ID: 901029831

View in Genome Browser
Species Human (GRCh38)
Location 1:6300633-6300655
Sequence CTGTGTTTGTGGAGAGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 482}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901029831 Original CRISPR CTGTGTTTGTGGAGAGAGGC CGG (reversed) Intronic
900736066 1:4300261-4300283 CTGGCTCTGGGGAGAGAGGCTGG + Intergenic
901029785 1:6300457-6300479 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901029844 1:6300696-6300718 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901029859 1:6300759-6300781 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901029873 1:6300817-6300839 CTGTGTTTGTGGAGAGGGACCGG - Intronic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
904093139 1:27959031-27959053 GTTTGTTTTTGGAGAGAGTCTGG - Exonic
904409619 1:30317582-30317604 CTGGCTTTGTTGAGAGAGGTGGG - Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905011883 1:34752871-34752893 CTCTGTTTGAGAAAAGAGGCTGG - Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905981084 1:42228752-42228774 ATGTGTGTGTGTATAGAGGCAGG - Intronic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
907853713 1:58281041-58281063 GTGTGTTTGGGGAGAAAGACAGG + Intronic
908739461 1:67311978-67312000 CTCTGTTTGTGGACAATGGCAGG - Intronic
909567055 1:77064389-77064411 GTGTTTTTGTGTTGAGAGGCTGG - Exonic
910171761 1:84385679-84385701 TGGTGTTTGAGGAAAGAGGCAGG + Intronic
910559821 1:88578397-88578419 CTTTCTTTGTGGTGGGAGGCAGG - Intergenic
910853274 1:91669636-91669658 GTGTGTTTGTGGAGTGAGCGTGG - Intergenic
911497100 1:98644955-98644977 ATGTGATTATGGAGAGAGACAGG - Intergenic
912516680 1:110220670-110220692 CTGTTTTTCAGGAGAGAGGGTGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912760215 1:112359773-112359795 CTGTATTTGGGCAGAGAGGAGGG - Intergenic
912843352 1:113058789-113058811 CTGAGTGTTTGGGGAGAGGCCGG - Intergenic
913314906 1:117541316-117541338 CTCTGTTTGTGGAGAAAAGAAGG + Intergenic
913378238 1:118179411-118179433 TTTTGTTTATGGAGAGAGACAGG - Intronic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
914320745 1:146556987-146557009 CAGTGTTTGAGGACAAAGGCTGG + Intergenic
915351409 1:155228912-155228934 CAGAGGTTGTGGAGAGAGGGTGG + Intergenic
915354193 1:155246092-155246114 CAGAGGTTGTGGAGAGAGGATGG + Intergenic
915416267 1:155745616-155745638 CTGTGGTTGCCGCGAGAGGCGGG - Intergenic
915490846 1:156249322-156249344 CTATTTTAGAGGAGAGAGGCAGG + Exonic
915943683 1:160135060-160135082 CTGCGGTGGTGAAGAGAGGCAGG + Intronic
916128118 1:161589237-161589259 CTGTGCTGGTGGGGAGAGGTTGG + Intronic
916138035 1:161671067-161671089 CTGTGCTGGTGGGGAGAGGTTGG + Intronic
917369467 1:174275038-174275060 ATATGTGTGTGGAGAGAGGAGGG - Intronic
917387215 1:174490804-174490826 CTCTGCTTGTGGAAAGAGGAGGG - Intronic
917479074 1:175394997-175395019 CAATGATTGTGCAGAGAGGCAGG - Intronic
917710490 1:177679548-177679570 CTGTGTTCTTGGGGAGAGGGAGG - Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918135896 1:181673748-181673770 CTGTGTTTCAGGAGAGGGGTGGG - Intronic
918284688 1:183040628-183040650 CTGGGTTTCAGGAGAAAGGCTGG + Intronic
919796392 1:201323792-201323814 CTGGCTGTGAGGAGAGAGGCTGG + Intronic
919841180 1:201610587-201610609 CTGTGCCTGCGGACAGAGGCAGG - Intergenic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
921709526 1:218359763-218359785 GTTTGTTTGTGTGGAGAGGCTGG + Intronic
921917361 1:220627484-220627506 AGGTGTTGGTGGAGAAAGGCAGG - Intronic
922377199 1:224980390-224980412 CTCTGCCTGTGGAGAGAGGAAGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG + Intronic
923081954 1:230666184-230666206 TTTTGCTGGTGGAGAGAGGCAGG - Intronic
1063702585 10:8400106-8400128 CTGGGTGTGTGAAGTGAGGCAGG + Intergenic
1064097018 10:12431416-12431438 CAGTGTCTGAGGAGAGAGACTGG + Intronic
1064425547 10:15226146-15226168 CTGGGTTTCTGGGGTGAGGCAGG - Intronic
1067835273 10:49634453-49634475 CTGTCCTTGTGGTCAGAGGCAGG + Intronic
1068088230 10:52401074-52401096 GTGTGTGTGTGTATAGAGGCAGG - Intergenic
1069092961 10:64223875-64223897 CAGTGTTGGTGGCGACAGGCTGG - Intergenic
1069556600 10:69402422-69402444 CTGTGTTTGGGTAGAGAGGGAGG - Intergenic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070325855 10:75388451-75388473 CTGCATTTGGGGAGAAAGGCAGG + Intergenic
1070606016 10:77898992-77899014 CTGAGTACGTGGAGAGTGGCAGG - Intronic
1072127262 10:92457899-92457921 CTGAGTTCCTGGAAAGAGGCTGG - Intronic
