ID: 901025626

View in Genome Browser
Species Human (GRCh38)
Location 1:6277372-6277394
Sequence CCTTCAAAGCTGATAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901025626_901025635 1 Left 901025626 1:6277372-6277394 CCCCCCACTATCAGCTTTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 901025635 1:6277396-6277418 CTGCTATTGGGAGATGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 108
901025626_901025636 2 Left 901025626 1:6277372-6277394 CCCCCCACTATCAGCTTTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 114
Right 901025636 1:6277397-6277419 TGCTATTGGGAGATGCCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901025626 Original CRISPR CCTTCAAAGCTGATAGTGGG GGG (reversed) Intronic
901025626 1:6277372-6277394 CCTTCAAAGCTGATAGTGGGGGG - Intronic
904512261 1:31021754-31021776 CCTTCACAGCTTCTAATGGGAGG + Intronic
904832116 1:33312004-33312026 CTGTCAAAGCTGTGAGTGGGAGG - Intronic
909979616 1:82083034-82083056 TCTTCAAAACTGACAGTGGCTGG - Intergenic
915449513 1:155994838-155994860 CCTCCAAAGCTGAGATTTGGAGG + Intronic
915973546 1:160370652-160370674 GCTTGAAAGCTGGTGGTGGGAGG - Exonic
917475344 1:175364729-175364751 TCTTCTAAGCTGGTAGTGGGAGG + Intronic
917491070 1:175499081-175499103 CCTTCAAGGTTGATACTGTGTGG + Intronic
924002503 1:239569594-239569616 CATTCAGAGCTTATAGTGGAAGG - Intronic
1064741529 10:18439595-18439617 ATTTCAAAGGTGATAGCGGGAGG - Intronic
1064805210 10:19122678-19122700 CCTTCAAGTCTTATATTGGGGGG + Intronic
1068636349 10:59352288-59352310 TCTTCAAAGCGGAGAGCGGGAGG - Exonic
1069879733 10:71584350-71584372 CCTTGAAAGTTGAAAGTGAGGGG - Intronic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1070491713 10:76982732-76982754 AGTTCAAAGAGGATAGTGGGTGG + Intronic
1075103934 10:119524753-119524775 CCTCGAAAGCTGTTACTGGGCGG - Intronic
1077174164 11:1181168-1181190 CCTACAAAGCTGAGGGTGAGCGG + Intronic
1081876876 11:46414545-46414567 CCTACAAATGTGATAGGGGGAGG - Intronic
1083311779 11:61787510-61787532 CATTCAAAGCTGAGAATGAGTGG - Exonic
1090980557 11:131717152-131717174 TCTTCAAATCAGATAGTGGTAGG + Intronic
1094690555 12:32764287-32764309 CATTCAAAGCTGCCCGTGGGTGG + Intergenic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1103849989 12:123926647-123926669 GCTTCAAAGCTGATCATTGGGGG - Exonic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1106851285 13:33795549-33795571 CCTTCCAAGCTTACAGTGGTGGG - Intergenic
1109443137 13:62400363-62400385 CCTTCAGAGCTGACAGAGGAGGG - Intergenic
1110439396 13:75510338-75510360 CCTTAAAAGCTGACAGAGTGGGG - Intergenic
1110651777 13:77950475-77950497 CCTTCAGAGCTGACAGAAGGAGG + Intergenic
1114840894 14:26260916-26260938 ACTTCCAAGATGATGGTGGGCGG - Intergenic
1116194363 14:41703749-41703771 CCTTCAAAGATGATAGTGTCAGG + Intronic
1119758720 14:77136667-77136689 CCTTGAGAGCTAAAAGTGGGAGG - Intronic
1121102684 14:91260982-91261004 TCTTTAAAGCTGACAGTGGATGG - Intergenic
1121319480 14:92982739-92982761 CCTTGAAAGCTCATAGTAGCTGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1124973927 15:34516091-34516113 ACTGCAAAGCTGATAGTGCCTGG - Intergenic
1126423564 15:48501379-48501401 ACTTCACAGCTGAAAGTGGAAGG - Intronic
