ID: 901022138

View in Genome Browser
Species Human (GRCh38)
Location 1:6260920-6260942
Sequence GCCGCGGGGGTGGCTGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 551}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901022125_901022138 2 Left 901022125 1:6260895-6260917 CCGGGCCGAGCGCAGGCCGCCGA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551
901022123_901022138 4 Left 901022123 1:6260893-6260915 CCCCGGGCCGAGCGCAGGCCGCC 0: 1
1: 0
2: 2
3: 27
4: 190
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551
901022124_901022138 3 Left 901022124 1:6260894-6260916 CCCGGGCCGAGCGCAGGCCGCCG 0: 1
1: 0
2: 1
3: 14
4: 191
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551
901022119_901022138 11 Left 901022119 1:6260886-6260908 CCCGCGCCCCCGGGCCGAGCGCA 0: 1
1: 0
2: 2
3: 22
4: 212
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551
901022128_901022138 -3 Left 901022128 1:6260900-6260922 CCGAGCGCAGGCCGCCGAGGGCC 0: 1
1: 0
2: 1
3: 14
4: 141
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551
901022115_901022138 29 Left 901022115 1:6260868-6260890 CCGGCTCCGGCTGCGGTTCCCGC 0: 1
1: 0
2: 10
3: 55
4: 282
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551
901022122_901022138 5 Left 901022122 1:6260892-6260914 CCCCCGGGCCGAGCGCAGGCCGC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551
901022120_901022138 10 Left 901022120 1:6260887-6260909 CCGCGCCCCCGGGCCGAGCGCAG 0: 1
1: 0
2: 4
3: 39
4: 269
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551
901022116_901022138 23 Left 901022116 1:6260874-6260896 CCGGCTGCGGTTCCCGCGCCCCC 0: 1
1: 0
2: 1
3: 27
4: 220
Right 901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901022138 Original CRISPR GCCGCGGGGGTGGCTGGCGG CGG Exonic
900147159 1:1163317-1163339 GCCACGGCGGGGGCTGGCGAGGG - Intergenic
900415591 1:2533044-2533066 GCTGCGGAGGGGGCTGGAGGAGG + Intergenic
900592933 1:3467894-3467916 GCCGTGGGCGTGGCGGGCAGCGG + Intronic
900970941 1:5992182-5992204 GCCGCGGGGGAGGTTGGACGCGG - Intronic
901007575 1:6179475-6179497 GCCGCGGGGCGGGCTGGGTGGGG - Intronic
901012373 1:6209093-6209115 GCTGCGGGGGCGGCGGGCGGTGG - Exonic
901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG + Exonic
901059638 1:6466074-6466096 GCCGCGGGGCTGCGCGGCGGTGG - Exonic
901066595 1:6497338-6497360 GCCGCGCGGGGGGCGGGCGGCGG + Intronic
901066654 1:6497471-6497493 GCCTCGGGGGCGGGGGGCGGGGG + Intronic
901455321 1:9359845-9359867 GCCGGGGGGGTGGGTGGCGGGGG + Intronic
901483217 1:9539977-9539999 GCCGCGGGGAGGACGGGCGGCGG - Intronic
901647098 1:10722701-10722723 GCCGTGGTGGTGGCTGAAGGTGG + Intronic
901671174 1:10857132-10857154 GCCGGGGTGGTGTCTGGTGGGGG - Intergenic
901773175 1:11541401-11541423 GCAGGGAGGGTGGCTGGCGCTGG - Intergenic
901932140 1:12602598-12602620 GCCCTGGGGGTGGGGGGCGGTGG - Intronic
902033472 1:13439520-13439542 GCCCACGGGGTGGCGGGCGGGGG - Intergenic
902896767 1:19485104-19485126 ACCGAGGGGGTGCCTGGCTGGGG + Intronic
902920723 1:19664941-19664963 GCCGCGGGCCGGGCGGGCGGCGG - Intergenic
903183509 1:21617266-21617288 GCAGCGGGGCTGGCTGGGGTGGG - Intronic
903328338 1:22584162-22584184 GCCCCGGGGGCCGCTGGGGGTGG - Intronic
903925137 1:26826634-26826656 GCCGCGGCGGGCGGTGGCGGCGG + Intergenic
904472791 1:30746306-30746328 GGCCCTGGGGTGGCTGGGGGTGG - Intronic
904778267 1:32925114-32925136 CCCGCGGGGGTCCCTGGGGGAGG + Intergenic
904942751 1:34176854-34176876 GCCGGTGGGGTGGGTGGGGGTGG - Intronic
905387223 1:37613285-37613307 GCCCCAGAGGTGGCTGGTGGCGG - Intronic
905653584 1:39672082-39672104 GACGCGGAGGTGGCTGGGGCTGG + Intergenic
905960072 1:42035843-42035865 GATGCCGGGGTGGCGGGCGGCGG + Intronic
906191710 1:43903363-43903385 GCAGTGGGGGAGGCTGGCAGAGG - Intronic
907160549 1:52366005-52366027 ACCGCGGGGGTAGATGGAGGCGG - Intronic
907766875 1:57421900-57421922 GGCGGGGGGGGGGGTGGCGGGGG + Intronic
907962471 1:59296583-59296605 GCCGCGGGGTGGGCAGGCGACGG + Intergenic
908380517 1:63593439-63593461 GCGGCGGACTTGGCTGGCGGAGG - Intronic
911696565 1:100895999-100896021 GCGGAGGGCGTGGCTTGCGGCGG - Intergenic
912212581 1:107570988-107571010 TCCACGGGGCTGGCGGGCGGGGG + Intergenic
913963103 1:143354173-143354195 GCCCCGGGGGTGGCTGCCGTCGG - Intergenic
914057459 1:144179759-144179781 GCCCCGGGGGTGGCTGCCGTCGG - Intergenic
914121687 1:144786607-144786629 GCCCCGGGGGTGGCTGCCGTCGG + Intergenic
914702822 1:150149950-150149972 GCCGGGCGGGCGGGTGGCGGGGG + Intronic
914803165 1:150974766-150974788 GCGGCGCCGGCGGCTGGCGGAGG - Exonic
915912723 1:159924591-159924613 GTCGTGGGGGTGGGGGGCGGCGG - Intronic
917846676 1:179025971-179025993 GCGGCGGCGGCGGCTGGGGGCGG + Exonic
918265676 1:182839554-182839576 GCGGCGGCGGCGGCTGGGGGTGG + Intronic
918780215 1:188690459-188690481 GCCGGGGGGGTGGGGGGAGGGGG - Intergenic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
919872030 1:201829178-201829200 GCCGCGGGGCTGGCGGGCTGAGG + Exonic
919916971 1:202144776-202144798 GCCGCGAGGGAGGGCGGCGGCGG - Intergenic
920795307 1:209131110-209131132 GCAGCGGTGGTGGCGGGCGGGGG + Intergenic
922351400 1:224737211-224737233 GCTGCGGGGGTGGGAGGGGGTGG + Intronic
922775395 1:228212175-228212197 GCCGCGTGGGTGGCTCCCCGAGG + Exonic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923299739 1:232630153-232630175 GCCGCTGGGCGGGCGGGCGGTGG - Intergenic
924289731 1:242524729-242524751 GCGGCGGGGGTGGGGTGCGGTGG + Intergenic
924511206 1:244730462-244730484 GCGGCGGGGCTGGCGCGCGGGGG + Intergenic
924754868 1:246931746-246931768 GCCGGGGAGGTCGCAGGCGGCGG - Intronic
1062932681 10:1363287-1363309 GCCGCGGGGGTGGCGGGGGTCGG + Exonic
1063200966 10:3785246-3785268 GCGGAGGGGGAGGCTGGCAGCGG - Exonic