1072256030 10:93621135-93621157 GTGTGTGTGGGGAGAGTGGCGGG - Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1074394419 10:113085831-113085853 CAGTGTTTCTGGAGAAAGCCAGG + Intronic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075278558 10:121118455-121118477 CTGATTGTTTGGAGAGAGGCAGG + Intergenic
1075598602 10:123750357-123750379 TTGTGTGGCTGGAGAGAGGCCGG - Intronic
1075680107 10:124325478-124325500 CTATGATCGTGGAGAGAGGAGGG + Intergenic
1076550500 10:131274857-131274879 CTGGGATTGTGGATGGAGGCAGG - Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077093088 11:788350-788372 CTGTGGTTGTTGAGAAGGGCAGG + Exonic
1077498515 11:2898267-2898289 CTGGGTCTGGAGAGAGAGGCAGG - Intronic
1077965088 11:7121809-7121831 GTGTGTGTGTGGATAAAGGCAGG + Intergenic
1079334964 11:19563282-19563304 CTGTGTTTGGGAAGAGAGACTGG - Intronic
1079868532 11:25765453-25765475 GTGTGTGTGTGGGGAGAGGGGGG + Intergenic
1080737448 11:35030715-35030737 CTGTGTTCCTGGCGAGAGGCTGG + Intergenic
1081086344 11:38806289-38806311 CTCTGGTAGGGGAGAGAGGCAGG - Intergenic
1081602413 11:44504416-44504438 GTGTGTGTGTGGAGAGAGTATGG - Intergenic
1082020144 11:47525906-47525928 GTTTGTTTGTGGATAGAGACGGG - Intronic
1082077583 11:47986234-47986256 CTGCCTTTGTGGAGATAGACTGG + Intronic
1082975273 11:59064318-59064340 CAGGGGTTGTGGAGTGAGGCAGG + Intergenic
1082979704 11:59108054-59108076 CGGGGGTTGTGGAGTGAGGCAGG + Intronic
1083327212 11:61878842-61878864 CTGAGCCTGGGGAGAGAGGCAGG + Exonic
1083950195 11:65950318-65950340 CTGGGTTTGTGGGGAGAAGAAGG - Intronic
1084068332 11:66718369-66718391 CTGGGTGTGGGGAGAGTGGCCGG - Intronic
1084319718 11:68366516-68366538 CTGTGTTTGTGTGCAGCGGCTGG + Intronic
1084362696 11:68679223-68679245 CTGTGTTACTGGAGTGGGGCTGG + Intergenic
1084556426 11:69878860-69878882 GTGTGTTGGTGGAGTGAGGATGG - Intergenic
1085474750 11:76782946-76782968 CTGTGTGTGTGGAAAGAGAGAGG - Intronic
1085567551 11:77528115-77528137 ATGTGTTTGTGGGGATAGGCTGG - Intronic
1086596851 11:88582864-88582886 ATGTGATTGTGGAGAGAGACAGG + Intronic
1086861561 11:91930799-91930821 GTGTCTATGTGGAGAGAGGTCGG + Intergenic
1086906459 11:92423667-92423689 CTATGTCTGTAGAGAGAGGGTGG + Intronic
1087958225 11:104316145-104316167 CTATGTTTGTGAAGTGAGGTTGG + Intergenic
1088169663 11:106981036-106981058 CTATGTTTGAGGAGATATGCTGG - Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088678799 11:112221893-112221915 CTGTTTTAGTGGAGAGAGGCAGG + Intronic
1089432771 11:118436904-118436926 CCGTGTTTGGGGAGAGCGGCGGG + Exonic
1089650342 11:119908752-119908774 CTCTGTTTGCCGAGAGAGGATGG + Intergenic
1089778918 11:120859507-120859529 CTCTGTGTGTGGGGAGAGGATGG + Intronic
1089818099 11:121194765-121194787 CTGAGTTTTAGGAGAAAGGCTGG - Intergenic
1090408269 11:126490533-126490555 CTGTGTTTGTGGTGAGACCTGGG + Intronic
1091046518 11:132330480-132330502 CCGTGTGTGAGGAAAGAGGCAGG - Intronic
1091058208 11:132438621-132438643 ATGTGTCTGTGGAGATGGGCTGG + Intronic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1092632246 12:10394657-10394679 CTGTGTCTGTGTAGAAAGGGAGG + Intronic
1092662909 12:10758181-10758203 CTGTCTTTGTGGAGAGAAATGGG + Intergenic
1093549510 12:20390831-20390853 CTGTGTTTGTAGTGATAGGCTGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094142237 12:27193064-27193086 TTATGTTTGTAGAGACAGGCTGG - Intergenic
1094241395 12:28229819-28229841 CTGTGTTTGTGGCTAGAAGAAGG + Intronic
1094272549 12:28632984-28633006 CTGTGGTTGTAAAGAAAGGCAGG - Intergenic
1094564487 12:31587841-31587863 CAGTATTTGAGGTGAGAGGCTGG - Intronic
1095338507 12:41060170-41060192 CTTTTTTTGTGGAGACTGGCTGG - Intronic
1096255754 12:50061225-50061247 CTGTATTTGTGCAGAAAGGATGG + Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096550608 12:52369568-52369590 CGGGAGTTGTGGAGAGAGGCAGG - Intergenic
1097005617 12:55915330-55915352 CTGTATTTGTGGAGATAACCAGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097714761 12:62954675-62954697 CTCTGCATGTGGAAAGAGGCAGG - Intergenic
1098016300 12:66108190-66108212 CTGTCTTTGAGATGAGAGGCTGG - Intergenic
1098139370 12:67436033-67436055 GTGTGCTTCTGGACAGAGGCAGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100089586 12:90954198-90954220 CTGTATGAGTGGAGAGAGCCTGG - Exonic
1100875767 12:98959891-98959913 CTCTGTTTGTGGAAAGGGGAGGG + Intronic
1101251919 12:102945534-102945556 CTCTGTTTGTGGAAAGGGGAGGG - Intronic
1101566343 12:105909503-105909525 CAGTGTCTGAGGACAGAGGCTGG - Intergenic
