ID: 901032136

View in Genome Browser
Species Human (GRCh38)
Location 1:6313328-6313350
Sequence AGGTTGCGGCCAGAAAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901032133_901032136 -8 Left 901032133 1:6313313-6313335 CCAGCAGACAGGCAGAGGTTGCG 0: 1
1: 0
2: 0
3: 29
4: 219
Right 901032136 1:6313328-6313350 AGGTTGCGGCCAGAAAGTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 223
901032124_901032136 30 Left 901032124 1:6313275-6313297 CCAAGGGCTGAAGGCTGGAATGG 0: 1
1: 1
2: 23
3: 100
4: 453
Right 901032136 1:6313328-6313350 AGGTTGCGGCCAGAAAGTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901032136 Original CRISPR AGGTTGCGGCCAGAAAGTGG AGG Intronic
900158635 1:1213264-1213286 AGGTTGTGGCCAGGAAGGGAGGG - Intronic
901032136 1:6313328-6313350 AGGTTGCGGCCAGAAAGTGGAGG + Intronic
901073248 1:6534556-6534578 AGGTTGGGGCCAGTAAGGGCAGG + Intronic
902156630 1:14492908-14492930 AGGCTGCAGCGAGCAAGTGGTGG - Intergenic
903371698 1:22840542-22840564 CGCTTGCGCCCAGGAAGTGGAGG - Intronic
904560785 1:31395869-31395891 TGCTTGAGGCCAGGAAGTGGAGG - Intergenic
904785606 1:32980336-32980358 AGATTGCGGCCAGCAAGTGCTGG + Intergenic
907000188 1:50845231-50845253 AAGTTGCAGCCAGAAACTGCAGG - Intronic
907913999 1:58852375-58852397 AGGAGGAGGGCAGAAAGTGGAGG + Intergenic
909754045 1:79201250-79201272 AGCTTGAGGCCAGAAGTTGGAGG + Intergenic
912133856 1:106635627-106635649 AGGTTGCAGCTAGAAAGAGTTGG - Intergenic
915338487 1:155162571-155162593 AGCTTGAACCCAGAAAGTGGAGG - Intergenic
915631876 1:157159116-157159138 AGGTTGGGGGCAAGAAGTGGTGG - Intergenic
915897827 1:159825230-159825252 AGGTTGGGGGCAGATTGTGGAGG - Intergenic
916165323 1:161961607-161961629 GGGTTGCAGCCAGAAATTGTGGG + Exonic
917243252 1:172972300-172972322 AGGTTGGGGCCAGAATGTGTGGG + Intergenic
918213853 1:182375850-182375872 AGGTTGCAGCCAGACTGTGAGGG - Intergenic
920183620 1:204147421-204147443 AGGTTGCTGGGAGAAGGTGGGGG + Intronic
921868596 1:220112640-220112662 AGGTTGAGTCCAGGAGGTGGAGG - Intronic
922810578 1:228413441-228413463 AGGAGGCAGCCAGAAGGTGGGGG - Intronic
923053023 1:230402015-230402037 AAGCTGCTGCCAGGAAGTGGTGG + Intronic
924532597 1:244905881-244905903 TGCTTGCGCCCAGAAGGTGGAGG + Intergenic
1064794883 10:19000289-19000311 TGCTTGAGACCAGAAAGTGGAGG - Intergenic
1067105630 10:43364196-43364218 AGTGTGTGGCCAGAAATTGGGGG - Intergenic
1067166002 10:43867189-43867211 AGGTTGCAGCCAGACTGGGGAGG - Intergenic
1069008325 10:63343280-63343302 TGCTTGAGCCCAGAAAGTGGAGG + Intronic
1069584551 10:69589412-69589434 AGGATGCAGCCAGAAAGTCCAGG + Intergenic
1069868262 10:71517541-71517563 AGGTTGCAGCGAGAAGCTGGGGG + Intronic
1072187015 10:93049661-93049683 AGCTTGAGTCCAGAAGGTGGAGG - Intronic
1073349258 10:102808093-102808115 AGCTTGCGCCCAGAAGGTTGAGG + Intronic
