ID: 901020710

View in Genome Browser
Species Human (GRCh38)
Location 1:6253951-6253973
Sequence GCTGCTGGTGGGCGGCAGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 1, 2: 5, 3: 34, 4: 373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901020710_901020716 1 Left 901020710 1:6253951-6253973 CCACGCTGCCGCCCACCAGCAGC 0: 1
1: 1
2: 5
3: 34
4: 373
Right 901020716 1:6253975-6253997 GGAAGCAGACGCCAAAGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 249
901020710_901020721 25 Left 901020710 1:6253951-6253973 CCACGCTGCCGCCCACCAGCAGC 0: 1
1: 1
2: 5
3: 34
4: 373
Right 901020721 1:6253999-6254021 CGATCTCAGCCACGATGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901020710 Original CRISPR GCTGCTGGTGGGCGGCAGCG TGG (reversed) Exonic
900127287 1:1074164-1074186 GCTGCTGGTGGCCGGCCCCGGGG - Exonic
900203145 1:1420198-1420220 GCTGCTGGCGGCCGGCGGCGCGG - Exonic
900334243 1:2153619-2153641 GCTGCCGCTGGCCAGCAGCGGGG - Intronic
900339175 1:2179745-2179767 GCTGCTGGTGGGAGGCCCCAGGG + Intronic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900913354 1:5617644-5617666 GCTGCTGGTGGGCAGGGGTGTGG - Intergenic
900938892 1:5784939-5784961 GGGGGGGGTGGGCGGCAGCGTGG + Intergenic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901174132 1:7286155-7286177 CCTGCTGGTGGGGGGCAGAGAGG + Intronic
901217273 1:7561786-7561808 TCTGCTTGTGGGAGGTAGCGTGG - Intronic
901810937 1:11766485-11766507 GCAGCTGGTGGACGGCAGCACGG - Exonic
902698761 1:18157490-18157512 CCAGCTTGTGGGCTGCAGCGTGG - Intronic
903279969 1:22244828-22244850 GGTGCTGGGGGGAGGCAGCCGGG + Intergenic
904045285 1:27604646-27604668 GCTGCTGGGGCGGGGGAGCGGGG + Intergenic
904456371 1:30650591-30650613 GCTGCTGATGGGGAGCAGTGGGG - Intergenic
904500171 1:30908655-30908677 GCGGCTGCTTGGCGGCGGCGCGG + Exonic
905308463 1:37034307-37034329 GCAGCCCGTGGGCGGCAGCCAGG - Intergenic
907443829 1:54494915-54494937 GCTGAAGGTGGGGGGCAGCCAGG + Intergenic
908553171 1:65230144-65230166 GCTGCTAGAGGGCAGCAGGGGGG - Exonic
910506696 1:87957564-87957586 GTTGCTGGGGAGAGGCAGCGTGG - Intergenic
911188827 1:94927677-94927699 GTTACTCCTGGGCGGCAGCGGGG - Intergenic
911632347 1:100197401-100197423 TCTGATGGTGGGGGGCAGTGAGG + Intronic
911925790 1:103830777-103830799 GCTGCTTGTGGGAGCCAGGGTGG - Intergenic
912509962 1:110182581-110182603 GCTGTGGGTGGGCGGTGGCGGGG + Intronic
913339770 1:117747191-117747213 GCTGTTGGTGGTGGGCACCGTGG - Intergenic
913959140 1:143326267-143326289 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
914053457 1:144151647-144151669 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
914125740 1:144814894-144814916 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
914200037 1:145476208-145476230 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914479155 1:148049343-148049365 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
915358116 1:155268792-155268814 GCTGCTGTCGGGGGGCAGGGGGG + Exonic
916390029 1:164321377-164321399 GCTGCGGGTGGCTGGAAGCGCGG - Intergenic
919083406 1:192892134-192892156 GCTGCTGGCTGGCTGCAGCAGGG - Intergenic
919463790 1:197908955-197908977 GCCGCTGGAGGGCTGCGGCGGGG + Intergenic
919724567 1:200873421-200873443 GCTGCTGGCGGGCATGAGCGTGG + Exonic
919800956 1:201354348-201354370 GCAGCTGGAGGGCAGCAGAGAGG + Intergenic
920273945 1:204789963-204789985 GCTGCTGGTGGGTGGCAGGGAGG + Intergenic
920929614 1:210374933-210374955 ACTGCTGGGGGGTGGCAGGGAGG - Intronic
922787788 1:228291728-228291750 GGTGCTGGTGGGCTGGACCGTGG + Intronic
1062854471 10:772887-772909 GGTGCTGGTGGCCGGCTGGGAGG + Intergenic
1063207960 10:3853099-3853121 TCTGCAGGAGGGTGGCAGCGTGG + Intergenic
1064026130 10:11850202-11850224 GCTGCTTGTGAGTGGCAGGGAGG + Intronic