1064028803 10:11869990-11870012 GCCGCGGGGGACGCCGGCGAGGG + Exonic
1064176489 10:13079810-13079832 GCAGCGTGGGTGGCTGGCAGAGG + Intronic
1064254042 10:13729088-13729110 GCCGCGGGGGCGGGCGGGGGCGG - Intronic
1064274258 10:13891963-13891985 GCGGCGGCGGTGGCGCGCGGTGG - Intronic
1065712822 10:28533488-28533510 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1065845134 10:29737035-29737057 GCCGAGGGGGTGGGTGGCGCCGG - Intergenic
1067175581 10:43943455-43943477 GACGTGGGGGTGGCTGGGTGGGG + Intergenic
1067708362 10:48627795-48627817 GCCTCTGGTGTGGCTGGCTGAGG + Intronic
1067769898 10:49115540-49115562 GGCCCGGGGCGGGCTGGCGGCGG - Intergenic
1068144577 10:53051241-53051263 GGCGGGGGGGTGGTTGGGGGTGG - Intergenic
1068560812 10:58512876-58512898 CGCGCGGGCGTTGCTGGCGGGGG + Intergenic
1069486549 10:68827501-68827523 TCCGCGGCGCTGGCTGCCGGGGG - Intergenic
1070785901 10:79162142-79162164 GCCACGGGGCTGGCGGGAGGTGG + Intronic
1073147811 10:101292057-101292079 CCCGCGGGGGCGGGAGGCGGTGG - Intergenic
1073250978 10:102120191-102120213 GCAGCGGGGGCCGCGGGCGGCGG - Exonic
1073503897 10:103967244-103967266 GCCGCGGGAGCGGACGGCGGCGG + Exonic
1073812347 10:107164641-107164663 GCCGCGGTGGGGGCGGGCGGAGG + Intergenic
1073921668 10:108466372-108466394 GCCGCGGTGGGGGCGGGTGGAGG + Intergenic
1073959807 10:108912644-108912666 GTCGGGGGGGTGGGGGGCGGGGG + Intergenic
1074095202 10:110305262-110305284 GCGGTGGTGGTGGGTGGCGGGGG + Intergenic
1076146587 10:128126641-128126663 CCGGCGAGGGCGGCTGGCGGAGG + Intergenic
1076351145 10:129816046-129816068 GCAGTGGTGGTGGCTGGCAGAGG - Intergenic
1076692437 10:132230662-132230684 GCTGGGGGGGAAGCTGGCGGGGG + Intronic
1076710599 10:132331882-132331904 TGCGCGGGGGTGGCAGGGGGTGG - Intergenic
1076723940 10:132404791-132404813 GGGGCGGGGGTGGCTCGGGGCGG - Exonic
1076888345 10:133272636-133272658 GCAGGGAGGGTGGGTGGCGGAGG + Intronic
1076985987 11:236387-236409 GGGGCGGGGGTGGGAGGCGGAGG - Exonic
1077052075 11:571498-571520 GGGGCAGGGGTGGCTGGAGGAGG - Intergenic
1077120219 11:903964-903986 GCCAGGGGGGTGGCAGGCAGTGG - Intronic
1077292429 11:1804136-1804158 GCGGCGGGTGTGGAGGGCGGCGG + Intergenic
1077292447 11:1804186-1804208 GCGGCGGGTGTGGAGGGCGGCGG + Intergenic
1077292453 11:1804202-1804224 GCGGCGGGTGTGGAGGGCGGCGG + Intergenic
1077292471 11:1804252-1804274 GCGGCGGGTGTGGAGGGCGGCGG + Intergenic
1077292477 11:1804268-1804290 GCGGCGGGTGTGGAGGGCGGCGG + Intergenic
1077292483 11:1804284-1804306 GCGGCGGGTGTGGAGGGCGGCGG + Intergenic
1077360670 11:2139036-2139058 GCCGGGGGGAGGGCTGGAGGGGG + Intronic
1077361176 11:2140732-2140754 GCCGCCGGGGAGGCCGGCGTGGG - Intronic
1077383975 11:2260388-2260410 GCTGAGGGGGTGGCTGCCAGGGG + Intergenic
1077465466 11:2731747-2731769 GCCTCCTGGGTGGCTGGCAGAGG - Intronic
1077635892 11:3841071-3841093 GCCGGGGGCGAGGCTGGGGGCGG - Intergenic
1079290560 11:19184542-19184564 GCAGAGGGGGTGACTGGAGGAGG - Intronic
1080012422 11:27472317-27472339 GCCGCGGGAGAGGCCGGCGCGGG - Exonic
1080503773 11:32893174-32893196 GCGGCGGGGGGCGCGGGCGGCGG - Exonic
1082795735 11:57376641-57376663 GGCCCGGTGGGGGCTGGCGGCGG - Intergenic
1083672188 11:64305760-64305782 GCCGCGGGGGTGGGCGGGCGGGG + Intronic
1083764182 11:64834219-64834241 GCCGCGGGGGAGCCTGGCTCCGG + Intronic
1083841318 11:65306057-65306079 GCCCTGGTGGTAGCTGGCGGAGG - Intergenic
1083861456 11:65422453-65422475 GCTGGGGGCGTGGCGGGCGGGGG - Intergenic
1083862836 11:65433871-65433893 GCCTAGGGGGTGGCAGGAGGCGG - Intergenic
1083989629 11:66238993-66239015 GCTGCGGTGGTGGCTGGGGGAGG + Intronic
1084371913 11:68750669-68750691 GCGGCGGGGCGGGATGGCGGGGG + Exonic
1084433971 11:69127246-69127268 GCCGGGTGGGTGGGTGGGGGGGG + Intergenic
1084463506 11:69309102-69309124 CCCGTGGGGGTGGGTGGCTGTGG + Intronic
1084492983 11:69488447-69488469 GCAGCTGGGGTGGCGGGAGGGGG - Intergenic
1084843734 11:71882369-71882391 GGCGTGGTGGTGGCTGGCTGAGG - Intronic
1085013496 11:73157591-73157613 GCCCCGGGGTGGGCAGGCGGGGG - Intergenic
1088808212 11:113370719-113370741 GAGGCTGGGGTGGCTGGCAGAGG - Intronic
1089253634 11:117182019-117182041 GCTCCGGGGGTGACTGGTGGGGG + Intronic
1089262639 11:117232892-117232914 GACGGGGGGGTGGCTGGCAGCGG + Intronic
1089288051 11:117420222-117420244 GCCGCAGTGGTGGCTGGTGGTGG + Intergenic
1089346410 11:117794660-117794682 GCCGCGGGGGTGACTGGCAACGG + Intronic
1090699176 11:129279234-129279256 GCGGCGGCGGCGGCGGGCGGAGG - Intronic
1090832873 11:130431277-130431299 GCGGCGGTGGTGGGTGGTGGGGG - Intergenic
1091001033 11:131910913-131910935 GGCGCAGGGGTGGCGCGCGGAGG - Intronic
1091230051 11:133982347-133982369 GCCTCGGGGATGGCTGGACGGGG + Intergenic
1091399731 12:174725-174747 CCCGGGGGCGTGGGTGGCGGCGG - Exonic
1091434231 12:460572-460594 GGCGCGGGGGTGGGCGGCGGCGG + Intronic
1091488091 12:908838-908860 GCTGAGGGGGTGGGTGGGGGTGG + Exonic
1091802598 12:3334025-3334047 GCCGAGGGCCTGGCTGGCCGTGG - Intergenic
1091915659 12:4270658-4270680 GGCGCGGGGGTGGGGGGCGGCGG - Intergenic
1092020705 12:5200070-5200092 GCTGGGTGGGTGGCTGGGGGAGG + Intergenic
1092180670 12:6444650-6444672 GACGGGGGGGTGGGTGGGGGGGG + Intergenic
1092754718 12:11752622-11752644 GGGGCGGGGGTGGCAGGCAGTGG + Intronic
1093894520 12:24562061-24562083 TCCCCGGGGGCGGCTGGCCGGGG - Intergenic
1095752940 12:45730220-45730242 GCTGGGGGGGTGGCCCGCGGGGG + Intronic
1095758720 12:45802064-45802086 GTCTCGGGGGTGGGTGGGGGTGG - Intronic
1096495561 12:52037451-52037473 GCTGCCGGGGTGGCGGGAGGTGG + Intronic
1096501134 12:52064357-52064379 GCAGCTGGGGTGGCTTGCAGGGG + Intergenic
1096660817 12:53122998-53123020 GCCGGGCGGGGGGCTGGAGGTGG + Intronic
1097014362 12:55974535-55974557 GCCCCGGGGGTGACTGGGGCTGG + Intronic
1097046257 12:56189542-56189564 GCCGCGGCGGCGGGAGGCGGCGG - Exonic