1077613791 11:3660880-3660902 AGGCTGTGGTCAGGAAGTGGTGG + Intronic
1077906415 11:6538270-6538292 AGGTAGGGTCCAGAAAGTGATGG - Intronic
1079789002 11:24712335-24712357 AGCTTGAGCCCAGAAAGTCGAGG + Intronic
1080548112 11:33342017-33342039 AGGTTGAAGCTGGAAAGTGGAGG + Intronic
1081998474 11:47378907-47378929 AGGCTGACTCCAGAAAGTGGAGG - Intergenic
1083255937 11:61495524-61495546 AGCTTGAGGCCAGGAAGTTGAGG + Intergenic
1084365312 11:68693681-68693703 AGGTGGCAGCCAGAAGGTGAGGG + Intergenic
1085868506 11:80323191-80323213 AGGGTGCAGGCAGAAACTGGAGG + Intergenic
1086268332 11:85028688-85028710 AGGGAGAGGCCAGACAGTGGGGG + Intronic
1086598472 11:88603774-88603796 AGGTTGCTGACAGAATGTGTGGG + Intronic
1087108428 11:94435470-94435492 TGCTTGAGCCCAGAAAGTGGAGG + Intronic
1088635592 11:111817270-111817292 AGGATGAGGCAAGAAAGTGTTGG + Intronic
1088964379 11:114703237-114703259 AGGTTGAGGACAGAAAGTCATGG + Intronic
1089168170 11:116493635-116493657 AGGTTGAGGCCAGCAAATTGAGG + Intergenic
1089769188 11:120790625-120790647 ATGTTGGGGCCAGACTGTGGAGG + Intronic
1089978043 11:122749814-122749836 AGCTTGCGCCCAGAAGGCGGAGG - Intronic
1090192680 11:124785579-124785601 AGGCTGCCACCAGAGAGTGGGGG + Intronic
1090685037 11:129107126-129107148 ATGTTGAGGCCAAAAGGTGGAGG + Intronic
1091749526 12:3013788-3013810 AGGTTGAGGCCAGGAGTTGGAGG + Intronic
1094058985 12:26293470-26293492 AAGATGTGGCCAGACAGTGGGGG - Intronic
1094740049 12:33278817-33278839 TGGATGTGGCCAAAAAGTGGAGG - Intergenic
1095646748 12:44556937-44556959 AGGTTGGGGCCAGATGGTGAAGG + Intronic
1095813146 12:46392780-46392802 AGGTTTCACCCAGAAAGAGGAGG + Intergenic
1096611071 12:52802096-52802118 AGGTTGAGGCCAGGATGTGGAGG - Intergenic
1099891199 12:88590505-88590527 AGATTTCGGGCAGAAAATGGAGG - Intergenic
1100483357 12:95001542-95001564 AGCTTGAGCCCAGAAAGTTGAGG + Intronic
1103112041 12:118288830-118288852 AGGTTGAACCCAGGAAGTGGAGG + Intronic
1103127701 12:118438507-118438529 GGCTTGAGCCCAGAAAGTGGAGG + Intergenic
1103205851 12:119128380-119128402 TGGATGCTGCCAGGAAGTGGGGG - Intronic
1103923113 12:124409759-124409781 TGCTTGAGCCCAGAAAGTGGAGG - Intronic
1104885988 12:132108576-132108598 AGGTTGTGGCCAGAAAGCACGGG + Exonic
1106364429 13:29064340-29064362 AGGTTGGGGCCAGATTGTGGGGG + Intronic
1110114338 13:71793612-71793634 TGCTTGCAGCCAGGAAGTGGAGG - Intronic
1112463913 13:99626340-99626362 AGGTTGAGGCCAGACTGTGAAGG + Intronic
1114904543 14:27109850-27109872 AAGTTGGGTCCAGAATGTGGTGG - Intergenic
1117376531 14:55123078-55123100 AGGTGGAGGCCAGAACATGGTGG + Intergenic
1117805702 14:59488617-59488639 AGGTTGAGGCCAGAATGTGAAGG + Intronic
1120391931 14:83919853-83919875 AGGCTGCGGCGGGAAAATGGTGG + Intergenic
1120521609 14:85532627-85532649 AGGTTGAAGGAAGAAAGTGGGGG + Intronic
1121812999 14:96907905-96907927 AGGTTCAGGCCAGAAAAGGGAGG - Intronic