1065483826 10:26217766-26217788 GCTGCGGGTAGGCGGGAGCGAGG + Intronic
1067764661 10:49075828-49075850 GCTTCTGGTGGGTGGCACCAAGG + Intronic
1069114138 10:64483525-64483547 TCTGCTGGGGGGCGGCGGGGGGG - Intergenic
1069909466 10:71750689-71750711 ACTGCTGGTAGGAGGCAGCTGGG + Exonic
1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG + Intronic
1072238305 10:93472060-93472082 GCTGCTGCTGGGCTCCTGCGAGG + Intronic
1073043317 10:100621799-100621821 GCTGCGGGTGGGGGGGCGCGAGG + Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1075885525 10:125896300-125896322 GCCGCGGGTCGGCGACAGCGGGG + Intronic
1076449146 10:130544259-130544281 GCTGCTGGGGAGCGAAAGCGTGG + Intergenic
1076830590 10:132992391-132992413 GGTGCTGGTGGGATGCAGAGGGG + Intergenic
1076910419 10:133385346-133385368 GTTGCTGGTGGGCAGCCGGGTGG + Intronic
1077005443 11:353242-353264 GCTATTGGTGGGCGGCACCCAGG + Intergenic
1077030337 11:462671-462693 GCTTCTGGTGTGCAGCAGTGCGG - Intronic
1077101360 11:823976-823998 GCTGCGGGTGGGCGGGAGGTCGG - Exonic
1077495802 11:2885997-2886019 GCGGCTGATTGGCGGCCGCGGGG + Intergenic
1077554289 11:3218510-3218532 GCTGCTGGCGGCCTTCAGCGTGG - Exonic
1077864411 11:6210929-6210951 GCTCCTGGTGGAGGGCTGCGGGG - Exonic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1079459541 11:20668340-20668362 ACTGCTGGTGAGGGGGAGCGGGG + Intergenic
1079470795 11:20775623-20775645 ATTGCTGGTGGGTGGCAGTGTGG + Intronic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1080503624 11:32892718-32892740 GGGGCTGGCGGGCGGCCGCGAGG - Intergenic
1080979648 11:37385891-37385913 GCTGGTGGTGGGGGGCGGGGGGG + Intergenic
1081235593 11:40643620-40643642 CGTGCTGGTGGACGGCAGGGGGG - Intronic
1081841172 11:46202451-46202473 GCTGCTGCTTGGCGGCTGGGGGG - Intergenic
1082184539 11:49163494-49163516 GGTGGTGGTGGGGGGCAGGGAGG - Intronic
1083442807 11:62688139-62688161 GCTGCTTTGGGACGGCAGCGAGG - Exonic
1083682782 11:64359032-64359054 GCTGCCGGTGGGCGGCCGGCTGG - Intergenic
1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG + Intronic
1084371814 11:68750298-68750320 GTTGCAGGCGGGCGGCTGCGGGG + Exonic
1084620817 11:70269400-70269422 GCTGTTGGTGTGAGGCAGCCAGG - Intergenic
1085038037 11:73311202-73311224 GCTGCTGGATGGAGGCAGCATGG - Exonic
1085190890 11:74621405-74621427 GGTGGTGGTGGGCGGCGGTGGGG - Intronic
1086850114 11:91798877-91798899 GATGGTGGTGGGAGGCAGAGAGG + Intergenic
1088893926 11:114063988-114064010 GCTGGGGGTGGGCGGCACCCTGG + Exonic
1090748541 11:129726485-129726507 GCTTCTGGTGGGAAGCAGGGAGG - Intergenic
1091215505 11:133898972-133898994 GCTGCTGGTTGGTGACAGTGGGG + Intergenic
1091800487 12:3321652-3321674 GCTGCTGGTGAGAGGCAGCAGGG + Intergenic
1094548469 12:31427746-31427768 GCTGGTAGTGGGGGGCAGCATGG + Intronic
1096149107 12:49297589-49297611 GCTGCTGGGGCGGGGCAGGGCGG + Intronic
1097889034 12:64759171-64759193 GCTGGTGCTGGGCGGCTGCCTGG - Exonic
1098157028 12:67609640-67609662 GGTGCTGGTGGGGGGTAGGGGGG - Intergenic
1098550388 12:71755198-71755220 GCTGCTGGGGGAAGGCTGCGTGG + Exonic
1099014121 12:77324933-77324955 GCTGCTAGGTGGCGGCGGCGCGG + Intergenic
1101337742 12:103811273-103811295 TCTGCGGGTGGGCGGGGGCGGGG + Intronic
1101751295 12:107584676-107584698 GTTCCTGGTGGGAGGCAGCCTGG + Intronic
1102458642 12:113086916-113086938 GCTTCAGGTGGGGGGCAGGGTGG - Intronic
1103619397 12:122177280-122177302 GAAGATGGTGGGGGGCAGCGTGG + Intronic
1104735188 12:131132094-131132116 GCAGCTGGGGGGCGGCAACGGGG + Intronic
1104985799 12:132596328-132596350 GCTGCTGGAAGGCGTCAGAGGGG - Intergenic
1105546056 13:21351984-21352006 CCTGGTGGTGAGCAGCAGCGTGG - Intergenic
1108555118 13:51584376-51584398 GCCGCTGGTGGGCGCGAGGGCGG - Intergenic
1111976012 13:94967996-94968018 GCTGCGGGTGGGCGGGACTGCGG - Intergenic