1097166476 12:57088994-57089016 GCTGCCGGGCTGGCGGGCGGAGG - Exonic
1097173116 12:57128460-57128482 GCCGAGGGGGGGGCTGATGGGGG - Intronic
1101606072 12:106248198-106248220 GGCGCGGGGGTGGCTGGGCGCGG + Intronic
1101967595 12:109291918-109291940 GCCGGAGGGGTGGCAGCCGGGGG - Intronic
1101967603 12:109291933-109291955 GCCGGAGGGGTGGCGGCCGGAGG - Intronic
1101967610 12:109291948-109291970 GCCGGAGGGGTGGCAGCCGGAGG - Intronic
1103561129 12:121793741-121793763 GCCGGGAGGCTGCCTGGCGGAGG - Exonic
1103563388 12:121804045-121804067 GCCCGGGAGGCGGCTGGCGGCGG - Intergenic
1103563617 12:121804764-121804786 GCGGCGGGGGCTGCTGGTGGTGG - Exonic
1103595423 12:122022198-122022220 GCCGGGGAGGCGGCTGGCGGCGG - Intronic
1103604862 12:122078971-122078993 GCCGCGCCGGAGGCGGGCGGCGG - Exonic
1103731078 12:123028154-123028176 GCCGAGGGAGTGGCCGGAGGTGG - Intronic
1103920943 12:124398892-124398914 GCCTTGGGGTTGGCTGGAGGTGG + Intronic
1104700796 12:130902783-130902805 GCCACGGGGGAGGTGGGCGGAGG - Intergenic
1104836832 12:131797272-131797294 GCCGCGGGGGCCGCGGGCCGGGG - Exonic
1104949677 12:132433779-132433801 CCCGCGGGTGTGGCAGGCTGGGG + Intergenic
1105031567 12:132887649-132887671 GCCCCGCGATTGGCTGGCGGCGG + Intronic
1105411838 13:20177455-20177477 GGCGCACGGGTGGCAGGCGGCGG - Intergenic
1105943548 13:25171212-25171234 GCGGCGGGGGCGGCGGGGGGCGG - Exonic
1105956411 13:25287342-25287364 CCCGCGGCGCTGGCTGGTGGAGG - Exonic
1106478023 13:30114788-30114810 GCCGCGCGGGCGGCTGCGGGAGG + Intergenic
1106549652 13:30760264-30760286 GGAGGGGGGGTGACTGGCGGGGG + Intronic
1106956398 13:34942881-34942903 GCCGTCGGGGCCGCTGGCGGAGG + Exonic
1107468143 13:40667087-40667109 GGCGCGGGGTGGGCGGGCGGAGG + Intergenic
1107624868 13:42272103-42272125 GCCGCGGGGCTGGGAGGGGGAGG + Intergenic
1109789845 13:67231204-67231226 GCCGCGGCGGTGGATCGTGGCGG + Intergenic
1110630018 13:77697605-77697627 GCCGAGGGGGCGGGTGGGGGGGG - Intergenic
1112402114 13:99086465-99086487 GCAGCGGGGGGAGCAGGCGGCGG - Intronic
1112652766 13:101416519-101416541 GCCGCCGGGCAGGCTGGGGGAGG + Intergenic
1113656885 13:112072982-112073004 GCGGTGGGAGTGGATGGCGGGGG - Intergenic
1113768394 13:112894459-112894481 GGCGCGGGGGTGACGGGAGGGGG + Intronic
1114270684 14:21098349-21098371 GCGGCGGCGGCGGCGGGCGGCGG + Exonic
1114519157 14:23321889-23321911 GGCGAGCGGGTGGCAGGCGGGGG + Intronic
1116457317 14:45134447-45134469 GCAGCGGGGGAAGATGGCGGCGG - Exonic
1116916586 14:50532067-50532089 GCCGCGGGGTGAGCTGGCGGGGG - Exonic
1118186455 14:63542846-63542868 GCCGCAGCGGGGGCGGGCGGCGG + Exonic
1118836987 14:69484656-69484678 GCCGGGGGGGTGGGTGGCTAGGG + Intergenic
1119539251 14:75428061-75428083 GCGACGGGGGGCGCTGGCGGCGG + Intronic
1120505791 14:85352727-85352749 CCCGACGGGGTGGCTGCCGGGGG + Intergenic
1121447361 14:93987576-93987598 GCCCTGGGAGTGGCTGGCGTGGG + Intergenic
1122073070 14:99217795-99217817 GACGGGGTGGTGGCAGGCGGCGG - Intronic
1122143369 14:99675226-99675248 GCCGGAGGGGCGGCGGGCGGCGG + Exonic
1122145339 14:99685308-99685330 GCTGCGGGGGGGGCGGGGGGAGG - Intronic
1122221239 14:100240070-100240092 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1122486758 14:102087136-102087158 GCCGCGGCGGCGGCTGGGGAGGG - Intronic
1122620952 14:103057445-103057467 GCCGCGGGCGGGGCTGAGGGCGG - Exonic
1122717331 14:103703492-103703514 GCCCCGGAGGTGGCTGCCAGTGG - Intronic
1122920458 14:104877828-104877850 GCTGCGCGGGTGGGTGGCTGTGG - Intronic
1122959450 14:105087756-105087778 GGCGCGGGGCGAGCTGGCGGGGG + Intergenic
1123031380 14:105453202-105453224 GCTGCGCGGGTGGCGGCCGGCGG + Intronic
1124375494 15:29126526-29126548 GCCGCAGGGGACGCTGGCGTGGG + Intronic
1124624971 15:31302571-31302593 GCCCCAGGTGTGGCTGGCAGAGG + Intergenic
1125679450 15:41521846-41521868 GCAGCATGGGTGGCTGGCAGTGG + Exonic
1126063874 15:44810343-44810365 GCGGCGGGGGTGGGGGGGGGGGG - Intergenic
1126090707 15:45048774-45048796 GCAGCGGGGGTGGAGGGAGGGGG + Intronic
1126777542 15:52112590-52112612 GCCTCGGGCGTGGATGGCGCCGG + Exonic
1127763601 15:62164518-62164540 GCCGCGGGGGTGGCCGGGCCCGG + Exonic
1127922379 15:63504085-63504107 GCCCCGGGGGAGGCGGGCAGCGG - Intergenic
1128374791 15:67066738-67066760 GCCGCGGGGGCGGGAGGCGGCGG - Intronic
1129739214 15:77981889-77981911 GCAGCTGGGTTGGCAGGCGGGGG - Intergenic
1129985930 15:79919795-79919817 GCCGCGGGGAGGGGGGGCGGGGG - Intronic
1130363119 15:83208250-83208272 GCCGCGGAAGTGGCTGGCTGGGG - Intergenic
1130676927 15:85961036-85961058 GCAGCGGGGGTCCCTGGCTGGGG + Intergenic
1131144351 15:90001696-90001718 GGCGCGGGGGTGGGTCGCTGCGG + Intronic
1131158897 15:90091673-90091695 GCCCCTGGGGAGGCTGGAGGGGG + Intronic
1131269016 15:90935355-90935377 ACCCCGGGGGTGGCCGGCCGGGG - Exonic
1132074689 15:98810133-98810155 GGTGTGGGGGTGGCTGGCGGAGG + Intronic
1132338908 15:101065823-101065845 GCCGTGTGGCTGGCTGCCGGGGG - Exonic
1132339599 15:101069490-101069512 GCCTCTGGGCTTGCTGGCGGTGG - Exonic
1132588709 16:717150-717172 ACAGCGGCGGTGTCTGGCGGAGG - Exonic
1132675088 16:1118199-1118221 GCGGTGGGGGTGGCTGAAGGTGG - Intergenic
1132683445 16:1153016-1153038 GCCGGGGGCGGGGCGGGCGGGGG - Intergenic
1132885107 16:2179055-2179077 GCGGCGGCGGCGGCTCGCGGGGG + Exonic
1134696983 16:16232527-16232549 TGCGCGGCGGCGGCTGGCGGCGG + Exonic
1135419755 16:22297755-22297777 GCCGCGGCCGACGCTGGCGGCGG + Intronic
1135517610 16:23148924-23148946 GGCGCGGGAGAGGCGGGCGGCGG + Exonic
1135572202 16:23557774-23557796 GCGGCGGGGGTGGCGGGCGCCGG + Intronic
1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1136381294 16:29897085-29897107 GCCGGAGGGGTGGCTAGCGTGGG + Exonic
1136519498 16:30786826-30786848 AGCGCGGGGGTCGGTGGCGGGGG - Intronic
