ID: 901026754

View in Genome Browser
Species Human (GRCh38)
Location 1:6282384-6282406
Sequence CCGCAGGGCAGCACTTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901026754_901026758 -5 Left 901026754 1:6282384-6282406 CCGGGGCAAGTGCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 901026758 1:6282402-6282424 TGCGGTCAGAATGCCCTCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 88
901026754_901026765 20 Left 901026754 1:6282384-6282406 CCGGGGCAAGTGCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 901026765 1:6282427-6282449 GCCCAGCGTGGCCTCTATTCTGG 0: 1
1: 0
2: 0
3: 3
4: 87
901026754_901026769 26 Left 901026754 1:6282384-6282406 CCGGGGCAAGTGCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 901026769 1:6282433-6282455 CGTGGCCTCTATTCTGGGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 135
901026754_901026761 8 Left 901026754 1:6282384-6282406 CCGGGGCAAGTGCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 901026761 1:6282415-6282437 CCCTCCCAGGCGGCCCAGCGTGG 0: 1
1: 0
2: 2
3: 25
4: 268
901026754_901026767 21 Left 901026754 1:6282384-6282406 CCGGGGCAAGTGCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 901026767 1:6282428-6282450 CCCAGCGTGGCCTCTATTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 136
901026754_901026759 -2 Left 901026754 1:6282384-6282406 CCGGGGCAAGTGCTGCCCTGCGG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 901026759 1:6282405-6282427 GGTCAGAATGCCCTCCCAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901026754 Original CRISPR CCGCAGGGCAGCACTTGCCC CGG (reversed) Intronic