1113200877 13:107866933-107866955 GGTGCTGGTGGCCGGCGGCGAGG + Intergenic
1113418165 13:110147432-110147454 GTTGCTGGTGGAAGGCAGCATGG + Intergenic
1113929888 13:113962655-113962677 GCTGCTGGTGGCGTGCAGTGGGG - Intergenic
1114288584 14:21269368-21269390 GCTGCTGGAGGTCGGCAACGCGG + Exonic
1116437588 14:44912271-44912293 ACTGCTGGTGGCCGGTGGCGCGG - Intergenic
1117628500 14:57665120-57665142 GGTGGTGGTGGGCGGGAGGGCGG - Intronic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1118531224 14:66707658-66707680 CCTGTTGGGCGGCGGCAGCGAGG + Intronic
1118895592 14:69943003-69943025 GCTGGTGGTGGGGGGCACAGTGG + Intronic
1119027322 14:71164431-71164453 TCTGCTGGTGGGAGGCGGGGTGG + Intergenic
1119731900 14:76956498-76956520 GCTGGCGCTGGGCGGCAGCCGGG - Intergenic
1121015527 14:90546607-90546629 GCTGCTGGTTGGGGGCAGTGTGG - Intronic
1121473497 14:94174382-94174404 CCTGCTGGTGGGCGGCCGCGGGG + Exonic
1122470818 14:101964811-101964833 GCTGCTGGAGGACGGCGGCGAGG + Exonic
1122657920 14:103274189-103274211 GCTGCTGCGGGGCTGCTGCGGGG - Intergenic
1122871245 14:104640039-104640061 GCTGCAGGTGGGCTGCTGTGAGG + Intergenic
1122900586 14:104780723-104780745 CCTCCTGGTGGGTGGCGGCGGGG - Intronic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1122939092 14:104973292-104973314 GCTGCTGGCGGGGGCCAGGGAGG + Intronic
1123043389 14:105499698-105499720 TCTGCTGGTGGGGGGCGGGGGGG - Intergenic
1202839781 14_GL000009v2_random:111097-111119 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1202909159 14_GL000194v1_random:101237-101259 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1202929280 14_KI270725v1_random:23916-23938 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1123423018 15:20147301-20147323 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1123532244 15:21153841-21153863 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1123671613 15:22664684-22664706 GCTGGACGTGGGCGGCGGCGGGG + Intergenic
1124323652 15:28737909-28737931 GCTGGACGTGGGCGGCGGCGGGG + Intronic
1124527549 15:30471150-30471172 GCTGGACGTGGGCGGCGGCGGGG + Intergenic
1124771110 15:32536552-32536574 GCTGGACGTGGGCGGCGGCGGGG - Intergenic
1125524836 15:40368301-40368323 GCCGCCGGGCGGCGGCAGCGTGG - Exonic
1126137250 15:45403410-45403432 GCTGCTGGACGGCGCCAGTGGGG + Exonic
1128905375 15:71463363-71463385 GCTGCTGGAAGGGGGCAGGGAGG - Intronic
1129410744 15:75348965-75348987 GCTGGTGTTCGGCGGCTGCGTGG + Exonic
1130317661 15:82810059-82810081 GCTGGACGTGGGCGGCGGCGGGG + Exonic
1132010290 15:98268961-98268983 GCTGGAGGTGGGTGGCAGGGAGG + Intergenic
1132651686 16:1024074-1024096 GCTGCTGGTGGGGGCCAGCCCGG - Intergenic
1134687680 16:16169988-16170010 GCTTCTGGTGGGAGGCACAGCGG - Intronic
1135049450 16:19180627-19180649 GCTGGGGGAGGGCGGCAGAGTGG + Intronic
1135652202 16:24216177-24216199 GCTGCTGGTGGGCTGTAGTGGGG + Exonic
1138340265 16:56284620-56284642 GCTGCTGGGGGGCAGCTGGGAGG - Intronic
1139489270 16:67278061-67278083 GGTGCTGGTGGGCAGCAGAAGGG + Exonic
1139544968 16:67645796-67645818 GCTGCTGGCGGGCGGGGGTGTGG - Intronic
1139594912 16:67951819-67951841 GCTGCTGGTGTGCTCCAGGGTGG - Exonic
1139922751 16:70470239-70470261 TCTGCTGCTGGGAGGCAGCCTGG + Intronic
1140927633 16:79599323-79599345 GGTGGTGGTGGCCGGCGGCGTGG + Exonic
1141642581 16:85349830-85349852 GCTGCTGGTGAATGGCAGAGAGG - Intergenic
1141694504 16:85613283-85613305 GCTGCTCGGCGGCGGCAGCTCGG - Exonic
1141831324 16:86511306-86511328 GGCGCCGGTGGGCAGCAGCGGGG - Exonic
1142132359 16:88436886-88436908 GTAGCAGGTGGGCGGCGGCGCGG - Exonic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142586904 17:979621-979643 GCTGGTGACGGGCGGCGGCGAGG - Exonic
1142809254 17:2387531-2387553 GGTGCTGGGGGGTGGCAGGGTGG + Exonic