1136519517 16:30786874-30786896 GCCGGGGTGGGGGCGGGCGGGGG - Intronic
1136568383 16:31083015-31083037 GTCGTGGGGGTGGGTGGAGGGGG - Exonic
1137645096 16:50066568-50066590 GACGCGGGGGAGGCCAGCGGTGG - Intronic
1137665392 16:50246343-50246365 GCCTCGCGGGTGCCCGGCGGTGG + Intronic
1138360613 16:56424964-56424986 CCCTCGGGGGTCCCTGGCGGAGG + Intronic
1139410088 16:66751778-66751800 GCCGCCGAGGTGGCGGGCGGCGG + Exonic
1140055892 16:71525390-71525412 GTTGCGGGGGTGGGTGGCGGTGG + Intronic
1140223238 16:73058648-73058670 GCAGCAGCGGCGGCTGGCGGGGG + Intronic
1141442239 16:84036953-84036975 GCCCGAGGGGTGGCTGGCTGGGG - Intronic
1141785334 16:86196154-86196176 GCCGCAGGGCTGGCTGGGGAGGG + Intergenic
1141786117 16:86201894-86201916 GCTGGGTGGGTGGCTGGGGGAGG + Intergenic
1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1142200156 16:88757302-88757324 GCAGGGGGCGTTGCTGGCGGGGG + Intronic
1142349820 16:89574989-89575011 GCCACGGGGGTGGGGGGCGAGGG - Intergenic
1142395415 16:89828788-89828810 GCCGCGGGTGAGGCCGGGGGCGG + Exonic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142713075 17:1733790-1733812 ATCTCGGGGGTGGGTGGCGGGGG + Exonic
1143514760 17:7414122-7414144 GCCGCGGGGAAGGCTGGCAGAGG + Intronic
1145014402 17:19387228-19387250 GGGGCTGGGGCGGCTGGCGGGGG - Intronic
1146332267 17:31937206-31937228 GCCCGGCGGGTAGCTGGCGGGGG + Exonic
1146339655 17:32007830-32007852 GGCGCGGGGCGGGCCGGCGGCGG - Intergenic
1146398660 17:32487297-32487319 GCAGCGGCGGCGGCGGGCGGGGG + Intronic
1146968598 17:37054165-37054187 ACAGTGGGGGTGGCTGGTGGGGG + Intronic
1147179103 17:38673831-38673853 GCCTCGGGGGCGGCCGGCGGGGG + Exonic
1147352743 17:39864313-39864335 ACAGCGGCGCTGGCTGGCGGCGG + Intergenic
1147436203 17:40417742-40417764 CTCGCGGGGGGGACTGGCGGTGG - Intronic
1148059935 17:44829747-44829769 GCCGCGGAGGTGTCGGGCGACGG - Intronic
1148852166 17:50560652-50560674 GCTGCGGGGCTGTCTGGGGGCGG + Intergenic
1148909226 17:50931648-50931670 GCCGCGGGGGCCGCAGGAGGTGG + Intergenic
1149475905 17:56960728-56960750 GCCGGGTGGGCGGCGGGCGGGGG - Intronic
1149552592 17:57551379-57551401 GCCTCGGGGATTGCTGCCGGAGG + Intronic
1149890184 17:60382225-60382247 GCCACTGTGCTGGCTGGCGGAGG - Intronic
1149916418 17:60613892-60613914 GGCGGGGGGGTGGCGGGGGGGGG - Intronic
1150060595 17:62065395-62065417 GCGGCGGGGGCTGCTCGCGGCGG - Intergenic
1150643484 17:66964672-66964694 GCCGCCGGGCGGGCTGGCGGCGG - Intergenic
1150802189 17:68291299-68291321 GCGGCCGGGGTGGGGGGCGGGGG - Intronic
1151780196 17:76240411-76240433 GCCGCCGCGGTGCCCGGCGGAGG - Intergenic
1152093313 17:78258580-78258602 GCCACTGGGCTGGCTGGAGGGGG + Intergenic
1152104160 17:78319108-78319130 GCCTCGCTGGTGGCAGGCGGTGG + Intergenic
1152134594 17:78496450-78496472 ACAGCGGGGGTGGTGGGCGGGGG + Intronic
1152281693 17:79388737-79388759 GCAGGAGGGGTGGCTGGAGGCGG - Intronic
1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG + Exonic
1152353884 17:79797623-79797645 GCGGCGCGGGCGGCTGGGGGAGG - Intronic
1152357328 17:79813503-79813525 GCGGCGGGGGCGGCGGGCGCGGG + Intergenic
1152360880 17:79832525-79832547 GCTGCCGGGGTGGGGGGCGGGGG - Intergenic
1152362494 17:79839153-79839175 GGCGCGGGGGCGGCGAGCGGCGG - Intronic
1152363677 17:79843642-79843664 GCGGCGGCGGCGGCGGGCGGTGG - Intergenic
1152461377 17:80444160-80444182 ACCGCGGGGGTGCCGGGAGGAGG + Intergenic
1152637882 17:81437605-81437627 GCCGCGTGGGTGGCTGGGTGTGG + Intronic
1152723665 17:81934897-81934919 ACTGCGGGGGAAGCTGGCGGCGG - Intronic
1152773831 17:82187660-82187682 GGCGCGGGGGAAGCTGGCAGGGG + Intronic
1152773841 17:82187682-82187704 GTTGCGGGGGGTGCTGGCGGGGG + Intronic
1152801799 17:82334104-82334126 GCCGCGGGGAGGGAGGGCGGGGG + Intergenic
1153265259 18:3262626-3262648 GCCGCGGCGGGTCCTGGCGGTGG + Exonic
1153596451 18:6729919-6729941 GCTGAGCGGGTGGCTGGCTGCGG - Intronic
1153900539 18:9614332-9614354 GGCGGGGGGGAGGCGGGCGGGGG - Intronic
1154954819 18:21242885-21242907 GCCGCGGAGGTGGCGGGGAGAGG + Intronic
1155193757 18:23453640-23453662 GCCGCGGGGGTGCCGGGATGGGG + Intronic
1155221464 18:23689671-23689693 CCCGCGCGGCTGGATGGCGGCGG + Exonic
1155954007 18:31942444-31942466 GCTCCGGGGGCGGCTGGAGGAGG - Intronic
1157622141 18:49022838-49022860 GCCTCGGGGGTGGGTGGTGCAGG - Intergenic
1157867315 18:51197559-51197581 GCGGCGGGGCGGGCTGGTGGAGG + Intronic
1158366736 18:56744925-56744947 GCCATGGGAGTGGCTGGCTGAGG + Intronic
1158648149 18:59265456-59265478 GCCGTGGGGCTGGCTGATGGTGG + Intergenic
1160242352 18:77132769-77132791 GCGGCGGCGGTGACTGACGGCGG + Exonic
1160412636 18:78685531-78685553 GCCTCTGGGGTGGATGGTGGGGG - Intergenic
1160541910 18:79628528-79628550 GCCGGGGGGAGGGCTGGAGGTGG + Intergenic
1160668347 19:344269-344291 GCCGGGGGGCTCGCGGGCGGCGG + Intronic
1160844904 19:1161902-1161924 GCCGCGGGGGGGGGGGGGGGGGG + Intronic
1160861230 19:1237967-1237989 GCAGCGGGGGCGGCGGGCCGGGG - Exonic
1160879467 19:1312961-1312983 GGCGGGTGGGGGGCTGGCGGCGG - Intergenic
1160901806 19:1432573-1432595 GCCCCGGGAGTGGCTGGTGGAGG - Exonic
1160903099 19:1438902-1438924 GCCGCGGGGGTCGCGGGCAGGGG + Intronic
1160967892 19:1754517-1754539 GCCGCTGGGCGGGCTGGCGGCGG + Exonic
1160979591 19:1810927-1810949 GCGACCAGGGTGGCTGGCGGGGG - Intronic
1161050916 19:2163820-2163842 GCCGAGGGGGTGGCGCGCGCGGG + Intronic
1161241154 19:3224696-3224718 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1161702936 19:5804997-5805019 GCCGGGGGCGGGGCTGGGGGCGG - Intergenic
1161752924 19:6110542-6110564 TGCGCGAGGCTGGCTGGCGGCGG - Intronic
1161959532 19:7516154-7516176 CCGGCGGGGCTGGCGGGCGGGGG + Exonic
1161976801 19:7611828-7611850 GCTCCGGGGGTGGCTGGGTGGGG - Exonic
1162159701 19:8702678-8702700 GCGTGGGGGGTGGGTGGCGGGGG - Intergenic