1101695577 12:107122617-107122639 CTGTGTTTGTTGAGAGATTAGGG - Intergenic
1101855237 12:108436794-108436816 CTGTGATTGCTGAGAGAGACTGG - Intergenic
1102237082 12:111300124-111300146 CTCTTTTTGTTGAGACAGGCAGG + Intronic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103508118 12:121454968-121454990 CTGTATTTGAGGAGAAAGGGGGG - Intronic
1104012637 12:124942869-124942891 CTTTGTTTTTTGAGAGAGACAGG + Intergenic
1104217692 12:126750211-126750233 CAGTCACTGTGGAGAGAGGCAGG + Intergenic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104967326 12:132514146-132514168 CCGTGTGTGGGGAGACAGGCTGG + Intronic
1105849722 13:24323209-24323231 CTGTGGTTGTTGAGAAGGGCGGG - Intergenic
1107694473 13:42986788-42986810 CTCAGTTTCTGGGGAGAGGCGGG + Intronic
1107794055 13:44031719-44031741 GTGTGTGTGAGCAGAGAGGCAGG - Intergenic
1107982927 13:45750649-45750671 CTGTGCTTGTGGAGAGACAGAGG + Intergenic
1108003544 13:45925839-45925861 CTGTGTGTGTGGTAAGGGGCTGG + Intergenic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1110090941 13:71447310-71447332 CTGTGTCTGAGGAGACAGACAGG + Intronic
1112348144 13:98609921-98609943 CTGTTTTTGTGGGGAGAAGGGGG - Intergenic
1112577820 13:100652666-100652688 CTGTGTTTATGCAGAGTGGGAGG - Intronic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1114494625 14:23124053-23124075 CCGAGTCTGTGGAGAGAGTCAGG - Intergenic
1114537540 14:23432501-23432523 CTCTGTCTGTGGGGAGAGGGTGG + Exonic
1117340862 14:54790009-54790031 GTGTGTGTGTGGAGCAAGGCTGG - Exonic
1118048641 14:62002605-62002627 CTGTCTCCGGGGAGAGAGGCAGG - Intronic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119776760 14:77253824-77253846 CTGTCTGCGTGCAGAGAGGCTGG + Intronic
1120836290 14:89040934-89040956 CTGAGTCCGTGGAAAGAGGCTGG + Intergenic
1121070875 14:91019539-91019561 CTGTGATTATGGAGACTGGCAGG - Intronic
1121503982 14:94462238-94462260 CTGGGTTTGTGGGGAGCGCCGGG - Intergenic
1121580442 14:95025934-95025956 CTCTGTTTGTGGACACAGGGAGG - Intergenic
1122084466 14:99290070-99290092 CTGTGTCTGTGGAGTCAGCCAGG + Intergenic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1122883530 14:104700529-104700551 CTGTGGTTGGGGACAGCGGCTGG + Intronic
1125766278 15:42138623-42138645 CTGAGTATGAGGACAGAGGCTGG - Intergenic
1125980330 15:43995428-43995450 CTGAGTTTGTGGGGGCAGGCTGG + Intronic
1126850909 15:52796257-52796279 CTGTGTATGTGTAGACAGTCTGG + Intergenic
1128342530 15:66832357-66832379 GTGTGTGTGTGGTGAGAGGCAGG + Intergenic
1128520956 15:68374604-68374626 CTGTGTCTGTTGAGGCAGGCAGG + Intronic
1129726043 15:77902260-77902282 CTGTGTTTGTGGTGAGGACCGGG - Intergenic
1130103502 15:80912004-80912026 CTGTGATTGCTGGGAGAGGCTGG + Intronic
1130764066 15:86852336-86852358 CTCAGTGTGTGGAGAGAGGGAGG - Intronic
1130862543 15:87903918-87903940 CTGAGGTTGTGGAGAGGGTCTGG - Intronic
1130892690 15:88146626-88146648 CTTTGTTTGTGCAGAATGGCTGG + Intronic
1131056867 15:89380018-89380040 CTGTGTATGTGCAGAGAGACAGG - Intergenic
1132153167 15:99476518-99476540 CTGGGCTTGGGGAGAGATGCTGG - Intergenic
1132501499 16:286472-286494 CTGTGAGTGTTGAGGGAGGCAGG + Exonic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132641106 16:979031-979053 CTGGCCTTGTGGAGGGAGGCAGG - Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1133504657 16:6399437-6399459 CTGTGTTTTAGCAGAGAGTCTGG - Intronic
1134122919 16:11597339-11597361 CTGGGGGTGTGGGGAGAGGCTGG + Intronic
1134865183 16:17600511-17600533 CTGGGGTTGTGGGTAGAGGCTGG - Intergenic
1135321800 16:21502316-21502338 CCGTGCCTGCGGAGAGAGGCGGG + Intergenic
1136293146 16:29287760-29287782 CCGTGGCTGTGGGGAGAGGCAGG + Intergenic
1137253686 16:46758255-46758277 GTGTGTGTGTGGAGAGAGAGAGG - Intronic
1138069082 16:53972806-53972828 CAGTGTTTGTGGAGAGTGCAGGG + Intronic
1138919266 16:61507179-61507201 GTGTGTTTGTGGATAGAGCAGGG + Intergenic
1139433235 16:66922354-66922376 CTGTGTGGGTGGGGAAAGGCAGG + Intronic
1139647867 16:68344923-68344945 GTGTGTGTGTGTAGAGATGCAGG - Intronic
1140012789 16:71153118-71153140 CAGTGTTTGAGGACAAAGGCTGG - Intronic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1140507181 16:75481085-75481107 ATGTTTTTGTAGAGACAGGCAGG - Intronic
1140765532 16:78153592-78153614 CTATGTTTGTGGGGCGGGGCTGG + Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141249704 16:82344190-82344212 CTGTGTTTGTGTTCAGAGCCTGG + Intergenic
1142088454 16:88197291-88197313 CTGTGTCTGTACAAAGAGGCAGG - Intergenic