1144626039 17:16844937-16844959 GCTGCGGGTGGGAGGCAGAAAGG - Intergenic
1144880395 17:18427783-18427805 GCTGCGGGTGGGAGGCAGAAAGG + Intergenic
1145151840 17:20516604-20516626 GCTGCGGGTGGGAGGCAGAAAGG - Intergenic
1146398460 17:32486620-32486642 GCTGCTGTTGGGCGGCGGCGCGG + Exonic
1147402830 17:40191381-40191403 GCTGCTGCAGCGCTGCAGCGAGG + Exonic
1148646894 17:49224392-49224414 GCTGCTGGCGGGCGGCGACGTGG - Exonic
1149655638 17:58308435-58308457 GCTGATGGAGGCAGGCAGCGTGG + Intronic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1151546761 17:74797995-74798017 GCTGGTGGTGAGAGGCAGTGTGG - Intronic
1151653761 17:75485960-75485982 GCTGCTGCTGGGCTGCTGCGGGG + Exonic
1151966005 17:77432037-77432059 GCTGGGGGTGGGGGGCAGCAGGG + Intronic
1152099831 17:78294558-78294580 GTTGCTGGTGGGATGCAGCTGGG + Intergenic
1152245599 17:79183191-79183213 GCGGGGCGTGGGCGGCAGCGCGG + Intronic
1152381518 17:79944800-79944822 GCTGTGGGTGGGGGGCGGCGAGG + Intronic
1152442760 17:80319018-80319040 TCTACTGGTGGGGGGCAGGGAGG + Intronic
1152553752 17:81042824-81042846 GCTGCTAGTGGCGGGCAGAGTGG + Intronic
1152639725 17:81444515-81444537 GCTGCGGGTGCGGGGCAGCCAGG - Exonic
1152714266 17:81891151-81891173 GGGGGTGGTGGGCGGGAGCGAGG - Intronic
1152727888 17:81956630-81956652 GCTGTGAGTGGGCGGCAGAGCGG - Exonic
1152753959 17:82079208-82079230 GCTGCTGGAGGGCAGCGGCCTGG - Exonic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1152931841 17:83113959-83113981 GCTGGTGGTGGGGGGCACAGAGG + Intergenic
1153316665 18:3729163-3729185 GGTGGTGGTGCGCGGCGGCGAGG + Exonic
1153666395 18:7370583-7370605 GCTGCTGATGGGAGGGGGCGGGG + Intergenic
1155393282 18:25360020-25360042 GCTGATGGTGGGGGGCTGGGTGG - Intergenic
1156221786 18:35060138-35060160 CCTGCTCGTTGGGGGCAGCGTGG + Intronic
1156396771 18:36706144-36706166 CCTGCTGGAGGGCCCCAGCGTGG - Intronic
1157398676 18:47367412-47367434 GCCCCTGGTGGGGGGCAGCATGG + Intergenic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160187797 18:76688895-76688917 GCTGCAGGTGGACGGGTGCGGGG - Intergenic
1160233553 18:77067647-77067669 GCTGCTGGTGGGTAGCACCAGGG - Intronic
1160556160 18:79726810-79726832 GTTGCTGGTGGACGGCTGTGGGG + Intronic
1160861190 19:1237790-1237812 GCTGGCGGCGGGCGGCTGCGTGG + Exonic
1161440936 19:4291343-4291365 GCTGCCGGGGGGAGGGAGCGGGG - Intergenic
1163645552 19:18487112-18487134 TCTCCTGGTGGGGGGTAGCGGGG - Intronic
1163690895 19:18737715-18737737 GCAGCAGGAGGGCGGCAGCTTGG - Intronic
1164283429 19:23789295-23789317 GCTGCTGGTGGCAGGCAGACTGG - Intronic
1164464166 19:28473428-28473450 GCTGCAGGCGGGCCACAGCGAGG + Intergenic
1164658546 19:29942332-29942354 GCTGCGGGGCGGCGGCGGCGGGG + Exonic
1164939887 19:32244173-32244195 GCAGATGGTGGGGGGCAGAGGGG - Intergenic
1165188484 19:34042099-34042121 CCTGCTGGTGAGTGGCAGCCAGG - Intergenic
1166067418 19:40367914-40367936 GCAGGGGGTGGGAGGCAGCGGGG + Intronic
1166721970 19:45001974-45001996 GCTGCTCTTGGGCGGTATCGGGG + Intronic
1166856749 19:45786071-45786093 GCTGCTGGCGGCCGGTGGCGTGG + Exonic
1167125521 19:47545770-47545792 GCTGCTGGGGGGCGGCTGGCCGG + Exonic
1167245235 19:48369198-48369220 CCAGCTGGCAGGCGGCAGCGAGG - Intronic
1167374339 19:49103074-49103096 GCAGCTGGTGGGAGGGAGCATGG + Intronic
1167528566 19:50000758-50000780 CCTGCAGGTGGGGGGCAGCTTGG - Intronic
1168311070 19:55461141-55461163 GCTGGAGGTGGGCGGCAACAGGG + Intronic
1168489204 19:56793912-56793934 GCTGCTGTTGGGGGGAAGGGTGG + Intronic
1202692856 1_KI270712v1_random:104070-104092 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
925180295 2:1813170-1813192 GCTGCAGGTGGGGGGGAGAGAGG + Intronic
925345217 2:3167279-3167301 GCTGCTGGTGTGGGGCTGAGGGG + Intergenic
926112868 2:10193931-10193953 GCTGCTCCTGGGCTGGAGCGTGG + Intronic