1162381235 19:10333181-10333203 TGCGCGGGGGTCGTTGGCGGGGG - Intronic
1162697103 19:12484825-12484847 GCCGCCGGGAAGGCGGGCGGAGG - Intronic
1162938437 19:13993734-13993756 GCCGCTGGGGGTGGTGGCGGTGG + Exonic
1163321534 19:16577532-16577554 GGCGCTGCGGGGGCTGGCGGGGG - Exonic
1163655600 19:18543353-18543375 GCCGCGGGGGTGGCGAGCCGGGG - Intronic
1163672562 19:18637306-18637328 ACTGAGGGGGTGGCTGGAGGGGG + Intronic
1164147142 19:22518965-22518987 GCCCTGGTGGTGGCTGGGGGAGG + Intronic
1164159490 19:22617364-22617386 GCCCTGGTGGTGGCTGGGGGAGG - Intergenic
1164179679 19:22807603-22807625 GCCGTGGGGCTGGCTGGGGCCGG - Intergenic
1164693628 19:30227863-30227885 GGCGCGGAGGGGGCCGGCGGAGG + Intergenic
1165095555 19:33407928-33407950 GGCCCGGGGGTGGCTGGCTGGGG + Intronic
1165122591 19:33570227-33570249 GCCACGGGGCTGGCAGGTGGGGG - Intergenic
1165157271 19:33796253-33796275 GCCGCGTGGCCGGCCGGCGGGGG + Intronic
1165157715 19:33797989-33798011 GCCGCGGGGCGGGGTGGCCGCGG - Intronic
1165168668 19:33875176-33875198 GCCGGGGGTGTTGCTGGCAGCGG + Intergenic
1165903354 19:39178884-39178906 GCAGTGGGGGTCGCTGGGGGTGG + Exonic
1166721801 19:45001424-45001446 GCCGGGCGGGCGGCGGGCGGGGG - Exonic
1166883054 19:45940557-45940579 CCCGCCGGGCTGGCTGGCGTGGG - Exonic
1167001038 19:46746034-46746056 GCCGCCGGGACGGCCGGCGGGGG - Exonic
1167146048 19:47681214-47681236 GCCGTGGGGGTGGCAGAGGGCGG - Exonic
1167146263 19:47682066-47682088 GCGACGGGGGTGGCTGGGGCTGG - Exonic
1167249778 19:48393747-48393769 GCTGCGGGCGAGGGTGGCGGCGG - Intergenic
1167333127 19:48868630-48868652 GCAGCGTGGGCGGCTGGCAGAGG - Exonic
1167424378 19:49422575-49422597 GCCGCGGAGGAGCCTGGCGCTGG - Exonic
1168076318 19:53982526-53982548 GCCGCGGGGCTGGCGGGGGCCGG + Exonic
1168257220 19:55173593-55173615 GCCGTGGGGGCGGCCGCCGGCGG - Exonic
1168277106 19:55284393-55284415 GCCGCAGGGGGGGCGGCCGGGGG + Exonic
1168277793 19:55286746-55286768 GGCCAGGGGGTGGCTGGCAGAGG + Intronic
1168281588 19:55308783-55308805 GCGGGGGGCGTGGGTGGCGGGGG + Intronic
1168281596 19:55308799-55308821 GCGGGGGGCGTGGGTGGCGGGGG + Intronic
1168281604 19:55308815-55308837 GCGGGGGGCGTGGGTGGCGGGGG + Intronic
1202696941 1_KI270712v1_random:132432-132454 GCCCCGGGGGTGGCTGCCGTCGG - Intergenic
926130965 2:10302910-10302932 GCCGCGGCGGCGGCGGGCAGCGG + Intronic
926422950 2:12716873-12716895 GTCGCGGGGGCGGCGGGGGGGGG + Exonic
927180626 2:20444591-20444613 GCCGGGGCGGTGGGGGGCGGGGG - Intergenic
927638861 2:24834425-24834447 GCTGCGGTGGTGCCGGGCGGGGG - Intronic
927772814 2:25878369-25878391 GCGGCGGGGGTGGTGCGCGGGGG + Intronic
927811769 2:26184437-26184459 GCCGCGGGAGGCACTGGCGGCGG + Exonic
927847813 2:26480396-26480418 GCCGTGGGGGTGGATGGTGGGGG + Intronic
927943272 2:27118923-27118945 GGCCCGGGGGAGGCTGGCGGCGG - Exonic
929050332 2:37831153-37831175 GCCGTGGGGGAGGATGGCAGAGG - Intergenic
929083626 2:38146750-38146772 GCTGCGGGGGTGGCGGGAGAAGG - Intergenic
929305705 2:40358972-40358994 GGTGCGGGGGTGGATGGGGGTGG + Intronic
931321445 2:61177612-61177634 GGCGCTGGCGCGGCTGGCGGCGG + Exonic
932028359 2:68157849-68157871 GCTGCAGGGGTGGTTGGCTGAGG + Exonic
932209553 2:69915484-69915506 GCTCCGGGGGTGGTTGGAGGCGG + Intronic
932699581 2:73984258-73984280 GGCGCGGGGGAGGCTGGTGATGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933810090 2:86027744-86027766 GGAGCGGGGGCGGCTGGAGGGGG - Intronic
934063891 2:88321727-88321749 GCCACAGGGGCTGCTGGCGGGGG - Intergenic
934079120 2:88452462-88452484 GCGGCGGTGGCGGCGGGCGGGGG + Exonic
934278101 2:91589446-91589468 GCCCCGGGGGTGGCTGCCGTCGG - Intergenic
934761890 2:96861120-96861142 GGGGCTGGTGTGGCTGGCGGTGG - Exonic
934906990 2:98213663-98213685 GGCTTGGGGGTGGCTGGTGGAGG + Intronic
935361625 2:102250791-102250813 GCCGCGTGGGTGGCTGGGCGGGG + Intergenic
935592545 2:104855583-104855605 GACGCGGCAGGGGCTGGCGGCGG + Exonic
935692634 2:105744928-105744950 GCCGAGCGGGCGGCGGGCGGAGG + Exonic
937950838 2:127387344-127387366 GCCGGGAGGGGGGCTGGCGGCGG - Intronic
938469184 2:131544004-131544026 GTGGCGGGGGTGGTGGGCGGGGG + Intergenic
940140412 2:150486249-150486271 GCCGCGGGGGTGATGGGAGGCGG - Intronic
940883529 2:158969217-158969239 GGCGCGGGGGAGGCGGGGGGAGG + Intronic
941273472 2:163460168-163460190 GCCGCGGAGTGGGGTGGCGGGGG - Intergenic
942919492 2:181354226-181354248 GCAGCGGTGGTTGCTGGTGGAGG + Intergenic
944766707 2:202871688-202871710 GGCGCGGGGCTCGCGGGCGGTGG - Intronic
945225916 2:207530588-207530610 GCCGGGGGCGAGGCGGGCGGCGG - Intronic
946228808 2:218279210-218279232 GCTGGGGGTGTGGGTGGCGGTGG - Intronic
946412640 2:219522740-219522762 GCCGCCGCGGGGGCGGGCGGCGG + Intronic
946875565 2:224126220-224126242 GCCGAGGGCGTGGCTGGCTGAGG + Intergenic
947635978 2:231680990-231681012 ACCGCGGCGGGGGCAGGCGGCGG + Intergenic
947702659 2:232247612-232247634 GCCGCGGGGGGGGGGGGGGGGGG + Intronic
948909554 2:240996265-240996287 GCCTGGGGCGTGGCTGGCAGTGG - Intergenic
1168878217 20:1185429-1185451 GCCGCTGGGGAGGCGGGGGGGGG + Intronic
1169139840 20:3221565-3221587 GTCCCGGGTGTGGCTGGCGAGGG + Intronic
1170150425 20:13221477-13221499 GCCCCGGCGCTGCCTGGCGGCGG - Intergenic
1170969088 20:21101864-21101886 CACGCGGGGGTGGTTGGGGGCGG + Intergenic
1171416288 20:24982836-24982858 GCGTCAGGGGTGGGTGGCGGGGG - Intronic
1172428597 20:34872806-34872828 GGCGCGGGCGAGGATGGCGGCGG - Exonic
1172587282 20:36093506-36093528 GCCTGGGCGGTGGGTGGCGGCGG + Intronic
1172618743 20:36306518-36306540 GGCGCGGGGGTGGCGCGCGGCGG + Intronic
1172781991 20:37442147-37442169 GCAGTGGGGGTGGCAGGCAGAGG - Intergenic
1172910823 20:38407688-38407710 CCCGATGGGGCGGCTGGCGGGGG - Intergenic
1173210750 20:41029494-41029516 GGCGCGGGGGAGGCGGCCGGCGG - Intronic
1173279730 20:41617971-41617993 GCCGCGGGCCTGGCGGGCGGGGG - Intronic
