ID: 901022463

View in Genome Browser
Species Human (GRCh38)
Location 1:6262086-6262108
Sequence GACACAGGGGTGCCTAGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901022463_901022471 6 Left 901022463 1:6262086-6262108 CCATGACTAGGCACCCCTGTGTC 0: 1
1: 0
2: 0
3: 5
4: 126
Right 901022471 1:6262115-6262137 AAACTAGGCACCCGACCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 43
901022463_901022470 3 Left 901022463 1:6262086-6262108 CCATGACTAGGCACCCCTGTGTC 0: 1
1: 0
2: 0
3: 5
4: 126
Right 901022470 1:6262112-6262134 AGGAAACTAGGCACCCGACCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
901022463_901022468 -9 Left 901022463 1:6262086-6262108 CCATGACTAGGCACCCCTGTGTC 0: 1
1: 0
2: 0
3: 5
4: 126
Right 901022468 1:6262100-6262122 CCCTGTGTCTGGAGGAAACTAGG 0: 1
1: 0
2: 3
3: 19
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901022463 Original CRISPR GACACAGGGGTGCCTAGTCA TGG (reversed) Intergenic
900158865 1:1214032-1214054 GACACAGTGGAGCCCCGTCACGG + Exonic
900185034 1:1328922-1328944 GACACAGGGGCACCCAGTGAGGG + Intergenic
901022463 1:6262086-6262108 GACACAGGGGTGCCTAGTCATGG - Intergenic
903161324 1:21491197-21491219 AACACAGTGGTGCCCAGGCAGGG - Intergenic
903938013 1:26910037-26910059 GACACAGGTCTGCCTACTTAGGG + Intronic
908905849 1:69007916-69007938 GACACAGGCGTGCTCAGTCCTGG - Intergenic
912040408 1:105383253-105383275 CACAAAGGTGTGCCTAGGCATGG + Intergenic
916164742 1:161955963-161955985 GACTCAGGAGTTCCTAGCCATGG - Intronic
918803626 1:189008081-189008103 GACTCAGGGTTACCTACTCATGG + Intergenic
1063210396 10:3875620-3875642 GGCTCAGGGGAGTCTAGTCAGGG - Intergenic
1074195060 10:111176486-111176508 GACAAAGGAGTTCCTAGTCCAGG - Intergenic
1076799248 10:132813078-132813100 GTCACGGCGGAGCCTAGTCAAGG + Intronic
1076840558 10:133043285-133043307 GACACAGGGATGTCCATTCAAGG - Intergenic
1077296332 11:1827966-1827988 GGCACAGGGGTGTCTGGACAGGG + Intergenic
1077453225 11:2663242-2663264 AAAGCAGGGGTGACTAGTCATGG + Intronic
1077472843 11:2772310-2772332 GACACAGGGGTGGTTGGCCAAGG - Intronic
1080122076 11:28689827-28689849 GACACAGGGGTGTTTACGCAAGG - Intergenic
1084432950 11:69121771-69121793 GACCCTGGGGTGCCCAGTGAGGG + Intergenic
1084569733 11:69952052-69952074 GAGACAGGGGTGCCGAGTGGTGG - Intergenic
1085202755 11:74711591-74711613 AACAGAGGAGTGCTTAGTCAAGG - Intronic
1085271546 11:75272988-75273010 GACACAGGGGAGCCAGTTCAGGG + Intronic
1086144989 11:83541808-83541830 GACAGTGGGCTGCCAAGTCAAGG - Exonic
1089176659 11:116553389-116553411 GTCACAGGTGTCCCTAGCCAGGG + Intergenic
1103081011 12:118023919-118023941 GAAAGAGGGGTGGCTAGGCAGGG + Intronic
1103685414 12:122728674-122728696 GACACAGGGGAGGCCAGGCACGG + Exonic
1104912285 12:132245053-132245075 GCCACAGCTGTGCCTTGTCAGGG + Intronic
1105544733 13:21343034-21343056 GACACAGGGGAGCCTAGGGGAGG - Intergenic
1106174951 13:27322272-27322294 GATACAGAGGTGCTTAGCCATGG + Intergenic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1108533210 13:51346585-51346607 GACACCTGGGTGACCAGTCAGGG - Intronic
1109999792 13:70180678-70180700 CACACAGGGCTACCTAGACATGG + Intergenic
1111040386 13:82740329-82740351 GACACATGGGTTCCTAGGCTGGG - Intergenic
1113842725 13:113369533-113369555 GACAGAGGGGCGCCTAGCGACGG - Intergenic
1113887974 13:113670885-113670907 GTCACAGGGGTGCCCAGGGAGGG + Intronic
1116615967 14:47139476-47139498 GACACAGAGGTCACTAGGCAAGG - Intronic