1142099030 16:88261767-88261789 CCGTGGCTGTGGGGAGAGGCAGG + Intergenic
1142103587 16:88289850-88289872 GTATGTTTGTGGAGTGAGGAGGG + Intergenic
1143584071 17:7842750-7842772 CTGTGTGTGTTCAGGGAGGCGGG + Intronic
1148290411 17:46443186-46443208 CTGTGCTTGTGGACTGAGGGAGG - Intergenic
1148312579 17:46660759-46660781 CTGTGCTTGTGGACTGAGGGAGG - Intronic
1148912826 17:50952252-50952274 CGGTGTGTGTGGGGAGAGGGAGG - Intergenic
1149525788 17:57354708-57354730 AGGAGTTTGAGGAGAGAGGCAGG + Intronic
1149684698 17:58528701-58528723 GTGGATTTGTGCAGAGAGGCAGG - Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1151213458 17:72561549-72561571 CTGTGTCTGGGGAGTCAGGCTGG - Intergenic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1152532125 17:80924789-80924811 GTGTGCTTGTGGAGTGAGGCTGG - Intronic
1152763916 17:82125186-82125208 TAGTGTTTGTGGGGAGGGGCTGG + Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154493112 18:14936404-14936426 ATGCGTTTGTGGAGGGAGGGAGG - Intergenic
1155311499 18:24528864-24528886 ATGTTTGTGTGAAGAGAGGCAGG + Intergenic
1155970913 18:32082894-32082916 CCCTGTTTGGGGAGAGAGGATGG - Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157881472 18:51325039-51325061 CTGTGTGTGGGCAGAGAGGTGGG + Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159994897 18:74955071-74955093 CAGTGTTTGAGGGGAGAGGAAGG + Intronic
1161088726 19:2347343-2347365 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088756 19:2347750-2347772 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088762 19:2347834-2347856 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088787 19:2348196-2348218 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088903 19:2350225-2350247 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088907 19:2350315-2350337 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088911 19:2350407-2350429 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1162401398 19:10448894-10448916 CTGTGATTGAGGACAGAGGCAGG - Intronic
1162761533 19:12891475-12891497 CTGTGCTTGCAGAGAAAGGCGGG + Exonic
1163447179 19:17353530-17353552 GTGTGTTTGAGGGAAGAGGCCGG - Intronic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1165070951 19:33254549-33254571 CTGTGCTGGTAGAGAGAGGCTGG + Intergenic
1165078446 19:33293864-33293886 CTGTGTTTCTGGTGAAAGGTTGG + Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166334389 19:42096367-42096389 CGGTGCTTGTGGAGGAAGGCGGG - Intronic
1166336032 19:42108152-42108174 CTGTAGTTGGGGAGATAGGCAGG - Intronic
1166516110 19:43448273-43448295 CTGTTTTTGAGGTGGGAGGCTGG + Intergenic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1167508317 19:49882685-49882707 CTGAGCTTGTGGACTGAGGCTGG + Intronic
1167509485 19:49888537-49888559 CTGTGTCCGTGGAGGGCGGCGGG - Exonic
1168116624 19:54224471-54224493 CTGTGTGTGTGGACAGGCGCTGG + Intronic
1168119607 19:54244254-54244276 CTGTGTGTGTGGACAGGCGCTGG + Intronic
1168126101 19:54284053-54284075 CTGTGTTTGTGGACAGACCCTGG + Intergenic
1168168613 19:54572171-54572193 CTGTGTGTGTGGACAGGCGCTGG - Intergenic
1168171186 19:54590736-54590758 CTGTATTTGTGGACAGAATCTGG - Intronic
1168175835 19:54627024-54627046 CTGTGTTTGTGGACAGACCCTGG - Intronic
1168184981 19:54694893-54694915 CTGTGTGTGTGGACAGGCGCTGG - Intronic
1168255972 19:55165575-55165597 CTGTGTTTGAAGGAAGAGGCTGG - Intronic
925176537 2:1788487-1788509 CTGTGTTCTGGGAGACAGGCAGG + Intergenic
925363238 2:3294372-3294394 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363290 2:3294605-3294627 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363362 2:3294935-3294957 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363369 2:3294974-3294996 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363413 2:3295220-3295242 GTGTATGTGTGGAGAGAGGACGG - Intronic
925363421 2:3295255-3295277 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363429 2:3295288-3295310 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363437 2:3295321-3295343 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363456 2:3295420-3295442 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363602 2:3296128-3296150 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363642 2:3296303-3296325 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925366851 2:3316554-3316576 CTGTGAGTTGGGAGAGAGGCAGG - Intronic
927272801 2:21231523-21231545 ATCTGTTTATGGAGAGAGGGAGG + Intergenic