1174579728 20:51563015-51563037 GCCACGGAGCTGGCTGGCCGCGG - Intergenic
1175112231 20:56656733-56656755 GCAGCTGGGCTGGCTGGTGGAGG + Intergenic
1175561320 20:59933329-59933351 GCGGCGAGGGTGGCTCGCGCAGG - Intronic
1175809170 20:61848301-61848323 GCCACGTGGGTGGCTGGGGCAGG - Intronic
1175847108 20:62065008-62065030 GCGGCGGGGGCGGCGGGCGCGGG + Exonic
1175916239 20:62427323-62427345 GCCGCGGGGGTGGGTGGGACTGG - Intronic
1176024976 20:62981304-62981326 GCTTCTGGGGTGGCGGGCGGTGG + Intergenic
1176157016 20:63627009-63627031 GCTGCGGCGGCGGCGGGCGGCGG + Intronic
1176159067 20:63639430-63639452 GCTGTGGGTGGGGCTGGCGGGGG - Intergenic
1176234904 20:64049607-64049629 GCCGGGAGGGCGGATGGCGGTGG + Exonic
1176234937 20:64049688-64049710 GCGGCGGGGCGGGCGGGCGGGGG + Intergenic
1176550167 21:8217364-8217386 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1176569095 21:8400402-8400424 GCGGCGGCGGCGGCAGGCGGCGG + Intergenic
1176577009 21:8444634-8444656 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1178954740 21:37012031-37012053 GACGCTGGGGCGGGTGGCGGAGG - Intronic
1179209345 21:39312940-39312962 GGCGCGGGGGGGGCGGGGGGCGG + Intronic
1179375463 21:40846773-40846795 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1179674905 21:42974745-42974767 GCAGCGGCGGCGGCGGGCGGCGG - Intronic
1179726469 21:43343988-43344010 GCAGCGGGGGAGGCAGCCGGAGG - Intergenic
1179788211 21:43741355-43741377 GGCTCGCGGGGGGCTGGCGGGGG + Intronic
1179998100 21:44983153-44983175 GATGCCGGGGTGGCTGCCGGCGG + Intergenic
1180045023 21:45301331-45301353 GCCACGGGGGTGGCACGAGGCGG - Intergenic
1180095928 21:45555302-45555324 GCGGCGGGGGCGGCGGGGGGCGG + Intergenic
1180123542 21:45770055-45770077 GCCGGGGGGTTGGCAGGTGGCGG + Intronic
1180959239 22:19755249-19755271 ACCGCGGGCGGGGGTGGCGGGGG - Intergenic
1181038586 22:20181537-20181559 GCCATGGGGGAGGCTGGGGGAGG + Intergenic
1181745470 22:24952743-24952765 GGCGCGGCGCGGGCTGGCGGTGG + Intronic
1182355267 22:29719955-29719977 GGCGGGCGGGCGGCTGGCGGGGG + Intergenic
1182355375 22:29720337-29720359 GCCCCGGGGGCGGCTGGAGCGGG - Exonic
1182355468 22:29720604-29720626 GGCGCGGGGGCGGGGGGCGGGGG + Intronic
1182578704 22:31291136-31291158 GCCCCGGGGCTGGCGGGCGGCGG - Intronic
1182741508 22:32571309-32571331 GCAGCGGGAGTGGCTGGCCCTGG + Intronic
1183268919 22:36848869-36848891 GGCGGGGGGGTGGGGGGCGGGGG - Intergenic
1183358773 22:37372752-37372774 GCCGGGGGGCTGGCGGGGGGAGG - Exonic
1183368592 22:37419912-37419934 GCAGGGGCGGGGGCTGGCGGCGG - Intronic
1183410228 22:37650640-37650662 GCCGGGGTGGTGGCTGGGGTGGG - Exonic
1183546044 22:38455322-38455344 GCAGCGGGGGTGGGGGGCGCGGG - Intergenic
1183752220 22:39728052-39728074 GCGGCGGGGGGTGGTGGCGGGGG - Intergenic
1183821124 22:40346681-40346703 GCTGTGGCTGTGGCTGGCGGAGG + Exonic
1184046736 22:41976792-41976814 GCAGCGGCGGCGGCTGGCGGCGG + Exonic
1184129336 22:42508531-42508553 GCCGCGGAGGAGGCTGGCTGGGG + Intergenic
1184139533 22:42570624-42570646 GCCGCGGAGGAGGCCGGCAGGGG + Intronic
1184225796 22:43128262-43128284 GGCGGGCGGCTGGCTGGCGGAGG + Intronic
1184252693 22:43269712-43269734 GCCTTGGGGGTGGCAGGGGGAGG + Intronic
1184277417 22:43417940-43417962 GCAGCGGGGATGGCTGTTGGGGG + Intronic
1184342112 22:43891769-43891791 GGCGCGGGGCTCGCTGGCGCAGG + Exonic
1184361975 22:44024315-44024337 GCCGCGCGTGGGGCCGGCGGCGG - Intronic
1184698022 22:46150543-46150565 GCGGCGGGGGCAGCGGGCGGCGG + Intronic
1184795133 22:46727837-46727859 GCCGCGGGGGTGGCAGGGCCGGG - Intronic
1185055396 22:48576244-48576266 GCCGCGGAGGGGGCGGGCGGGGG - Intronic
1185313868 22:50170557-50170579 GCCGCGGGAGAGGGTGGCAGGGG - Intergenic
1203255062 22_KI270733v1_random:133702-133724 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1203263118 22_KI270733v1_random:178781-178803 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
949987526 3:9552700-9552722 GCGGCGGCGGCGGCTGGCGGGGG + Exonic
950622299 3:14215587-14215609 GCGGTGGGGGTGGCTGGAGCAGG + Intergenic
950702510 3:14760022-14760044 GCGGCTGGGGTGGCAGGCAGTGG - Intronic
951611383 3:24495307-24495329 GCGGTGGCGATGGCTGGCGGCGG - Intergenic
953404656 3:42654471-42654493 GCCTCGGGCGCGGCGGGCGGGGG - Intronic
953903072 3:46854158-46854180 ACCCCGGAGGTGGCTGGAGGTGG + Intergenic
953912188 3:46898828-46898850 GCAGCGGCGGTGGCAGGCGGCGG - Exonic
954301907 3:49704759-49704781 GCCGCAGTGGGGGCAGGCGGTGG + Intronic
954397334 3:50299657-50299679 GCCTGGGGCGGGGCTGGCGGAGG - Intergenic
954437493 3:50503737-50503759 GCCGCGGCGGGGGCGCGCGGGGG - Intronic
954702018 3:52455536-52455558 GCGGCGGGGGCGACGGGCGGCGG + Exonic
955971625 3:64443608-64443630 GCGGTGGGGGTGGGGGGCGGGGG + Intronic
959604512 3:108227431-108227453 GGGGTGGGGGTGGGTGGCGGGGG + Intergenic
960047418 3:113211624-113211646 GCCGCGGGGGCGGCAGCAGGAGG - Exonic
961213280 3:125141709-125141731 GCCGCGGCGGGGGCTTCCGGCGG + Intronic
961446298 3:126983245-126983267 GGCGCGGCGATGGCCGGCGGCGG + Intergenic
962222348 3:133574174-133574196 GCCGCGGGTGCGGCGGGCGGCGG + Exonic
962283841 3:134070854-134070876 GCCGCTGGGGTGGTTCTCGGCGG - Intronic
963827497 3:149970912-149970934 GCGGCGGCGGTAGCGGGCGGCGG + Exonic
964252719 3:154737738-154737760 GGGGCGGGGGTGGGGGGCGGCGG + Intergenic
965530895 3:169769210-169769232 GGGGCTGGGGTGGCTGGGGGTGG - Intronic
965757216 3:172039628-172039650 GCGGCGGCGGCGGCTGGAGGAGG + Intronic
967316236 3:188154179-188154201 GCGGCGGCGGCGGCTGGAGGCGG - Intronic
967858880 3:194137253-194137275 GCCGCGAGGGTGGCGGGCGCCGG + Intronic
967859676 3:194141527-194141549 GCCGCGGGGGGAGCGGGCGGCGG + Intergenic
968056573 3:195696742-195696764 GCCGCGGGGGGGCCGGTCGGCGG + Intergenic
