ID: 901020929

View in Genome Browser
Species Human (GRCh38)
Location 1:6255049-6255071
Sequence CTACAACGCTGTCGCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901020929_901020937 4 Left 901020929 1:6255049-6255071 CCTCTCTGGCGACAGCGTTGTAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 901020937 1:6255076-6255098 TAGGTACTTGGGATGGGAGATGG 0: 1
1: 0
2: 0
3: 22
4: 270
901020929_901020932 -7 Left 901020929 1:6255049-6255071 CCTCTCTGGCGACAGCGTTGTAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 901020932 1:6255065-6255087 GTTGTAGCCCTTAGGTACTTGGG 0: 1
1: 0
2: 0
3: 5
4: 64
901020929_901020933 -3 Left 901020929 1:6255049-6255071 CCTCTCTGGCGACAGCGTTGTAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 901020933 1:6255069-6255091 TAGCCCTTAGGTACTTGGGATGG 0: 1
1: 0
2: 0
3: 5
4: 81
901020929_901020931 -8 Left 901020929 1:6255049-6255071 CCTCTCTGGCGACAGCGTTGTAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 901020931 1:6255064-6255086 CGTTGTAGCCCTTAGGTACTTGG 0: 1
1: 0
2: 0
3: 4
4: 61
901020929_901020934 -2 Left 901020929 1:6255049-6255071 CCTCTCTGGCGACAGCGTTGTAG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 901020934 1:6255070-6255092 AGCCCTTAGGTACTTGGGATGGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901020929 Original CRISPR CTACAACGCTGTCGCCAGAG AGG (reversed) Intronic
901020929 1:6255049-6255071 CTACAACGCTGTCGCCAGAGAGG - Intronic
913673220 1:121117375-121117397 TTACAACGGTGTCGTCAGAGGGG + Intergenic
914024997 1:143904736-143904758 TTACAACGGTGTCGTCAGAGGGG + Intergenic
914663428 1:149812456-149812478 TTACAACGGTGTCGTCAGAGGGG + Intergenic
917854768 1:179091362-179091384 GTAGAACGCTGGTGCCAGAGTGG + Intronic
1091049194 11:132352387-132352409 CTTCAAGGCTGTCCCCAGAATGG - Intergenic
1091232311 11:133996652-133996674 CCACACAGCTGTCCCCAGAGAGG + Intergenic
1091798150 12:3308965-3308987 CTACCCTGCTGTGGCCAGAGGGG - Intergenic
1091840088 12:3614621-3614643 CTACAACCCTGACTCCAGGGTGG - Intronic
1097895510 12:64821382-64821404 CTACAACACTGTCTCTGGAGTGG - Intronic
1099913639 12:88864523-88864545 CTACTAAACTGTCTCCAGAGTGG - Intergenic
1116561018 14:46378323-46378345 CTACATCGCTGTTGGCAGATGGG + Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1131810059 15:96163713-96163735 CTACAACGTTGTCGTCATGGGGG - Intergenic
1139303543 16:65964547-65964569 CTAATGCGATGTCGCCAGAGTGG - Intergenic
1152837459 17:82543071-82543093 CTTCAGTGCTGTTGCCAGAGTGG + Intronic
1154335665 18:13462815-13462837 CTACAACAATGTAGCCAGAGAGG + Intronic
1167604756 19:50475885-50475907 CTCCAACGCTACCTCCAGAGCGG - Exonic
927508366 2:23628988-23629010 CTCCAATCGTGTCGCCAGAGTGG - Intronic
937036405 2:118786086-118786108 CTACAGTGCTGTCTCCACAGAGG + Intergenic
942418322 2:175781701-175781723 CTCCAAAGCTGTCTTCAGAGAGG - Intergenic
946353701 2:219171952-219171974 ATACAAAGCAGTGGCCAGAGAGG + Intronic
948581456 2:238989722-238989744 CTGCAAGGGTGTTGCCAGAGGGG - Intergenic
1171078854 20:22156868-22156890 CTCCAACCCTGTAGCCTGAGTGG - Intergenic
1173647062 20:44639951-44639973 CTACAGAACTGTGGCCAGAGAGG + Intronic
1174447627 20:50601395-50601417 CTACAACTCTGTTGCCAGCCTGG + Intronic
1175625425 20:60484994-60485016 CTCCAACGCAGTTGCCAAAGAGG - Intergenic
1178531947 21:33383127-33383149 CTACAGCTCTCTCCCCAGAGGGG - Intergenic
1180908141 22:19430613-19430635 CTACAGTGCTGTCAGCAGAGTGG + Intronic
1181632197 22:24157118-24157140 GTACAACCCTGCGGCCAGAGAGG + Intronic
953420781 3:42751677-42751699 CTCCAACTCTGTCTCCAGAAAGG - Intronic
954304575 3:49718753-49718775 CTACAGCGCTGGCACCAGCGGGG - Exonic
961520164 3:127462672-127462694 CTACATCGCTGTCTCCGAAGAGG - Intergenic
965682230 3:171263429-171263451 CTGCAACTCTGTCAACAGAGAGG + Intronic
994720316 5:103372598-103372620 CTCCCACACTGTTGCCAGAGTGG + Intergenic
1012005038 6:93703142-93703164 CTACACCACTGTCCCAAGAGAGG - Intergenic
1018935116 6:168269196-168269218 CTGCATCGCAGTCACCAGAGGGG - Intergenic
1021601405 7:22367817-22367839 CTACAACGAGGTCCCTAGAGAGG + Intergenic
1037114264 8:15204820-15204842 CTACCACTCTGTCCCAAGAGAGG + Intronic
1037474638 8:19245080-19245102 CCACAGGGCTGTGGCCAGAGAGG - Intergenic
1038325309 8:26568331-26568353 GTACAACGCTGTAGAAAGAGAGG - Intronic
1041414613 8:57594179-57594201 CTATATTGCTGTCACCAGAGAGG + Intergenic
1048799389 8:138182081-138182103 CTACCACGCTGCCACCACAGTGG + Intronic
1051122907 9:13771612-13771634 CTAAAAAGCTGCCTCCAGAGAGG + Intergenic
1061970703 9:134043589-134043611 CTTCAAGGCTGTCGGCCGAGCGG - Intronic
1199104041 X:143840798-143840820 CTATCACGCTGTCGCCAAACTGG + Intergenic
1199991041 X:152987969-152987991 CTTCAGCACTGTGGCCAGAGGGG - Intergenic