927704841 2:25290752-25290774 GCTGCAGGTGGGCTGCAGCCTGG - Intronic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929075180 2:38074830-38074852 GCTGCTGGTGCGCGGCAGCGCGG - Exonic
929860328 2:45671575-45671597 GCTGGTGGGGGGAGGCAGAGGGG - Intronic
931711196 2:64989916-64989938 GCCGCTGGTGGTCTGCAGCCTGG + Exonic
931941305 2:67254780-67254802 GGTCCTCGTGGGAGGCAGCGTGG + Intergenic
932446648 2:71785790-71785812 GCTGCTGGGGTGGGGAAGCGGGG + Intergenic
932451354 2:71812735-71812757 GCTGTAGGTGGGAGGCAGTGGGG + Intergenic
932480020 2:72033476-72033498 GCTGATGGTGGGCGGCGGGGGGG - Intergenic
933953545 2:87349897-87349919 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
934237750 2:90246145-90246167 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
934275451 2:91570586-91570608 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
934460180 2:94209477-94209499 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
934614406 2:95762384-95762406 GGTGCTGGTGCCAGGCAGCGGGG + Intergenic
934669577 2:96202134-96202156 ACTGCTTGTGGGCGGGAGGGGGG - Intronic
934692284 2:96370902-96370924 GCTGCTGTTGGGGGGCAGTAAGG + Intronic
937113377 2:119384865-119384887 TCTCCTGGTGGGTGGCAGGGTGG - Intergenic
937249961 2:120517392-120517414 ACAGCTGGTGGGAGGCAGCATGG - Intergenic
937956253 2:127423188-127423210 GATGCTGGCGGGCGGCGGGGCGG + Intronic
939032794 2:137096349-137096371 TCTGGTGGTGGGCTGCAGCCTGG + Intronic
940928628 2:159398194-159398216 GTTACTGGTGGACGGCAGGGTGG + Intronic
943601195 2:189923207-189923229 GCTGCTGGAGGTCGGCAACGCGG - Intronic
945776069 2:214107801-214107823 GCTGCTGGGGGTAGGCAGTGGGG - Intronic
946019833 2:216633504-216633526 CATGCTGGCGGTCGGCAGCGCGG - Exonic
948032111 2:234827407-234827429 GATGATGGTGGGATGCAGCGTGG - Intergenic
948479263 2:238239990-238240012 GCTGCTGCTGGGCGGCCGCGGGG - Exonic
1169140319 20:3224057-3224079 CCTGCGGGTGGGGGGCAGCATGG - Intergenic
1169516422 20:6321417-6321439 CCAGCTGCCGGGCGGCAGCGAGG - Intergenic
1172428600 20:34872816-34872838 GCTGCTGGGGGGCGCGGGCGAGG - Exonic
1173249047 20:41354920-41354942 GGTGCAGGTGGGTGGCAGGGAGG + Intronic
1173703422 20:45093084-45093106 TCTGTTTGTGGGTGGCAGCGGGG + Exonic
1175346037 20:58276784-58276806 GCTGCTGGTGGGTGGAAGCCAGG - Intergenic
1175493592 20:59396102-59396124 GCTGCTGCTGGGCACCAGCAAGG - Intergenic
1176234501 20:64048199-64048221 GCTGCTGGCGTCCGACAGCGCGG + Exonic
1176628513 21:9115950-9115972 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1179421736 21:41241797-41241819 GCTGCGGGAGGGCGACAGAGAGG - Exonic
1180032954 21:45224586-45224608 GCTACTGGGGGGCGGCTGTGAGG + Exonic
1180096246 21:45556403-45556425 GGCGCTGGTGGGGAGCAGCGGGG - Intergenic
1180110325 21:45644275-45644297 GCGGCTGGAGGGCGGCGGGGCGG + Intronic
1180274150 22:10629627-10629649 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1180378631 22:12117496-12117518 GCTGTTGGTGGGAGGCAGGAGGG + Intergenic
1181307124 22:21923181-21923203 GCTGCTGGAGGGCGGGAACCAGG - Exonic
1181356078 22:22297275-22297297 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1181882563 22:25992525-25992547 GCAGCAGGTGGGCGGCATCCTGG + Intronic
1182074845 22:27488456-27488478 GGTGCTGGTGGGGGCCAGGGAGG + Intergenic
1182481841 22:30614299-30614321 GCTGCTGGGTGGGGGCAGAGAGG + Intronic
1183352853 22:37343635-37343657 CCTGCTGGTGGCTGGCAGCCTGG - Intergenic
1183744517 22:39685273-39685295 GCTGCAGGTGGGGGGCCCCGGGG + Intronic
1183983651 22:41557424-41557446 GCTGCTGGTGGGTGGGTGGGTGG + Intergenic
1184035028 22:41914193-41914215 GCTGGTGCTGGCCGGCATCGGGG - Exonic
1184246470 22:43238187-43238209 CCTGCTGGTGGCTGGCAGTGAGG - Intronic
1184401390 22:44276644-44276666 GGAGATGGTGGGAGGCAGCGGGG + Intronic