968077946 3:195826636-195826658 GCCCCTGAGCTGGCTGGCGGGGG - Intergenic
968775399 4:2536866-2536888 GGCGCGGGGGCCGCGGGCGGCGG - Intronic
968820195 4:2844096-2844118 GCCGCGGTTGCGGCGGGCGGGGG + Intronic
968950920 4:3690997-3691019 GTCGCGAGGCTGGGTGGCGGTGG - Intergenic
968972572 4:3803662-3803684 GCCGGGTGGGGGGCTGGGGGAGG - Intergenic
969032643 4:4226890-4226912 GTCCCGGGGGTGGCTGCCGTCGG + Intergenic
969412989 4:7042124-7042146 GCCGCTGAGGTGGCTGACCGGGG - Exonic
969599959 4:8170498-8170520 ACGGCGGGAGTGGCTGGTGGAGG + Intergenic
969621245 4:8280015-8280037 GCTGCGGGGCTGCCTGGAGGAGG + Intronic
971279817 4:25233957-25233979 GCGGGGGTGGTGCCTGGCGGAGG + Exonic
972396919 4:38664985-38665007 GCGGCGGGGGGCGCGGGCGGAGG - Intronic
972765810 4:42151767-42151789 GCGGCGGGGGACGCGGGCGGCGG + Exonic
975118536 4:70705072-70705094 CCGGCGGGGGAGGCCGGCGGCGG - Intronic
975997813 4:80336554-80336576 GCAGCGGGGGTAGCTGGGGAGGG - Intronic
976447036 4:85141799-85141821 GCCGAGGGGGTGGGGGGTGGGGG - Intergenic
977809698 4:101346056-101346078 GCCGCGGGGGGCGCGGGAGGCGG - Intronic
980943375 4:139295733-139295755 GCCGCTCGGGAGCCTGGCGGGGG + Exonic
981407120 4:144385003-144385025 GCAGCGGGGGTGTGTGGTGGGGG + Intergenic
983398528 4:167234085-167234107 GCCGCGGCGGTGGCTGCAGCCGG - Exonic
984206481 4:176792810-176792832 GGCGGCGGGGCGGCTGGCGGCGG + Intergenic
984432161 4:179663639-179663661 GACGGGAGGGTGGCTGGCTGGGG - Intergenic
984668008 4:182448851-182448873 GGCGCGGGGCTGGCGGGAGGCGG + Intronic
985718313 5:1475414-1475436 GCCCCAGGTGTGGCTGGCGGAGG - Intronic
986347152 5:6846138-6846160 GCCTCGGGGGTGGCGGGGAGGGG - Intergenic
989368240 5:40679781-40679803 GCCGCAGGGAAGACTGGCGGGGG - Exonic
992080346 5:73230587-73230609 GCCGCGGGGCTGGAGCGCGGAGG + Intergenic
992365449 5:76084691-76084713 CGGGCGGGGGTGGCGGGCGGGGG + Intronic
994947768 5:106417449-106417471 CCGGCGGGGGAGGCCGGCGGCGG + Intergenic
996354645 5:122582061-122582083 GGCAGGGGGGTGGCTGGGGGAGG + Intergenic
997162061 5:131619313-131619335 GCGGCGGGGCTGGAGGGCGGGGG + Intronic
997980589 5:138465512-138465534 GCTGCGGCGGCGGATGGCGGCGG - Exonic
997980789 5:138466304-138466326 GCTGCGTGGGTGGGTGGAGGGGG + Intronic
1001563209 5:172683586-172683608 GCCGCGGCGTCGGCTGGCGGTGG - Exonic
1002051938 5:176576207-176576229 TGGGCGGGGGTGGCTGGGGGAGG + Intronic
1002401726 5:178994875-178994897 GCCGCTGGCGTGGCTGGCGCAGG - Exonic
1002456044 5:179345740-179345762 GCCCCTGGGGTGGCTGGCGGCGG - Intergenic
1002559374 5:180071424-180071446 GGCCCGGGGGCGGCGGGCGGTGG - Intronic
1002618304 5:180468932-180468954 GCCACGGGGGAGGCTGGTGCTGG + Intergenic
1002897953 6:1390035-1390057 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1003125962 6:3356096-3356118 GAGGCGGGGGTGGGTGGAGGCGG + Intronic
1004562123 6:16760985-16761007 GGCGCAGGGGCGGCCGGCGGGGG - Intronic
1004978672 6:20997528-20997550 ACCACGGGGGTGGCGGGGGGAGG + Intronic
1006089619 6:31620774-31620796 GGGGCGGGGGAGGATGGCGGCGG - Exonic
1006180716 6:32151947-32151969 GCGGCGGGGGGGGGGGGCGGGGG + Exonic
1006180723 6:32151960-32151982 GGGGCGGGGGGGGCGGGCGGAGG + Intronic
1006502138 6:34465916-34465938 GCGCCGGGGGTGGCGGGTGGCGG - Intergenic
1006834035 6:36986106-36986128 GCCGCGGGGATGGCGGGAGCCGG - Exonic
1007276162 6:40675542-40675564 GCAGAGGGGGTCGCGGGCGGGGG - Intergenic
1007785105 6:44275378-44275400 GCGGCGCGGGGGGCAGGCGGCGG - Intronic
1008053934 6:46927295-46927317 GCGGCGGGGGTGGGTGGAGGGGG + Intronic
1010141925 6:72622256-72622278 GCGGCGGCGGCGGCGGGCGGGGG + Exonic
1011765120 6:90611414-90611436 GCCCCGAGGGTTGCAGGCGGGGG + Intergenic
1015625828 6:135180864-135180886 GTCGCGGGGGCGGCAAGCGGTGG - Intergenic
1016923181 6:149316981-149317003 CCCGCGGCGGAGGCTGGCGCCGG - Intronic
1018778995 6:167045350-167045372 GCCGCGGGGGGGGCGGGGAGGGG - Exonic
1019283136 7:210559-210581 GCCGCGGGCACGGCTGGGGGAGG + Intronic
1019288262 7:234442-234464 GTATCGGGGGTGGCTGGCCGAGG + Intronic
1019341301 7:510325-510347 GCCCCTGGTGTGGCTGGTGGGGG - Intronic
1019925039 7:4186341-4186363 GCAGCCGGGGTGGGTGTCGGAGG - Intronic
1020140034 7:5606955-5606977 ACCTCGGGGGTGTCTGGCGGTGG + Intergenic
1020264403 7:6550981-6551003 GGCGCGGGGGTGGGAGGTGGGGG - Intronic
1021452781 7:20798069-20798091 GCCGCGGGCGCGGGAGGCGGAGG + Intergenic
1021827921 7:24573283-24573305 GCGGCGGCGGCGGCTGGAGGAGG + Intronic
1021845333 7:24757547-24757569 GCCGCGGGACTGGCCGCCGGAGG + Intronic
1022518118 7:30988499-30988521 GTCCCGGGGCTGGCTGGAGGTGG + Intronic
1024044822 7:45579403-45579425 GCAGCGGGAGGGGCTGGTGGGGG - Intronic
1025069780 7:55887841-55887863 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1025069792 7:55887873-55887895 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1026236931 7:68535121-68535143 GCCGGGGGGGTGGTGGGCGGCGG + Intergenic
1026236943 7:68535140-68535162 GCGGGGGGGGTGGTGGGCGGCGG + Intergenic
1026871159 7:73852798-73852820 GCAGTGGCGGTGGCTGGTGGTGG + Intergenic
1027352699 7:77327818-77327840 GGAGCGGGGATGGCTGGAGGAGG - Intronic
1029168768 7:98616785-98616807 GCCGCGGGGGTGGCTCGCGATGG + Intergenic
1029444593 7:100605052-100605074 GGAGCGGGGGTGGGGGGCGGTGG - Intronic
1029495657 7:100894640-100894662 GCCGCTGGGGGAGCTTGCGGCGG + Intronic
1029746412 7:102517782-102517804 GCCGCAGGGGGGGCGGGCCGGGG + Intergenic
1032279766 7:130491398-130491420 GCAGCGGCGGTGGCTGGAGCGGG + Intronic
1032387485 7:131534509-131534531 GCCACAGGGGTGGCCGGCGGGGG + Intronic
1032581193 7:133105136-133105158 GGGGCGGGGGTGGGTGGAGGGGG - Intergenic
1033299641 7:140175767-140175789 GCTGCGGGGCCGGCTGGCGGCGG - Intronic
1033328480 7:140398477-140398499 GCGGCGGGGGAGGCGGGCAGCGG - Exonic
1034204278 7:149302295-149302317 GCGGCGGAGGTGGGTGGCTGAGG - Intergenic