927681329 2:25141412-25141434 ATGTGTTTGTGGAGAGGCCCAGG + Exonic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928192003 2:29179432-29179454 TTCTGTTTGTGAAGAGAGCCTGG + Intronic
928468486 2:31547848-31547870 CTATCTATGTAGAGAGAGGCGGG - Intronic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
931061722 2:58536885-58536907 CTGTTTTAGTGGAGAAAAGCAGG + Intergenic
932494831 2:72141149-72141171 CTCTTTGTGTGTAGAGAGGCTGG - Intronic
932842897 2:75100120-75100142 CTGAGTTTTTTCAGAGAGGCAGG + Intronic
932849863 2:75174040-75174062 CTGGGTTTTGGGAGTGAGGCAGG - Intronic
934557830 2:95296794-95296816 CTGTGTCTGTGAAGAGTGGCAGG + Intergenic
934847219 2:97669608-97669630 CTGTGTCTGTGGACAGTGACGGG - Intergenic
934990174 2:98915020-98915042 CTGTGACTGTGAACAGAGGCTGG - Intronic
935178868 2:100673086-100673108 CTGGGTTTGTCGGGAGAGGAAGG - Intergenic
935982028 2:108636804-108636826 CTCTGTGTGGGGAGAGAGGAAGG + Intronic
936808346 2:116364726-116364748 CTGTATTTATTGAGAGTGGCTGG - Intergenic
937260446 2:120582739-120582761 GTGTGTTTGTGGATGGTGGCTGG - Intergenic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
938726513 2:134113424-134113446 CAGTCTTGCTGGAGAGAGGCTGG + Intergenic
939417761 2:141923478-141923500 GTGTGTGTGTAGAGAGAGGGAGG + Intronic
940209117 2:151238277-151238299 GTGCGTGTGTGGAGAGAGGTGGG - Intergenic
941818340 2:169820899-169820921 GTGTGTGTGTGGGTAGAGGCAGG + Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
943851566 2:192729766-192729788 CTGTGTTAGTGTGGAGAGGTGGG + Intergenic
944133206 2:196369758-196369780 CTCTGTTTGTGGAAAGATGAGGG - Intronic
944655984 2:201877170-201877192 CTGTGTTTGTGTAGAGTGTCTGG - Intronic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946444333 2:219725519-219725541 GTGAGTTTGGGGAGACAGGCAGG - Intergenic
946714000 2:222534142-222534164 TTGTGTTTGTGGAGGAAGGAGGG + Intronic
946744292 2:222830324-222830346 CTGTGTGTGCTGAGATAGGCTGG - Intergenic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
947468854 2:230381701-230381723 GTGTGTGTGTGTAGAGAGACAGG - Intronic
948276804 2:236715189-236715211 GTGTGGTTGTGGTTAGAGGCTGG + Intergenic
948600909 2:239107027-239107049 CTTTGTCTGTAGAGAGGGGCTGG - Intronic
949061397 2:241960020-241960042 TGGTGTTTGTGGAGAAAAGCTGG - Intergenic
1168826369 20:817110-817132 TTGTGTGTGTAGAGAGGGGCAGG + Intergenic
1168961250 20:1871492-1871514 GTGTGTGTGTGGAGAGGGGGTGG - Intergenic
1169090937 20:2861038-2861060 CTGTGTCTGTGAAGAGTGCCAGG - Exonic
1171111361 20:22485559-22485581 CTTTGATTCTGGAGAGAGCCTGG + Intergenic
1171343101 20:24445760-24445782 CTGTGTTTGTCGTGGGAGTCAGG + Intergenic
1171428794 20:25065627-25065649 CTGAGTTTGAGCTGAGAGGCTGG - Intergenic
1172181563 20:33007062-33007084 ATGTGCATTTGGAGAGAGGCTGG + Intergenic
1173732343 20:45337702-45337724 CTGGGCTTCTGGGGAGAGGCAGG + Intronic
1173766240 20:45612274-45612296 CTCTGTGTGTGGAGGGAGACAGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174665844 20:52256983-52257005 CTGTGTCTGTGGGTAGAGGCCGG + Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175569237 20:60006531-60006553 TTGTGTTGGGGGAGAGAGGGAGG - Intronic
1175676199 20:60948839-60948861 CTGTGTTGGTGGGGACAGGGCGG - Intergenic
1178635544 21:34299086-34299108 ATGTGATTGAGGAGAGAGGGAGG - Intergenic
1178697944 21:34810115-34810137 TTGGGTTTGTGTAGAGAGGAAGG - Intronic
1178890203 21:36514651-36514673 GTGTGTGTGTGTAGAGAGACAGG + Intronic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1179188789 21:39106367-39106389 CTGTGTGTGTGGAGAGTGTTTGG - Intergenic
1179290465 21:40013776-40013798 CAGGGTTTGAGGAGAGAGCCAGG + Intronic
1181347834 22:22233256-22233278 CTGTGTTTCAGGAGAGAGCTTGG - Intergenic
1182394930 22:30028387-30028409 CTCTCTGTGTGGAGAGAGGGCGG - Intronic
1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG + Intronic
1182708272 22:32303371-32303393 TTGTGTTTTTGGTGAAAGGCTGG - Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1184384456 22:44166417-44166439 CCGTTTTTGAGGAGTGAGGCAGG + Intronic
1184395973 22:44240855-44240877 TTGTGTTTTTGGTGAAAGGCTGG - Intergenic
1184718607 22:46296296-46296318 CTGCGTTGGAGGAGAGAGCCAGG - Intergenic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185056571 22:48581854-48581876 CTGTGTTCCTGGAGAGGGGAGGG + Intronic
1185121247 22:48973063-48973085 CTGTCTTTGTGGGGAAAGCCCGG + Intergenic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
950948590 3:16976226-16976248 ATGTGTGTGTGGAGAGGGGTTGG + Intronic