1184523544 22:45009062-45009084 GCTGCTGGCGAGCGGCGGCGTGG - Intronic
1185269174 22:49920815-49920837 GCTGATGGTGGGCGGGTGGGGGG - Intronic
949226312 3:1699810-1699832 GCTGATGGTGGGAGGCAGACAGG + Intergenic
950200356 3:11037937-11037959 GCTTGGGGTGGGTGGCAGCGAGG - Exonic
950421224 3:12901019-12901041 GCTGCTGGTGGGGGGCGGCGGGG + Intronic
952180331 3:30910204-30910226 GCTGCTGGCCTGCGGCAGCCTGG + Intergenic
953749959 3:45601437-45601459 GCTGCTGGGGTGCGGCAGGCAGG - Intronic
953980194 3:47409802-47409824 GCTGCTGGCGGGCAGCCTCGCGG - Exonic
953982125 3:47418198-47418220 GCTGCTGGTGAGCTGCTGCCTGG - Exonic
955785717 3:62536692-62536714 GATGTTGGTGGGAGGCAACGGGG - Intronic
956618594 3:71198210-71198232 GCTGCTGCTGGGCGTGGGCGAGG + Intronic
957215725 3:77317652-77317674 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957215764 3:77317744-77317766 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957215793 3:77317813-77317835 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957215807 3:77317846-77317868 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957215818 3:77317869-77317891 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
960702472 3:120451294-120451316 GCTGCTGGCTGGCGGCGGCCCGG + Intergenic
961658908 3:128458023-128458045 GCTGGAGGTGGGAGGCAGGGTGG + Intergenic
962352151 3:134663999-134664021 GCTGCTGCTGGGCTGCTGCAGGG + Intronic
962421133 3:135230055-135230077 GCTGAGGGTGGGCAGCAGTGAGG + Intronic
962688255 3:137868214-137868236 GCTGCTGCTGGGGGTCAGGGAGG - Intergenic
966619990 3:181953094-181953116 CCTGCTGGAGGGCAGGAGCGGGG + Intergenic
967054335 3:185815753-185815775 GGTGCTGGTGGGAGGGAGAGAGG - Intronic
968506540 4:973616-973638 GCTGCTGGTGGGCGGATCTGGGG + Intronic
968525868 4:1056866-1056888 GATGCTGATGGGCGGCCGGGGGG + Intronic
968565635 4:1311147-1311169 ACTGCTCTTGGGCGGCAGCACGG + Intronic
968602564 4:1517262-1517284 GCTGCTGGTGGGCGGAGGGCTGG - Intergenic
968605163 4:1531977-1531999 GCTGCTGATGGGGGACAGAGCGG - Intergenic
968613893 4:1568795-1568817 GCTGCGGGTCGGAGGCGGCGCGG - Intergenic
968615936 4:1577912-1577934 GCTGCAGGTGAGGGGCTGCGGGG + Intergenic
968653384 4:1768660-1768682 GCGGGTCCTGGGCGGCAGCGAGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969436645 4:7192766-7192788 GCTGCTGCTGGGCGCCTGCGGGG + Exonic
969437245 4:7195099-7195121 GCTCCTTGAGGGCGGCAGCTGGG + Intronic
969597838 4:8158904-8158926 GGTGCTCCCGGGCGGCAGCGGGG - Intergenic
972437264 4:39045392-39045414 GGTGCTGGTGGCCGGCAGTGAGG + Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
972698257 4:41468804-41468826 GTAGCTGGTGGGTGGCAGCTCGG + Intronic
977746755 4:100558534-100558556 GCTGTTGGTGGGGGGCACGGTGG + Intronic
979099506 4:116598268-116598290 GGTGCTGGTGTGCCGCAGCCAGG - Intergenic
981002337 4:139839883-139839905 GCTGCTGGTGGCCAGCAGTGGGG + Intronic
982232594 4:153222836-153222858 GCTGCAGAAGGGCGGCTGCGGGG + Intronic
984023820 4:174519691-174519713 CCCGCTGGTGGGCAGCAGTGGGG - Intronic
984944331 4:184959514-184959536 GCTGCAGGTGGGAGGCAGTGGGG - Intergenic
1202760249 4_GL000008v2_random:102963-102985 GCTGTTGGTGGGAGGCAGGAGGG + Intergenic
985696620 5:1344664-1344686 GCTGCAGGTGAGCGTCCGCGGGG - Exonic
988492631 5:31717764-31717786 GCTGCTGGTGGGCATCTGGGAGG + Intronic
989826596 5:45864080-45864102 GCTGCTGGTAGCCAGCACCGCGG + Intergenic
990545266 5:56815702-56815724 GCTGCGGGAGGCGGGCAGCGGGG + Exonic
992716342 5:79514334-79514356 GCTGATGGTGGGGGGCCGAGCGG + Intergenic
997351320 5:133233447-133233469 GCTGCTCGTGGCCGGAAGCATGG + Exonic
997717497 5:136052995-136053017 ACTGGAGGTGGGCTGCAGCGGGG + Exonic
998026415 5:138820032-138820054 GCTGGCGGTGGGGGGCAGGGCGG - Intronic
998138689 5:139688097-139688119 GCTGCGGGTGGGCGGGGGGGGGG - Intergenic