1034272916 7:149812039-149812061 GGTGTGGGGGTGGCTGGCAGGGG - Intergenic
1034455499 7:151167812-151167834 GGCGCGGCGGCGGCGGGCGGAGG - Intronic
1034911664 7:155002978-155003000 GCCGCGGGGGCCGGGGGCGGGGG - Exonic
1034951287 7:155298349-155298371 CCCGCGGCGCTGGCTCGCGGGGG - Exonic
1035174405 7:157040099-157040121 GCTCCGGGGGGGGCTGGCTGGGG + Intergenic
1036828969 8:12005719-12005741 GGCGTGGTGGTGGCTGGCTGAGG + Intergenic
1036834203 8:12045669-12045691 GGCGTGGTGGTGGCTGGCTGAGG + Intergenic
1036856047 8:12292234-12292256 GGCGTGGTGGTGGCTGGCTGAGG + Intergenic
1037450734 8:19013826-19013848 GCCCCGGGGGCGGAGGGCGGAGG + Intronic
1037977606 8:23224660-23224682 GCGGCGGGGGTGCCTGGCCCGGG - Intronic
1038828453 8:31032874-31032896 GGCGTGGGGGTCGCGGGCGGCGG - Exonic
1041690391 8:60680394-60680416 GTCGCGGGGGGGGGGGGCGGGGG + Intronic
1042580362 8:70270550-70270572 GTAGTCGGGGTGGCTGGCGGGGG + Intronic
1042591570 8:70402976-70402998 GCCCCGGGGGTGGGGGGCGAGGG - Intronic
1042785087 8:72537365-72537387 GCCGCGGGGGCGGAGGGCGGAGG - Intergenic
1044629161 8:94262311-94262333 GCCGCGGCGGCTGCAGGCGGCGG - Exonic
1045222579 8:100213263-100213285 GCGGCGGCGGCGGCGGGCGGCGG + Exonic
1045489101 8:102655763-102655785 GCCGCGGGCGGGGGTGGGGGCGG + Exonic
1046770373 8:118111708-118111730 GCGGCGGCGCTGGGTGGCGGCGG + Exonic
1048214136 8:132480489-132480511 GCGGCGGGGGCGGCTGGCGGCGG - Exonic
1049109795 8:140635645-140635667 GCGGCCGGGGCGGCGGGCGGAGG + Intergenic
1049227705 8:141465666-141465688 GCCGGGGGAGTGGGTGGCTGTGG + Intergenic
1049276958 8:141724795-141724817 GCCACGAGAGTGGCTGCCGGTGG - Intergenic
1049388274 8:142355080-142355102 GCCACCTGGGAGGCTGGCGGTGG - Intronic
1049499220 8:142952560-142952582 GCTGAGGGGGTGGCTGGGGGTGG + Intergenic
1049688746 8:143949729-143949751 GCCGCGGGGGTTGATGGGTGAGG - Intronic
1049710860 8:144062753-144062775 GGCGAGGGGGTGGCTGGGGATGG - Intronic
1049721181 8:144116206-144116228 GCCGCGGGGGCAGCGGGCGCGGG - Exonic
1049762275 8:144336904-144336926 GCGGCGGCGGCGGCGGGCGGGGG + Intergenic
1050170430 9:2810100-2810122 GCGGTGGGGGGGGCTGGCGGGGG + Intronic
1053010233 9:34628797-34628819 GTCGCGGGGATGGAGGGCGGTGG + Intergenic
1053346549 9:37382700-37382722 GCCGTGGGGGTGGCTGACTGTGG - Intergenic
1054440858 9:65258895-65258917 GCCGCGGCGGCGGCGGGGGGGGG + Intergenic
1054489419 9:65762592-65762614 GCCGCGGCGGCGGCGGGGGGGGG - Intergenic
1055030668 9:71769092-71769114 GCAGCGGGGGGCGCTGGCTGGGG - Intronic
1056810188 9:89757921-89757943 GCCTCGTGGGTGGCTGGGGTGGG - Intergenic
1057133423 9:92670144-92670166 GCCGGGGGCGTGGCTTCCGGCGG - Exonic
1057312368 9:93950438-93950460 GGCGGGGGGGTGGCGGGGGGAGG - Intergenic
1057514344 9:95708779-95708801 GCCACGGTGGTGACTGGGGGCGG - Intergenic
1058687263 9:107489698-107489720 GCAGAGGCGGTGGCGGGCGGCGG - Intronic
1060399397 9:123339450-123339472 GCAGCGGGGGTGGAGGGTGGTGG + Intergenic
1060477961 9:123999722-123999744 GCCGCGGCGCGGGCTGGCTGCGG - Intergenic
1060700604 9:125746947-125746969 GCGGCGGCGGCGGCGGGCGGCGG - Intergenic
1060825110 9:126683297-126683319 GCCGCGGGCCGGGCGGGCGGCGG - Intronic
1061283778 9:129611136-129611158 GCCTGGGCGGTGGCTGGTGGGGG - Intronic
1061482069 9:130902298-130902320 GCCGGGGTGGTGGCTGGAGCAGG - Intergenic
1061737356 9:132670503-132670525 GCCGCGGAGGGCGCTGGGGGTGG + Exonic
1061862570 9:133475579-133475601 GCCGTGGCGCTGGCTGGCTGTGG - Exonic
1061895296 9:133643880-133643902 GTCCCAGGGCTGGCTGGCGGTGG + Intronic
1061913722 9:133738359-133738381 GCAGCGAGGGTGGGGGGCGGGGG - Intronic
1061949769 9:133929764-133929786 GCCACTGGGGTCGCTGGTGGTGG - Intronic
1061988114 9:134142171-134142193 GGGGCGGGGGTGGGTGGGGGAGG + Intronic
1062425588 9:136504702-136504724 GCAGCGAGGGTGGGCGGCGGCGG - Exonic
1062428128 9:136515453-136515475 GCCAGGCGGGTGGCCGGCGGGGG - Intronic
1062571307 9:137186635-137186657 GCAGCAGGTGTGGCTGTCGGGGG + Intronic
1062610585 9:137371675-137371697 GCCCCGGGGGTGCCTGGCCTGGG - Intronic
1062630770 9:137462139-137462161 GCGGCGGCGGAGGCGGGCGGAGG - Intronic
1062659096 9:137619075-137619097 GGCGCGGGGGCGGCGGGCAGCGG + Intronic
1202779998 9_KI270717v1_random:24911-24933 GCCGCGGCGGCGGCGGGTGGCGG + Intergenic
1202780002 9_KI270717v1_random:24914-24936 GCGGCGGCGGCGGGTGGCGGGGG + Intergenic
1203471460 Un_GL000220v1:116839-116861 GCGGCGGCGGCGGCAGGCGGCGG + Intergenic
1203479281 Un_GL000220v1:160811-160833 GCGGCGGCGGCGGCAGGCGGCGG + Intergenic
1185596250 X:1308693-1308715 GCCGGGGAGGAGGCTGGCGTGGG - Intronic
1185621454 X:1453338-1453360 CCCGGGGGGGAGGCGGGCGGGGG - Intronic
1186539910 X:10389726-10389748 GGGGGGGGGGTGGCGGGCGGGGG + Intergenic
1188242638 X:27809474-27809496 GGCGGGGGGGGGGCCGGCGGGGG - Intronic
1188242663 X:27809510-27809532 GGCGGGGGGGGGGCGGGCGGGGG - Intronic
1189002875 X:36963969-36963991 GCCGCGGGAGCCGCGGGCGGGGG - Intergenic
1189137116 X:38561504-38561526 GCGGCGGCGGCGGCAGGCGGCGG - Exonic
1189281842 X:39824646-39824668 GCAGTGGGGGTGGGTGGGGGTGG - Intergenic
1189534586 X:41923440-41923462 GCCGCGGAGGGAGGTGGCGGCGG + Intronic
1190066266 X:47243616-47243638 TCCCCGGGGGTGGGGGGCGGAGG + Intronic
1190108276 X:47574029-47574051 GCAGCGGCGGTGGCGGGTGGCGG + Exonic
1191038979 X:56058493-56058515 GCGGTGGGGGTGGGTGGGGGTGG - Intergenic
1194977364 X:100408797-100408819 GACGCGGCGGGGGCTCGCGGGGG + Exonic
1196854523 X:119970372-119970394 GCCGGGGGGGGGGCGGGGGGCGG + Intergenic
1198972127 X:142293455-142293477 GCCGGGGGGTTGGGGGGCGGGGG + Intergenic
1199832941 X:151562807-151562829 GCAGCGGGGGGGGCGGGGGGTGG + Intergenic
1200231077 X:154444197-154444219 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1201076740 Y:10195311-10195333 ACCGCGGCGGTGACTGGAGGAGG - Intergenic