951137833 3:19124441-19124463 CTGGCTTTGTGGTAAGAGGCAGG - Intergenic
951259106 3:20485370-20485392 GTGTGTATGTGGGGAGAGGGGGG + Intergenic
951393312 3:22133805-22133827 CTTTGTTTGTGGAGAAAAGTAGG - Intronic
952213013 3:31248350-31248372 CTGTGTTTGTGGAAGAAGCCTGG + Intergenic
952810657 3:37399608-37399630 GAGTCTTTGTGGACAGAGGCAGG + Exonic
954211198 3:49098453-49098475 CAGTGGTTGTGTAGAGAGTCTGG - Exonic
955936205 3:64105079-64105101 TTGTGTTTGGGGAGACAGGGAGG - Intronic
955947755 3:64211544-64211566 CTGTGTGTGTGGAAAGAGAGAGG + Intronic
956723592 3:72138969-72138991 CTGGGTTTGGAGAGAGGGGCAGG - Intergenic
957302826 3:78415058-78415080 CTTTTTTTCTGGAGAGAGTCAGG + Intergenic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
958801023 3:98756028-98756050 GTGTATGTGTGGAGAGAAGCTGG + Intronic
958899824 3:99872569-99872591 ATGTGTTTGTGGGGGCAGGCAGG - Intronic
959118449 3:102205817-102205839 CTCTGTTTGTAGAAAGAGGAAGG - Intronic
960903430 3:122574417-122574439 CTATTTTTTTGGAGAGAGGCTGG - Exonic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
961444113 3:126970877-126970899 ATGTTTTTTTGCAGAGAGGCAGG + Intergenic
961475052 3:127141005-127141027 CTGAGTTTGGGGAGAGATGATGG + Intergenic
961681833 3:128604559-128604581 CTGTGTTTCTGCAGCCAGGCAGG + Intergenic
962354374 3:134681131-134681153 CTGATTTTGAGGAGAGAGCCAGG + Intronic
963329151 3:143894799-143894821 CTGGGTTTGTGGGGAGCGGAGGG + Intergenic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964465745 3:156989810-156989832 CTGTGTGTGTGCAGAGAGAGAGG - Intronic
966142004 3:176767359-176767381 CTCTGCTTGTGGAAAGAGGAGGG + Intergenic
969136603 4:5034287-5034309 GTGTGTTTGGTGAGAAAGGCAGG - Intergenic
969413516 4:7044186-7044208 CTGAGTTCGTGGAGACAGGCAGG + Intronic
971214324 4:24649463-24649485 ATGTGTTTGTGGAGATGGGGTGG + Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971393625 4:26208800-26208822 ATTTGTTTGGGGAGACAGGCTGG - Intronic
972359656 4:38315208-38315230 CTGTGCGTGAGGAGAGAGGCTGG + Intergenic
972469512 4:39390223-39390245 TTGTGTGTGTGGAGAGAGAGAGG - Intergenic
973333582 4:48933998-48934020 CCGTGTTGGAGGAGAGAGGGAGG - Intergenic
976111850 4:81683831-81683853 TTGTCTTTGTGGAGAAAGGGAGG - Intronic
977303969 4:95299896-95299918 CTGTGTTTGTGGTAACAGGGAGG + Intronic
979395094 4:120178160-120178182 CTCTGTTTGTGGAAAGGGGAGGG + Intergenic
980693309 4:136323703-136323725 ATGTGTGTGTGGAGAGAGGGAGG + Intergenic
981196678 4:141929175-141929197 CTGTGATGGAGGAGAGAGTCTGG - Intergenic
981507085 4:145514135-145514157 CAGTGTGTGTGCATAGAGGCTGG + Intronic
981532891 4:145769647-145769669 CTATGTCTGTGGAAAGAGCCAGG + Intronic
982649079 4:158064200-158064222 CTGTGCTTTGGGAGAGAGACTGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985852603 5:2399656-2399678 CTGTGTTTGTGGAGTGGGAGGGG - Intergenic
986124710 5:4874387-4874409 CTTTGTTTGGGTAGAGATGCAGG + Intergenic
986763132 5:10898035-10898057 CTGGGGTGTTGGAGAGAGGCAGG + Intergenic
987077989 5:14402472-14402494 TGGTGTTGGTGTAGAGAGGCAGG + Intronic
988508678 5:31846750-31846772 TTGTGTTTGTGGAGAGCTGGTGG + Intronic
988636883 5:32994543-32994565 GTGTGTGTGTGTAGAGAGGGAGG - Intergenic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
989245312 5:39248062-39248084 CTGGGTGGGTGGAGAGAGTCAGG + Intronic
990321768 5:54636601-54636623 TTGTAGTTGTGGAAAGAGGCAGG - Intergenic
990323835 5:54655195-54655217 GTGTGTTTGTGGACTGAGTCGGG + Intergenic
992810773 5:80386296-80386318 GTGTGGTGGTGGAGAGGGGCAGG + Intergenic
994465494 5:100123854-100123876 GTGTCTTTTTGGAGATAGGCTGG - Intergenic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG + Intergenic
999268799 5:150284471-150284493 GTGTGCTTGTGGAGGGAGGTGGG + Intronic
999661916 5:153873650-153873672 CTGTGATTCTGGAGAGATTCTGG + Intergenic
1000126925 5:158254530-158254552 CTGAGACTGTGGAGAGAAGCTGG + Intergenic
1000314641 5:160077562-160077584 TTGTGTTTGTGGGGTGGGGCGGG + Intronic
1000540012 5:162527956-162527978 CTGTTATTGTGGAGAGAGGAAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001552168 5:172610988-172611010 CTGTGCTTGGGGAGAAAGGATGG + Intergenic
1001820438 5:174705956-174705978 GGGTATGTGTGGAGAGAGGCAGG - Intergenic
1002286645 5:178166872-178166894 CTGTTTCTGTGAAGAGAGGATGG - Intergenic
1002347143 5:178555919-178555941 CTCAGTCTGTGGGGAGAGGCTGG - Intronic
1002359930 5:178662386-178662408 CTGCGTCTGGGGAGAGAGGAGGG - Intergenic