998174158 5:139891142-139891164 GCCGCTGGTGGGAGGAAGCAGGG + Intronic
998365758 5:141629784-141629806 GATGATGGTGGGGGGCAGCTGGG - Intronic
998515851 5:142753416-142753438 GGTGCTGTTGGGTGGCAGCCAGG + Intergenic
999204647 5:149839433-149839455 GCTGCAGGTGGGTGGCACCTGGG + Intronic
1001797216 5:174512677-174512699 GCTGGTGGTGGGGGGCAAAGTGG + Intergenic
1002418100 5:179131449-179131471 GGTGCTGGTCCACGGCAGCGTGG + Intronic
1004044660 6:12012335-12012357 GCGGCTGCTGGGCGGCGGCAGGG + Exonic
1004044661 6:12012338-12012360 GCTGCTGGGCGGCGGCAGGGTGG + Exonic
1004178083 6:13358027-13358049 GCTGCTGGAGGCCCGCAGGGAGG + Exonic
1005938355 6:30542254-30542276 GCTGCTGATGGGTGGTGGCGGGG - Exonic
1006130292 6:31865010-31865032 GCTGCTGGTGGTCGGAGGCGTGG - Exonic
1006295015 6:33166452-33166474 GCTGTGGGTGGGCAGCAGAGGGG + Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006925251 6:37650389-37650411 ACTGATGGTGGGCGGCACTGTGG + Exonic
1007078613 6:39083481-39083503 GCTGCTGGTGGGCGTGAGTGGGG + Intronic
1007310080 6:40938377-40938399 GCTGCAGGTGAGAGGCAGAGTGG - Intergenic
1007932983 6:45708970-45708992 GCTGAAGGTGGGGGGCAGCCTGG + Intergenic
1011441069 6:87387906-87387928 GCAGCTGGAGGGCCGCAGAGAGG + Intronic
1011999621 6:93637181-93637203 CCAGCTGCAGGGCGGCAGCGAGG - Intergenic
1013491009 6:110646396-110646418 GCTGCTGGCGGGCGGCGACATGG + Intronic
1018876657 6:167827302-167827324 GCGGCTGGCGGGCGGCGGCGGGG - Intronic
1019190059 6:170246428-170246450 GGTGCTGGGGGGCGGCTGCAGGG - Intergenic
1019190099 6:170246531-170246553 GGTGCTGGGGGGCGGCTGCAGGG - Intergenic
1019190164 6:170246703-170246725 GGTGCTGGGGGGCGGCTGCAGGG - Intergenic
1019190215 6:170246841-170246863 GGTGCTGGGGGGCGGCTGCAGGG - Intergenic
1019190229 6:170246876-170246898 GGTGCTGGGGGGCGGCTGCAGGG - Intergenic
1019190282 6:170247013-170247035 GGTGCTGGGGGGCGGCTGCAGGG - Intergenic
1019320311 7:412144-412166 CCTGCTGCTGGGCTGCCGCGTGG - Intergenic
1019497794 7:1348458-1348480 GCTGATGGTGGGTGGGGGCGGGG - Intergenic
1019903313 7:4041608-4041630 GCTGCTGGGGGTCGGCAGTCAGG - Intronic
1020212442 7:6166693-6166715 GCTGCAGGTGGGAGGAAGCCTGG + Intronic
1020278288 7:6637463-6637485 GGGGCCGGTGGGCGGCGGCGCGG + Intronic
1020860766 7:13489396-13489418 GCTGTTGGTGGGGGGCATGGTGG + Intergenic
1021210105 7:17839917-17839939 GCTGCTGTTGGGCGGTAACCCGG + Exonic
1022707103 7:32812433-32812455 GCTGCTGGTAGGCTCCAGCAAGG + Intergenic
1022915768 7:34950200-34950222 GCTGCTGGTAGGCTCCAGCAAGG - Intronic
1023418222 7:39951112-39951134 GCTGCTGGGGGGGGCCAGCGCGG + Exonic
1023991795 7:45133014-45133036 GTGGCTGGTGGGGGGCAGTGGGG + Intergenic
1024237541 7:47409402-47409424 GCTCTTGGTGGGCGGTAGGGGGG + Intronic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1025770477 7:64500699-64500721 GCTGCTCGAGGTCGGCAACGTGG - Intergenic
1026806814 7:73434049-73434071 GCTGCTGGCGGCGGGCGGCGCGG + Exonic
1026894345 7:74001270-74001292 GCTGTTGGTGTGAGGCAGTGAGG - Intergenic
1029701398 7:102248834-102248856 GCTGTTGCTGGGCGGCGGCGCGG - Exonic
1032570608 7:132992172-132992194 GCTGCTGCTGGGAAGCAGTGAGG - Intronic
1034123100 7:148645113-148645135 GCTACTAGTGGGTGGCAGTGAGG - Intergenic
1034446046 7:151114881-151114903 CCTGCAGGGCGGCGGCAGCGCGG - Intronic
1034855737 7:154544910-154544932 GCCGCATGTGGGCGGCTGCGTGG + Intronic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035468111 7:159092872-159092894 CCTGGTGCTGGGCAGCAGCGTGG + Intronic
1040981559 8:53250957-53250979 GCTGCTGTTGGGGGGCAGGCAGG + Exonic
1042743302 8:72075524-72075546 GCTGCCTGTGAGCTGCAGCGCGG - Exonic
1042759090 8:72251680-72251702 GCTGCCTGTGAGCTGCAGCGAGG - Intergenic
1045791526 8:105989611-105989633 GCTCCTTGTGGGAGGCAGTGGGG + Intergenic
1047000557 8:120568652-120568674 CCTGCTCCTGGGCGGCAGCCTGG - Intronic