1116734489 14:48671409-48671431 GACACATGGGTTCCTGGACAGGG + Intergenic
1117183305 14:53214489-53214511 GACAGAGGGGAGCCAGGTCATGG + Intergenic
1120290619 14:82565585-82565607 GCAACAGGAGTGCCTAGTCTAGG + Intergenic
1120611677 14:86648533-86648555 GACACACGGGCTCCTAGTAAAGG + Intergenic
1122228059 14:100291245-100291267 GGCACAGGGGTGGCTAGTTGGGG - Exonic
1124580814 15:30953236-30953258 AGCACAGGGGAGCCTTGTCATGG + Intronic
1125675414 15:41499766-41499788 GACACAGGGCTGCCGAGTTGCGG + Intronic
1131788487 15:95938519-95938541 GACAGAGGGGTGCCTGGGCACGG + Intergenic
1134641849 16:15835566-15835588 GACACAAGGATGCCAAGTGATGG + Intronic
1135409047 16:22219307-22219329 GACAAATGGGTGCCTGGGCAGGG - Intronic
1136911519 16:34147954-34147976 GACAGAGAGGTGACTAGACAGGG + Intergenic
1138788850 16:59878669-59878691 TACGCAGAGGTGCTTAGTCATGG - Intergenic
1141040374 16:80667919-80667941 GAAACAGTGGTGGCGAGTCAGGG - Intronic
1141928807 16:87186737-87186759 GACACAGGGGCCCCTTCTCAGGG + Intronic
1145239333 17:21230875-21230897 GAAGCAGGGGTGGCTATTCAGGG - Intergenic
1149218706 17:54389481-54389503 GACATAGTGATGCCTAGGCAGGG - Intergenic
1151397528 17:73833783-73833805 CACACAGTGGTGCCTATTAAAGG + Intergenic
1152326713 17:79645728-79645750 GGCACAGGGCTGCCTGGCCAGGG + Intergenic
1152334641 17:79693477-79693499 GGCACAGGGGAGCCTGGGCAGGG + Intergenic
1152643963 17:81460425-81460447 GACACAGTGGAGCCCAGGCAGGG - Intronic
1153658970 18:7309615-7309637 GACACAGTGGTTCCTAGGAAGGG + Intergenic
1156087511 18:33424639-33424661 GACACAGGGGAGCCACGGCACGG + Intronic
1156822126 18:41385689-41385711 AACACAGGGGTGCCTACTGCTGG - Intergenic
1160877623 19:1304598-1304620 GACACAGGGGTACACAGGCATGG - Intergenic
1161326545 19:3667065-3667087 GTGGCAGGGGTGCCTGGTCAGGG - Intronic
1166887753 19:45972350-45972372 GACACAGGCGTGGCTGGTGAGGG - Intronic
925252679 2:2453490-2453512 AACACAGGGGGACCCAGTCACGG + Intergenic
934783738 2:96989569-96989591 TTCACAGGGGTGCCTTGTAAAGG - Intronic
935856411 2:107279295-107279317 GACACAGATGTGCCTCATCATGG + Intergenic
940693967 2:156956026-156956048 CCCACAGGTGTGCCTAGTCATGG + Intergenic
942461148 2:176169703-176169725 GACCCAAGGAAGCCTAGTCAGGG + Intronic
947926572 2:233926955-233926977 GACACAGACGTGCCCAATCATGG + Intronic
948728940 2:239951501-239951523 GTCCCAGGGATGCCTGGTCAGGG + Intronic
1171769711 20:29313285-29313307 GACAGAGAGGTGACTAGACAGGG - Intergenic
1171812434 20:29756436-29756458 GACAGAGAGGTGACTAGACAGGG - Intergenic
1171906845 20:30906231-30906253 GACAGAGAGGTGACTAGACAGGG + Intergenic
1173872656 20:46351579-46351601 GCCACAGGGGTGCTTTCTCAGGG + Intronic
1176121276 20:63455632-63455654 GCCAGAGGGGTGCCCAGTTAAGG + Intronic
1182967651 22:34536982-34537004 GAAGCAGGGCAGCCTAGTCAGGG + Intergenic
1183736734 22:39648589-39648611 GAGCCAGGGGTGCTTATTCAGGG + Intronic
1183986155 22:41571802-41571824 GGCACAGGTGAGCCTAGTCCAGG - Intronic
1184455938 22:44609444-44609466 GACACAGAGATGCCTGGGCATGG + Intergenic
949102664 3:164787-164809 GGCACAAGGATGCCTATTCAAGG + Intergenic
949108895 3:234758-234780 GACACAGGGCTCCCCATTCATGG + Intronic
950979675 3:17289057-17289079 AACACAGTGGTGCCCAGGCAGGG - Intronic
952906149 3:38140295-38140317 GGCCCAGGGTTGCCTAGGCAGGG + Intronic
954523099 3:51247346-51247368 TACAAAGGGCTGCCTTGTCAGGG - Intronic
954922928 3:54207372-54207394 GACACAGTGGTTCCAGGTCACGG - Intronic
961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG + Intronic