1122864445 14:104597191-104597213 AGGCTGCAGCCAGAAACAGGAGG + Intronic
1125486828 15:40116931-40116953 AGGGTGGGGCCAGAGAGAGGTGG - Intergenic
1125521146 15:40348450-40348472 AGGTTGAGGACACAAAGTGAAGG - Intergenic
1125737202 15:41935037-41935059 AGGGAGCAGCCAGGAAGTGGTGG - Intronic
1127551654 15:60044404-60044426 AGGTTGGGGCCAGCAGCTGGAGG + Intronic
1127662404 15:61112535-61112557 AGGTTGAGGCCAGGAAGTAAAGG + Intronic
1129572176 15:76699937-76699959 ATGCAGCTGCCAGAAAGTGGTGG + Intronic
1129880728 15:79004523-79004545 AGGATGAGGCCAGAGAGTGTAGG - Intronic
1134183494 16:12065583-12065605 AGGTTGAGGACAGACTGTGGTGG + Intronic
1137251912 16:46747289-46747311 AGGTTGGGGACAGGAGGTGGCGG + Intronic
1141335117 16:83147355-83147377 AGGGTGCAGGCAGGAAGTGGAGG - Intronic
1142059942 16:88022775-88022797 GGGATGCGGCCAGAGACTGGAGG - Intronic
1143467804 17:7149578-7149600 AGGTTGCTGCTACACAGTGGGGG + Intergenic
1143514502 17:7413076-7413098 AGATTCCGGCCTGAAAGTGCTGG + Intronic
1144181094 17:12753259-12753281 AGGATGAGGGCAGAAAGTGAGGG - Exonic
1144696606 17:17307964-17307986 AGCTTGAGCCCAGGAAGTGGAGG + Intronic
1146807369 17:35875695-35875717 AGGTTGGGGGCAGGAAATGGAGG - Intronic
1147918914 17:43904597-43904619 AGGTGCTGCCCAGAAAGTGGGGG + Intronic
1152073984 17:78147553-78147575 AGGATGGGGCAAGAAAGTGCAGG - Intronic
1152895874 17:82910999-82911021 AGGAGGTGGCCAGAAACTGGTGG - Intronic
1152929914 17:83104191-83104213 AGCTTGCAGGCAGGAAGTGGAGG - Intergenic
1153265110 18:3262151-3262173 AGGCTGTGGCCGGACAGTGGCGG - Intronic
1157812264 18:50705672-50705694 AGGTCGGGGACAGAAAGGGGAGG + Intronic
1160017951 18:75158524-75158546 AGGTTGCGGCCCGCAGGTGGAGG + Intergenic
1160020322 18:75175520-75175542 AGGTTGGGGAAAGAAAGTGAAGG + Intergenic
1161413273 19:4129288-4129310 GGCTTGAGCCCAGAAAGTGGAGG - Intergenic
1161659195 19:5535649-5535671 CGCTTGAGGCCAGGAAGTGGAGG + Intergenic
1161782724 19:6304108-6304130 GGCTTGAGTCCAGAAAGTGGAGG - Intergenic
1163589118 19:18181189-18181211 TGGTTGAGCCCAGAAGGTGGAGG - Intergenic
1165390106 19:35533869-35533891 AGGCTGCAGCCTGAAAGTGGCGG + Intronic
1165670248 19:37672298-37672320 AGGCTGAGCCCAGAAAGTTGAGG + Intronic
1167383082 19:49149703-49149725 AAGCTGCAGCCAGAAGGTGGGGG + Exonic
1167439191 19:49498664-49498686 TGCTTGAGCCCAGAAAGTGGAGG + Intronic
925812305 2:7712546-7712568 AGCTTGAGCCCAGGAAGTGGAGG - Intergenic
927871592 2:26627613-26627635 AGGGTGAGGCCAGGAAGTGGGGG + Intronic
929608369 2:43251061-43251083 AGGTTGCAGCCTGAGAGGGGTGG + Intronic
929750982 2:44713368-44713390 AGGGTGTGGCCAGAGTGTGGGGG + Intronic
930451649 2:51546592-51546614 TGGGTGCTGTCAGAAAGTGGGGG - Intergenic
931777832 2:65555324-65555346 AGTGTGAGGCCAGGAAGTGGAGG + Intergenic
933299056 2:80522352-80522374 AAGTTGGGGTCAGACAGTGGAGG + Intronic
933721789 2:85401740-85401762 AGGTTGGGCCCAGGAAGGGGAGG - Intronic