1047192040 8:122687066-122687088 ACTGCTGAGGGGCGGCAGTGGGG - Intergenic
1047277497 8:123416864-123416886 GCTGGTAGTGGACAGCAGCGGGG - Exonic
1048981028 8:139703476-139703498 GCGGCCGGAGGGCGGCCGCGGGG + Intergenic
1049183212 8:141234205-141234227 GGTGCTGGTGGAAGGCAGCCTGG + Intronic
1049209556 8:141379209-141379231 GCTTCTGGTGGGAGGCGGTGGGG - Intergenic
1049414018 8:142487289-142487311 GCTGCTGGGAAGCTGCAGCGGGG - Intronic
1049661297 8:143820842-143820864 GGTGCTGGCGGCCGGCAGTGTGG - Intronic
1049740795 8:144239970-144239992 GGAGCAGGTGGGGGGCAGCGGGG + Intronic
1049752006 8:144289385-144289407 GCTGCTGGTGGGTGGCTGGAGGG - Intronic
1049791088 8:144473045-144473067 GCTGCAGGTGGGCGCCGGGGCGG + Exonic
1049828259 8:144684573-144684595 GCTGCTGGTGGGAAGCGGCTCGG + Intergenic
1049986548 9:956900-956922 GCTTCAGGTGGGCTGCAGCTAGG + Intronic
1050151256 9:2621720-2621742 GCGGCGGGCGGGCGGGAGCGCGG - Intergenic
1051206358 9:14693258-14693280 GCTGCTGGCGGTCGGGAGAGCGG - Exonic
1052056286 9:23911164-23911186 GCTGCTGGTGGGAGGTGGGGAGG - Intergenic
1053145110 9:35706797-35706819 GCTGCTGGCTGACTGCAGCGAGG + Exonic
1053690677 9:40585163-40585185 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054274128 9:63052328-63052350 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1054301935 9:63386134-63386156 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054400712 9:64712640-64712662 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054434320 9:65196957-65196979 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054496070 9:65824724-65824746 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1055514148 9:77020104-77020126 GGTGGTGGTGTGCGGCAGCGTGG - Exonic
1056475275 9:86946746-86946768 GCTGCTGGGCGGCGGCGGCGAGG - Exonic
1056793186 9:89639407-89639429 GCTGCTGGCGTGCGGCCCCGGGG - Intergenic
1057220713 9:93256387-93256409 GGTGCTGGGCGGCGGCAGCACGG - Exonic
1057223259 9:93269075-93269097 GCTGCAGGTGTGCGGCACAGAGG - Intronic
1057869680 9:98708579-98708601 GCTGCTGGGCGGCGGCCGGGGGG + Exonic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1059145613 9:111896896-111896918 GGGTCTGGTGGGCGGCCGCGAGG + Exonic
1060401806 9:123353932-123353954 GCTGCTGGTGGGTGGGGGGGGGG + Intergenic
1061014087 9:127972018-127972040 GCTGCTGGTGGGCTGGAGTGTGG - Intronic
1061299659 9:129697377-129697399 GCAGCTGGGCGGCGGCGGCGCGG + Intronic
1061406487 9:130395341-130395363 GCTGCAGGTGGGCGCCAGGCAGG + Intronic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1061903359 9:133684224-133684246 GCACCTAGTGGGCGGCAGCCAGG + Intronic
1062278901 9:135743347-135743369 GCTGAAGGTGGATGGCAGCGGGG - Intronic
1203786980 EBV:133558-133580 TCTGATGGTGGCCGGCAGCCTGG + Intergenic
1203751358 Un_GL000218v1:83629-83651 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1203482629 Un_GL000224v1:20725-20747 GCTGTTGGTGGGAGGCAGGAGGG + Intergenic
1203541025 Un_KI270743v1:87857-87879 GCTGTTGGTGGGAGGCAGGAGGG + Intergenic
1203621330 Un_KI270749v1:131279-131301 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1185734893 X:2489091-2489113 GACGCTGGCGGGCGGCGGCGTGG + Exonic
1187344361 X:18449495-18449517 GATTCTGGGGGGCGGCAGGGGGG - Intronic
1187748356 X:22433491-22433513 GCTGTTGGTGGGGGGCACAGTGG + Intergenic
1191855270 X:65620306-65620328 GGAGCTGCGGGGCGGCAGCGAGG - Intronic
1192218825 X:69182922-69182944 GCTGGGGGTGGGGGGCAGTGAGG + Intergenic
1198254738 X:134915010-134915032 GATGCGGGTGGGCGGCGGGGAGG - Intronic
1200099900 X:153685186-153685208 GCTGCTGGGGAGGGGCAGGGTGG - Intronic
1201165016 Y:11201242-11201264 GCTGTTGGTGGGAGGCAGGAGGG - Intergenic
1202584329 Y:26408426-26408448 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic