCCCCACAAAGGCCACAGTGGG + Intronic
1132518751 16:377883-377905 CCCTCCTCCAGGGCCGCAGATGG + Intronic
1132611193 16:817099-817121 GCCTCCAGAAAGGCCGCTGCGGG - Intergenic
1134150576 16:11801542-11801564 ACCTCAACAAGGGCTGGAGATGG - Intergenic
1134680306 16:16120395-16120417 AGCTCCACAAAGCTTGCAGAAGG + Intronic
1135089517 16:19501946-19501968 GCCTGGACAAAGGCCACAGATGG + Exonic
1141448751 16:84082174-84082196 ACAACCACATAGGCTGCAGAAGG + Intronic
1142001531 16:87667065-87667087 CCCTCCCCAGAGGCTGCAGAGGG - Intronic
1142398814 16:89848475-89848497 TCCTGCAGAAACGCCGCAGAAGG - Intronic
1142398837 16:89848607-89848629 TCCTGCAGAAACGCCGCAGAAGG - Intronic
1142398845 16:89848651-89848673 TCCTGCAGAAACGCCGCAGAAGG - Intronic
1142398875 16:89848827-89848849 ACCTGCAAAAAAGCCGCAGAAGG - Intronic
1142398883 16:89848871-89848893 TCCTGCAGAAACGCCGCAGAAGG - Intronic
1143009578 17:3858585-3858607 ACCTCCACAAAAACCCCAAAAGG + Intergenic
1143376750 17:6471633-6471655 ACCTCCAATAAAGCTGCAGAGGG + Intronic
1143579260 17:7815839-7815861 ACCTCCACAGAGTCCACAGGTGG + Intronic
1147871561 17:43591306-43591328 ACCTCGGCAAAAGCAGCAGAAGG - Intergenic
1150366181 17:64587310-64587332 ACCACCACAAAGAACGAAGAAGG + Intronic
1150682580 17:67295124-67295146 TCCTGCACCAAGGCCGCAGGTGG - Intergenic
1151820369 17:76493691-76493713 ACCTCCCCAGAGGCCGGAGCTGG + Intronic
1152740612 17:82016841-82016863 ACCAGCACATCGGCCGCAGATGG - Exonic
1154958270 18:21281215-21281237 ACCTCCCCAAAGGCAGCACCAGG - Intronic
1155770470 18:29691872-29691894 ACCTCCACAAAGGAGGCAAGGGG + Intergenic
1157117735 18:44877940-44877962 ACCTGCACACAGCCCTCAGATGG - Intronic
1161296877 19:3524596-3524618 TCCACCAGAGAGGCCGCAGACGG + Intronic
934163356 2:89272753-89272775 ACCTCCAATATGGCTGCAGATGG - Intergenic
934203918 2:89909771-89909793 ACCTCCAATATGGCTGCAGATGG + Intergenic
937144313 2:119629364-119629386 ACCTCAACAAAGGCCTCAGCTGG + Intronic
941840561 2:170078361-170078383 AACTCCACACAGGCCGCAACAGG + Intronic
942063521 2:172249179-172249201 CCCTCCTCAAATGCCACAGATGG + Intergenic
946016494 2:216608135-216608157 GACTCCACAAGGGCAGCAGAAGG + Intergenic
949074158 2:242044634-242044656 ACCTCCACACAGACCCCACAGGG + Intergenic
1173221718 20:41137353-41137375 ACCCCCAGACAGGCCGCAGGCGG - Intronic
1173227007 20:41168006-41168028 TTCTCCACAAAGACCACAGATGG - Intronic
1178693282 21:34767996-34768018 ACCTCTACAAAGGATGCAGCAGG - Intergenic
1179152747 21:38822536-38822558 ACCTACACAAGGTCCGCAGGAGG - Intronic
1183502362 22:38188602-38188624 ACCTCTCCCAAGGCAGCAGAAGG - Intronic
950375627 3:12569968-12569990 ACCTCAACAAGTGCAGCAGAAGG + Intronic
951465706 3:22998467-22998489 ACCACCGTAGAGGCCGCAGAAGG - Intergenic
953465726 3:43117619-43117641 ACCTGCACAAAGTCTGGAGATGG + Intergenic