1129204447 15:74027731-74027753 GCTTCCTAGCTGATAGTGAGAGG - Intronic
1130150478 15:81307779-81307801 GCTTCATAGCTGCTAGTGGTGGG - Intronic
1132185515 15:99799117-99799139 CCATCATAGCTGATAGCGTGTGG - Intergenic
1132289291 15:100688315-100688337 CCTTCCTAGTTGATACTGGGGGG + Intergenic
1133901297 16:9977576-9977598 ACTCCAAAGCTGAGAGTGGAAGG + Intronic
1134602927 16:15547641-15547663 CATTAAAAGCTGAAAGTGGCTGG - Intronic
1140641481 16:76978292-76978314 CCTTCAAAGTTGAAAGAGGAGGG - Intergenic
1143353103 17:6303821-6303843 CAGTCAAAGTTGATAGTGAGTGG + Intergenic
1144642270 17:16944097-16944119 CCTTCAAAGCAGATCTGGGGTGG + Intronic
1149368392 17:55968150-55968172 TTTTCAAAGCTGATAGTTGGTGG - Intergenic
1152350811 17:79783130-79783152 CCTTGAAAGCTGATGGTGGACGG + Intronic
1153500009 18:5739153-5739175 CCTTCAAGGCCGATTGTGGTTGG + Intergenic
1155744519 18:29336943-29336965 CTTTCAAAGCTCATAGTGCCTGG + Intergenic
1155955098 18:31950090-31950112 CCTGCAAAGCTGTTAGTTGTGGG - Intronic
1162278303 19:9675419-9675441 CCTCCAAAGCTTATCCTGGGCGG + Intergenic
1163816495 19:19468221-19468243 TCCTCAAAGCTGACAGTGGCTGG - Intronic
1164884758 19:31769199-31769221 CCTTCAAGGCTGAGAGCTGGAGG + Intergenic
1166143868 19:40821371-40821393 CATCCAAAGCTGAGAATGGGTGG + Intronic
1166183741 19:41125725-41125747 CATCCAAAGCTGAGAATGGGTGG - Intronic
1168199657 19:54805457-54805479 CCTTCAAAGCCCACAGTGGCTGG - Intronic
933281641 2:80338320-80338342 CTTTTAAAGCAGATAATGGGAGG + Intronic
934944205 2:98525238-98525260 TCTTCAAAGCTGGCAGTGGCAGG + Intronic
934969761 2:98753761-98753783 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
935616116 2:105083550-105083572 CCTTTAAAACTCATAATGGGAGG + Intronic
938317122 2:130337604-130337626 CCTTCGCTGCTGATTGTGGGCGG - Intergenic
942695269 2:178635439-178635461 CCTGCAAAGCTGACACTTGGAGG - Exonic
944305078 2:198169819-198169841 CATTCAAAGGTGTTGGTGGGTGG + Intronic
946305922 2:218857065-218857087 TCTTCTAAGGTGATAGTGGTGGG + Intergenic
1175375743 20:58522764-58522786 ACTTGCAAGCTGATGGTGGGGGG - Intergenic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1181142841 22:20819997-20820019 CCTTCACAGTTATTAGTGGGTGG - Intronic
950354519 3:12395045-12395067 CCTTCAAAGCTGTGAGTGCATGG - Intronic
950593051 3:13952814-13952836 CCTTCATAGCTGACAGAAGGAGG + Intronic
950858910 3:16130307-16130329 CCTTCTAGGCTGTTAGTTGGTGG + Intergenic
950868001 3:16204819-16204841 CCTTCAAAGGGCAGAGTGGGAGG - Intronic
951349454 3:21587820-21587842 CCTGAAAAGGTGAGAGTGGGAGG + Intronic
952984195 3:38762988-38763010 CCATCAAAGCTCATTGTGTGGGG - Intronic
954117395 3:48474740-48474762 CTTTCAAAGCTGAAAGGAGGGGG - Intronic
959386085 3:105709042-105709064 CATTAAGAGCTGATAGTGGGAGG - Intronic
961690733 3:128667618-128667640 CCTTCATAGCTGACAGAAGGAGG - Intronic
962170582 3:133097527-133097549 CCTTCAAAAATGATAGTCTGTGG - Intronic
964849971 3:161085561-161085583 CCTTCAAAGATGATATGTGGAGG - Exonic
969269320 4:6088379-6088401 ACTGCAAAGCTGATACTGAGGGG - Intronic
975413745 4:74084683-74084705 CCTTCATAGCTGAGAGAAGGAGG - Intergenic
975693938 4:76993150-76993172 ACTTCAGAGTTGATGGTGGGAGG + Intronic
978481084 4:109191524-109191546 TCCTCAAAGCTGATGGTGGTTGG - Intronic
978503955 4:109436728-109436750 CCTTCAAAGGGGATGATGGGTGG - Intronic
984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG + Exonic
985097073 4:186423434-186423456 CCTTCCATGCTAAGAGTGGGTGG - Intergenic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
990339085 5:54804759-54804781 TTTTCAAAGCTGATAGGGGAAGG - Intergenic
990973225 5:61532996-61533018 TTTTCAAAGTTGATAGTGTGTGG + Intronic
992257142 5:74932550-74932572 CCTGCACAGCTGAAAGTGGAGGG - Intergenic
993012481 5:82499026-82499048 ACTTCAAAACTGATGGTAGGTGG + Intergenic
994636007 5:102344914-102344936 CCTTCAAAGCTGACAGAAGGAGG + Intergenic
999158497 5:149475512-149475534 CCTTGATACCTGATGGTGGGAGG + Intergenic
1002048468 5:176555372-176555394 CCCTCACAGCTGAAAGTGAGTGG - Intronic
1002917300 6:1539739-1539761 CCTTGAAAGGTGATTGTGGCCGG - Intergenic
1002937217 6:1683930-1683952 CCCTCATAGCTGATAGAGGGCGG - Intronic
1002937230 6:1683980-1684002 CCCTCATAGCTGATAGAGGGCGG - Intronic
1002937243 6:1684030-1684052 CCCTCATAGCTGATAGAGGGCGG - Intronic
1004322983 6:14647608-14647630 CCTTCAGAGATGAGAGTGGCAGG - Intergenic
1007234423 6:40380023-40380045 CCTTCAAAGGGGGAAGTGGGAGG - Intergenic
1008623088 6:53291065-53291087 CCTTTAAAGCTAAAAGGGGGAGG - Intronic
1010497179 6:76549109-76549131 CCTTCAAAGATGATAGAGGATGG + Intergenic
1011675344 6:89727859-89727881 CCTTCAAAGCTGCCAGTAAGGGG + Exonic
1011962631 6:93110057-93110079 ACTTCAAAGCAGAGAGTGGCTGG + Intergenic
1012489343 6:99763428-99763450 CTTTCACAGATCATAGTGGGAGG + Intergenic
1015231064 6:130915335-130915357 CCTTCAAACATGAAATTGGGAGG + Intronic
1017815376 6:158012374-158012396 CCTTAAAAGCTGGAAGAGGGAGG + Intronic
1017895227 6:158673732-158673754 CCTTCAAAGCTGTTCCTGGCGGG - Intronic
1019647603 7:2139402-2139424 CCTTCACTGCTGAGGGTGGGGGG - Intronic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1022070673 7:26910569-26910591 CCTTCAAAGCTCCTAGTGAGCGG + Intronic
1028342059 7:89733992-89734014 CCTCCCAAGCTCATTGTGGGTGG - Intergenic
1028650964 7:93150484-93150506 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
1030496703 7:110309438-110309460 AATTCACAGCTGATAATGGGGGG + Intergenic
1033099370 7:138457448-138457470 CCTCAAAAGGTGCTAGTGGGTGG - Intergenic
1033422550 7:141216777-141216799 ACTTCAAGCCAGATAGTGGGTGG - Intronic
1041476473 8:58272664-58272686 AGATCTAAGCTGATAGTGGGAGG + Intergenic
1041749518 8:61245161-61245183 ACTTCAAAGTTGAAAGTGGAAGG - Intronic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1047181840 8:122595865-122595887 TTTTCAAAGATGTTAGTGGGAGG - Intergenic
1048445261 8:134488517-134488539 ACTCCAAAGCAGAGAGTGGGTGG - Intronic
1049367470 8:142247504-142247526 ATTTCACAGCTCATAGTGGGGGG + Intronic
1058712727 9:107694988-107695010 GCTTCAAAGATGATAGGGGATGG + Intergenic
1059454305 9:114389978-114390000 CCTCCAGAGCTGATAGGGAGGGG - Intronic
1187170870 X:16850551-16850573 CCTTTAAAGCAGACAGTTGGGGG - Intronic
1189813239 X:44800161-44800183 CCTTCAAAGCTGAGCATGGTTGG - Intergenic
1195622747 X:106973747-106973769 CCTTCAAAGCTAGTAGTGACAGG - Intronic
1200131711 X:153852228-153852250 CATTCAAAGCAGCTGGTGGGTGG - Intergenic