1002531955 5:179852461-179852483 CGGTGTTTGTGGAGTGAGTAAGG - Intronic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1002923664 6:1592305-1592327 GTGTGTGTGTGGAGAGGGGTAGG - Intergenic
1003117471 6:3292903-3292925 CTCTGTTGGTGAAGAGAAGCTGG - Intronic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004386643 6:15178799-15178821 CTGTGTTTTAGTAGAGAGGAGGG - Intergenic
1005588083 6:27296355-27296377 GTTTGGTTTTGGAGAGAGGCGGG + Intronic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006974567 6:38087159-38087181 TTTTGTATGTGGAGAGAGACAGG - Intronic
1007110235 6:39309454-39309476 CTGTGTGTGTGGGGTGGGGCAGG + Intronic
1007409563 6:41653978-41654000 CTGGGGTGGAGGAGAGAGGCAGG - Exonic
1007679381 6:43624022-43624044 CAGTGTGTCTGGAGAGAGTCTGG - Exonic
1007729704 6:43938565-43938587 CCGTGTCTGTGGAGCGAGGCTGG + Intergenic
1008044275 6:46835557-46835579 CTGTGGCTGGGGAGACAGGCAGG + Intronic
1009439404 6:63658812-63658834 ATGTGATTGTGGAGACTGGCTGG + Intronic
1010175478 6:73023203-73023225 TGGTGTTTGAGGTGAGAGGCTGG + Intronic
1010556854 6:77292668-77292690 TTGAGTTTGTGGAGAGTGCCTGG - Intergenic
1011228448 6:85133752-85133774 CTGACTTTGTGAAGAGAGGAGGG - Intergenic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1013499914 6:110738953-110738975 ATGTTTCTGTGGTGAGAGGCAGG - Intronic
1014406031 6:121052347-121052369 CTGTGTTCATGGAGGGAGACAGG - Intergenic
1015367239 6:132409882-132409904 GTGTGTGTGTGGAGAGAGACAGG - Intergenic
1016292538 6:142540300-142540322 CTTAGTTTGTGGAGACAGGAGGG - Intergenic
1017090300 6:150753301-150753323 GTGTGTGTGTTGGGAGAGGCAGG + Intronic
1019067557 6:169315036-169315058 AAGTGTGTGTGGACAGAGGCAGG - Intergenic
1019067595 6:169315365-169315387 ATGAGTGTGTGGACAGAGGCGGG - Intergenic
1019067609 6:169315480-169315502 GTGTGTGTGTGGACAGAGGCAGG - Intergenic
1019067631 6:169315679-169315701 ATGAGTGTGTGGACAGAGGCGGG - Intergenic
1019067645 6:169315798-169315820 GTGTGTGTGTGGACAGAGGCAGG - Intergenic
1019067653 6:169315885-169315907 GAGTGTGTGTGGACAGAGGCGGG - Intergenic
1019067700 6:169316292-169316314 ATGAGTGTGTGGACAGAGGCAGG - Intergenic
1019786325 7:2979856-2979878 CGGTGTTTGTGGGCAGGGGCTGG + Intronic
1020052142 7:5088679-5088701 CTGTTCTTCTGGAGAGAGGCGGG - Intergenic
1020509072 7:9029917-9029939 CTGCCTTTGAGGAGAAAGGCGGG + Intergenic
1021575769 7:22104409-22104431 GTGTGTGTGTGTATAGAGGCAGG + Intergenic
1022729363 7:33008114-33008136 CTGTGATGGTGGAGACAGACGGG + Intergenic
1023143535 7:37126732-37126754 CTGTGGTGGTGAAGAAAGGCAGG - Intronic
1023297571 7:38731574-38731596 CTGTGGTTGCGAAGATAGGCTGG - Intronic
1023899322 7:44463231-44463253 ATGTGTTTTTGGGGAGGGGCAGG - Intronic
1024692116 7:51814358-51814380 CTGAGGTTTGGGAGAGAGGCTGG + Intergenic
1026490866 7:70862141-70862163 CTGTATTTTTGGATAGAGACAGG - Intergenic
1027570221 7:79856891-79856913 CTGTGTTTGGGGAGAGAGCATGG - Intergenic
1028759712 7:94482589-94482611 CAGTGTTTGTGAGGTGAGGCGGG - Intergenic
1031683892 7:124709058-124709080 CTCTGTCTTTGGAGAGAGGAAGG + Intergenic
1031929165 7:127666788-127666810 CTGTGTTTGATGACAGAGGGCGG + Intronic
1032023364 7:128422137-128422159 CTGTGTTTGTGGTGTGTGGGGGG + Intergenic
1032129790 7:129218666-129218688 CTGTTTTTTTGGAGACAGGGTGG - Intergenic
1033942078 7:146667155-146667177 CTTTGTATGTGGTGAGAGGTGGG + Intronic
1034041542 7:147882466-147882488 CTCTATCTGTGGACAGAGGCAGG - Intronic
1034205719 7:149313063-149313085 TTGTGTTTATGGCGAGAGGTAGG + Intergenic
1035219636 7:157398361-157398383 CTTTTTTTGGGGAGAGAGGGGGG - Intronic
1035232607 7:157475336-157475358 CTGTGTCTGTGGGGAGAGACTGG + Intergenic
1035358708 7:158295739-158295761 CAGTGTTTGGGCAGACAGGCAGG - Intronic
1035368708 7:158364759-158364781 CTGTGTGTGTGGACAGAGAGAGG - Intronic
1035636047 8:1145180-1145202 CTGTGTTTCTGGATGGTGGCTGG - Intergenic
1035636053 8:1145210-1145232 CTGTGTTTCTGTACAGTGGCTGG - Intergenic
1035894906 8:3388861-3388883 GTGTGTATGTAGAGAGAGGGAGG - Intronic
1036142981 8:6225463-6225485 CTGGGCTTGTGGAGGGTGGCAGG - Intergenic
1036166715 8:6441671-6441693 TAGTGTTAGTGGGGAGAGGCAGG - Intronic
1036285662 8:7442510-7442532 CTATGTTTGTGGAAAGAAGGAGG - Intergenic
1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG + Intergenic
1037338879 8:17820681-17820703 CTGTGTGTGTGTAGAGGGGGAGG - Intergenic
1037488391 8:19372516-19372538 ATCTGTTTTTGGAGAGTGGCTGG + Intronic
1037659520 8:20914983-20915005 GTTTGTGTGTGGAGAGAGGAGGG - Intergenic