957419883 3:79953883-79953905 AGCTCCCCAAAGGCCCCAAAGGG - Intergenic
958241395 3:91079758-91079780 ACTTCCACATAGGCCTGAGACGG - Intergenic
960937579 3:122913049-122913071 ACCTCCACCAGGGCTGCGGAGGG + Exonic
961696648 3:128709755-128709777 ACCTCCAATGAGGCAGCAGATGG - Intergenic
963200162 3:142578516-142578538 ATCTCCACAAGGGCCGCAGCGGG + Intronic
967120294 3:186376717-186376739 TCCTCCACATAGGCCACAGATGG - Intergenic
969449065 4:7262744-7262766 ACCTCCACACAGCCCTCAGCAGG + Intronic
976111745 4:81682737-81682759 TCCTGCATAAAGGCCGCTGAAGG + Intronic
978903583 4:113980604-113980626 TCCTGCTCAAAGGCAGCAGAGGG + Intergenic
979264562 4:118685795-118685817 AGCACCACAAAGACCGCGGAAGG - Intronic
979694469 4:123596815-123596837 TCCTCCACACAGTCTGCAGAAGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985706412 5:1403769-1403791 ACCACCACAAAGGTAACAGAGGG + Intronic
986287640 5:6371530-6371552 ACCTCCGCACAGGCCGCACTAGG + Intergenic
988643074 5:33063060-33063082 ACCTCCATAAAGCCAGCAGACGG - Intergenic
990486199 5:56261384-56261406 CCCTCCACGAAAGCCGCAGGAGG + Intergenic
990975102 5:61553084-61553106 CCCGCCAGAAAGGCCTCAGAAGG - Intergenic
993946220 5:94119941-94119963 ACCTCCACTGAGTCAGCAGATGG + Intergenic
997409381 5:133679510-133679532 AACTCCTGAAAGGCCTCAGAAGG + Intergenic
1005367137 6:25089874-25089896 ACCTCCAAAAAGGTGGCAGGAGG + Intergenic
1006729781 6:36228361-36228383 AGCTCCACAAGGGCAGCAGCTGG - Intronic
1010592525 6:77727092-77727114 ACCTCCACAAAAACGGGAGAGGG + Intronic
1012430499 6:99159101-99159123 ACCTCCACAGAGGGTGAAGAGGG + Intergenic
1014508502 6:122290314-122290336 AGTTCCACAAAGCCTGCAGATGG - Intergenic
1015641720 6:135340809-135340831 ACCAGCACAAAGGAGGCAGAAGG + Intronic
1017444304 6:154493500-154493522 ACTTCCACTAAGGCTGGAGAAGG - Intronic
1018976314 6:168570121-168570143 ACCCCCACAGAGGCAGCTGATGG - Intronic
1028826782 7:95282603-95282625 CCCTCCCCAGAGGCTGCAGAGGG + Intronic
1032708922 7:134445876-134445898 ACCTGCATGAAGGCAGCAGACGG + Intronic
1038466787 8:27772144-27772166 GCCAGAACAAAGGCCGCAGATGG + Intronic
1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG + Intergenic
1049459017 8:142713394-142713416 ACCTCCAAAATGGCCGCATTTGG + Intergenic
1056132283 9:83598513-83598535 ACCACCACAAAGGCCTTATAAGG + Intergenic
1056928064 9:90851465-90851487 ACCTCCAGAAATGCCACAGGCGG - Intronic
1057842096 9:98494661-98494683 TCCTCCCCAAAGCCCTCAGATGG - Intronic
1061052115 9:128203217-128203239 AGCACCCCAAAAGCCGCAGAAGG + Intronic
1061868305 9:133506643-133506665 ACCTGCACACCGGCCGCAGGCGG - Intergenic
1062085859 9:134647894-134647916 ACCACCACAAGGGCCGCTGTGGG - Intronic
1062569403 9:137178204-137178226 ACCTCCACAAACGCCGCCACTGG + Intronic
1197412897 X:126140110-126140132 ATCTCCAGATAGGTCGCAGATGG + Intergenic