964384561 3:156133573-156133595 GATACAGGGATGCAGAGTCAGGG + Intronic
967891259 3:194365974-194365996 CACAGAGGGCTGCCCAGTCATGG + Intronic
969270451 4:6096104-6096126 GACACAGGAGTGCCTGTGCAAGG + Intronic
969627748 4:8316390-8316412 GTCACAGGGGGGCCTGGTCCTGG - Intergenic
975745777 4:77472869-77472891 GCCAGAGGTGTGCCTAGTTATGG - Intergenic
979339402 4:119503192-119503214 GACTCCGGGCTGCTTAGTCAGGG - Intronic
980528655 4:134021609-134021631 GACACAGAGGTGTCTAGTTAAGG + Intergenic
983294401 4:165847727-165847749 ACCACAGGGATGCCTAGCCATGG + Intergenic
983809005 4:172034192-172034214 GGCACAGGGGAGGTTAGTCAGGG - Intronic
985477984 5:90677-90699 GACCCAGTGGCGCCTGGTCAGGG - Intergenic
989266381 5:39479478-39479500 GACACAGGGGTTTCTAGAGAGGG - Intergenic
995490992 5:112691596-112691618 GACACAGGGGAGCTGTGTCATGG - Intergenic
995704964 5:114979142-114979164 GACACACGGGTGCATAGTGGGGG + Intergenic
997704033 5:135930344-135930366 GGCACAGGAGCGCCTAGGCACGG - Intronic
1000123976 5:158225676-158225698 GACTCAGAAGTGCCTAGTCCAGG - Intergenic
1006403386 6:33830678-33830700 AACACAGGGGTGCTAAGTCATGG - Intergenic
1007032615 6:38641621-38641643 GGGACAAGGGTGCCTAGTCCAGG + Intergenic
1007483828 6:42167091-42167113 GAGACAGGGATGCCAAGGCAAGG - Intronic
1007588459 6:43007127-43007149 GACACAGGGGGGACTGGTGAGGG + Intronic
1008564781 6:52756429-52756451 TACACAGAGGGGGCTAGTCATGG + Intronic
1011359811 6:86511336-86511358 GACTCAGTGCTGCCTTGTCAAGG - Intergenic
1011701614 6:89960322-89960344 GTCACAGGGCTGCCTGGCCAGGG + Intronic
1012231464 6:96765304-96765326 GACATAGGTGTGCTCAGTCACGG + Intergenic
1013821372 6:114157117-114157139 GACAATGGGGTGGATAGTCATGG - Intronic
1014079423 6:117270408-117270430 GGCACAGGGCTGGCTAGCCATGG - Intronic
1015769708 6:136755863-136755885 GACACTGAGGTTTCTAGTCAGGG + Intronic
1021292766 7:18866246-18866268 GAGACAGGGGTACCTAGAGAAGG - Intronic
1024505636 7:50159079-50159101 GAGACAGGGGAGCCTGGTGACGG - Exonic
1024520351 7:50300444-50300466 GACACTGAGGTGCCAAGACAGGG + Intergenic
1028639188 7:93024084-93024106 GACAGAGGGCTCCCTAGACAAGG - Intergenic
1034219719 7:149434341-149434363 GACACAGGTGTGCTGAGTCAAGG + Intronic
1034424501 7:151007458-151007480 ACCACAGGGGTGCCTAGCCCAGG + Intronic
1034682526 7:152939979-152940001 GGCACCGAGGTGCCTTGTCAAGG + Intergenic
1035775590 8:2185297-2185319 GACACAGTGGTGCCGAGATATGG - Intergenic
1036685191 8:10904789-10904811 GCCACAGGAGTGCCTAGAGATGG + Intronic
1037831996 8:22195266-22195288 GAAAGAGGGGTCCTTAGTCAGGG + Intronic
1049585822 8:143431923-143431945 GCCACAGGGAGGCCTGGTCACGG + Intergenic
1056925982 9:90834914-90834936 GACACAGTGGTTTCCAGTCAGGG + Intronic
1060013261 9:120063477-120063499 GACACAGGGGTGGCAATTTAGGG - Intergenic
1061308786 9:129748909-129748931 GAGACAGGGGGGCCTTTTCATGG - Intronic
1061496133 9:130975506-130975528 CACACACGGGGGCCTACTCAAGG + Intergenic
1061866457 9:133494014-133494036 GACACAGGAGAGCCAGGTCAGGG + Intergenic
1062303932 9:135891258-135891280 GAAACAGGGAAGCCTAGGCACGG + Intronic
1203363412 Un_KI270442v1:237453-237475 GACAGAGAGGTGACTAGACAGGG - Intergenic
1188812674 X:34671115-34671137 GACACAGGGGTACCCTGGCAAGG - Intergenic
1189057719 X:37716044-37716066 CACACAAGGGTGTCTTGTCAAGG + Intronic
1191688796 X:63919477-63919499 CACACAGGGGTGCTCAGTGATGG - Intergenic
1199343291 X:146708070-146708092 GCCAAAGTTGTGCCTAGTCATGG + Intergenic