1038586590 8:28795252-28795274 CTGTGATGGTACAGAGAGGCAGG + Intronic
1038649631 8:29390748-29390770 CTGTGTTTCTGAGGTGAGGCTGG + Intergenic
1039805334 8:40992731-40992753 CTCTGTTAGTGCAGAGTGGCTGG + Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1040818074 8:51529772-51529794 GTGTGGTTGTGGGGAGAGACTGG - Intronic
1041276604 8:56166363-56166385 CTGTGTTTGTGGGGGGAGCTGGG + Exonic
1041439148 8:57875023-57875045 ATGTGTCTGTGGACACAGGCTGG - Intergenic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1042572814 8:70185059-70185081 CTGTGTCTGTAGAGAGAAACTGG - Intronic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1044819720 8:96147445-96147467 CCTAGTTTGGGGAGAGAGGCAGG - Intronic
1044842504 8:96348988-96349010 CTCTGTTTGGGGTGAGAGGTGGG + Intergenic
1044982176 8:97727744-97727766 GTATGTATGTGGAGACAGGCTGG - Exonic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1045886033 8:107098793-107098815 CTGTGTTTTGGGAGAGATGGAGG + Intergenic
1047281753 8:123452085-123452107 CTGCGTTTGTGACAAGAGGCTGG - Intronic
1047287684 8:123502295-123502317 CTGTGTCTGTGGACAGAGTGGGG - Exonic
1047788963 8:128182798-128182820 CTGTGTTTCAGCAGAGAGGGAGG + Intergenic
1048707427 8:137169483-137169505 CTGTGTTTGTGGAACGAGGTTGG + Intergenic
1048788092 8:138073405-138073427 CTGTCGTTGTAGGGAGAGGCAGG - Intergenic
1049001263 8:139826813-139826835 CTGGGTTTCTGCAGAGAGGTTGG + Intronic
1049194132 8:141306375-141306397 ATGTGTTTCTAGAGAGAGGCTGG - Intronic
1049283213 8:141761093-141761115 CTGTGTTTGGGGACAGAGGTGGG - Intergenic
1049607638 8:143537069-143537091 CTGTGTCTGATGACAGAGGCAGG + Intronic
1053087749 9:35241408-35241430 CTATTTTTGTGGAATGAGGCAGG + Intronic
1053653327 9:40191434-40191456 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1053903729 9:42820724-42820746 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1055273598 9:74589354-74589376 GTGTGTTGGGGGAGAGAGGTGGG - Intronic
1056270991 9:84947959-84947981 CAGTGTTTGTGGGCACAGGCTGG + Intronic
1056753837 9:89370412-89370434 GTGTGTTTGTGGTGTGTGGCTGG + Intronic
1057403114 9:94742011-94742033 CTATGTTTGTGGGGAGGGGCTGG + Intronic
1057572299 9:96213923-96213945 CTGGTTTTGTGGAAAAAGGCGGG - Intergenic
1057648104 9:96895895-96895917 CTGTTTTTCTAGATAGAGGCAGG - Intergenic
1058617815 9:106852534-106852556 CTGTGTTTGTGTTTGGAGGCTGG - Intergenic
1058704936 9:107630256-107630278 CTCTGCCTGTGGAGGGAGGCTGG + Intergenic
1060868754 9:127022254-127022276 CTGTGTGTGTGGAGAAAGGGAGG - Intronic
1061405288 9:130390428-130390450 GTGTCTTTGTGTTGAGAGGCTGG + Intronic
1061883930 9:133582139-133582161 CTGTGTGTGTGCCGAGAGGACGG + Intronic
1061894020 9:133637606-133637628 CTGTGTCTGTGCGGAGCGGCCGG + Intronic
1062388759 9:136325880-136325902 CTGGGTTAGTGGTGGGAGGCTGG - Intergenic
1185579623 X:1201346-1201368 GTGTGTGTGTGTAGAGAGACAGG + Intronic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186664683 X:11705098-11705120 CTGTGTGTGGGGAGAGAGCCAGG + Intergenic
1187467827 X:19542288-19542310 TGGAGTGTGTGGAGAGAGGCGGG - Intronic
1189297129 X:39926713-39926735 CTTTTTTTTTGGAGAGAGGCAGG - Intergenic
1189892031 X:45612826-45612848 CTGGAGTTGTGGAGACAGGCTGG - Intergenic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190480226 X:50870147-50870169 CTGTGCCTGCAGAGAGAGGCAGG + Intergenic
1191891010 X:65940877-65940899 CTGTGCATGTGGAGAAAGGGAGG + Intergenic
1192397342 X:70795240-70795262 CTCTGCTTGTGGAAAGAGGAGGG + Intronic
1193210102 X:78797422-78797444 CTCTGCTTGTGGAAAGAGGTGGG - Intergenic
1193248429 X:79258957-79258979 GTGTCTTTGTGGAGAGAGGTAGG + Intergenic
1195008874 X:100715747-100715769 CTGTGTGTGTGTAGAGAGATGGG - Intronic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1197411086 X:126117211-126117233 CTGGGTTTGGGGAGAGAGGTGGG - Intergenic
1197594465 X:128449750-128449772 CTGTGTTTTAGTAAAGAGGCTGG - Intergenic
1197712860 X:129684560-129684582 GTGTGTGTGTAGAGAGAGACGGG + Intergenic
1197783140 X:130176274-130176296 GTGTGTGTGTGTAGAGAGGGAGG + Intronic
1197901142 X:131373676-131373698 GTGTGTGTGTGGAGAGAGAGGGG + Intronic
1198122928 X:133611830-133611852 TCATGTTTCTGGAGAGAGGCAGG + Intronic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1199327026 X:146511549-146511571 CTCTGTTTCTGGAGAAAGGGAGG - Intergenic
1200136650 X:153878504-153878526 CTGGCTTTGTAGGGAGAGGCCGG - Intronic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201944289 Y:19495470-19495492 ATGTGTGTGTGTAGACAGGCAGG - Intergenic