934709270 2:96504325-96504347 TTTTTGCAGCCAGAAAGTGGGGG + Intronic
937445197 2:121951528-121951550 AGGTTGGGGCTAGCAAGTGGCGG - Intergenic
940780298 2:157926170-157926192 AGCTTGAACCCAGAAAGTGGAGG + Intronic
941007797 2:160265228-160265250 TGGTTGAGCCCAGGAAGTGGAGG + Intronic
942695380 2:178636733-178636755 AAGTTAAGGCCAGGAAGTGGTGG - Exonic
943683610 2:190793397-190793419 AGGTTCTGGCCAGAAACTGGGGG + Intergenic
943901325 2:193441227-193441249 ATCCTGCGGCCAGAGAGTGGGGG + Intergenic
944203233 2:197131022-197131044 ATGTCACAGCCAGAAAGTGGAGG - Intronic
944718309 2:202397580-202397602 TGTTTGAGCCCAGAAAGTGGAGG - Intronic
944767319 2:202877578-202877600 AGCTTGAGCCCAGAAGGTGGAGG + Exonic
944809883 2:203317547-203317569 AGCTTGAGCCCAGGAAGTGGAGG + Intergenic
946204260 2:218092096-218092118 AGGGTGAGGGGAGAAAGTGGGGG + Intergenic
946530483 2:220564908-220564930 AGCTTGAGCCCAGGAAGTGGAGG - Intergenic
946737943 2:222773328-222773350 AGGATGCGGCCAGACACTGATGG + Intergenic
946810548 2:223520154-223520176 TGCTTGAGGCCAGAACGTGGAGG - Intergenic
947271499 2:228341291-228341313 AGGTTGCTGCTATACAGTGGTGG + Intergenic
947772872 2:232684819-232684841 AGCTTGAGCCCAGGAAGTGGAGG + Intergenic
1171063955 20:21994873-21994895 AGGTTGTGGCCAGACTCTGGAGG + Intergenic
1172572953 20:35984567-35984589 AGGCTGAGGACAGGAAGTGGAGG + Intronic
1172954703 20:38748133-38748155 AGCTGGCAGCCAGAAAGGGGCGG + Intergenic
1173024704 20:39297178-39297200 TGCTTGGGCCCAGAAAGTGGAGG - Intergenic
1173521774 20:43705284-43705306 AGTGTGCAGCCAGAAGGTGGTGG + Exonic
1174826877 20:53776498-53776520 AGGTCCCAGCTAGAAAGTGGTGG - Intergenic
1178357928 21:31923835-31923857 AGGTTGGGTCCTGACAGTGGGGG + Intronic
1181099933 22:20532241-20532263 AGGTGGCAGTCAGAAAGTGAAGG + Intronic
1183254988 22:36756467-36756489 AGGATGCTGCCAGGAAGAGGGGG - Intergenic
1183612078 22:38915819-38915841 GGGTTGCTGCCACACAGTGGAGG - Intergenic
1183868985 22:40726352-40726374 AGCTTGAGCCCAGAAGGTGGAGG + Intergenic
1185329034 22:50243532-50243554 TGCTTGAGCCCAGAAAGTGGAGG + Intronic
949891327 3:8735688-8735710 AGGTTGGGGCCAGATTGTGTTGG - Intronic
949894841 3:8761374-8761396 ACCTTGGGGCCAGATAGTGGGGG + Intronic
950634686 3:14306612-14306634 TGGCTGCTGTCAGAAAGTGGGGG - Intergenic
950681869 3:14590998-14591020 GGGTTGGGGCCAGATTGTGGAGG - Intergenic
951270154 3:20614847-20614869 AGTTTGTGGCCAGATTGTGGGGG + Intergenic
953536899 3:43783417-43783439 GGGTTGCAGCTAGAAACTGGTGG + Intergenic
953694838 3:45149499-45149521 AGGTTGGGGCCAGACAGCTGGGG - Intergenic
954834869 3:53457281-53457303 AGGTTGCTGCAATAGAGTGGGGG + Intergenic
955068986 3:55556435-55556457 AGCTTCTGGACAGAAAGTGGAGG - Intronic
960744049 3:120866761-120866783 CGCTTGAGGCCAGGAAGTGGAGG - Intergenic
961107112 3:124251451-124251473 AGCTTGAGCCCAGAAGGTGGAGG - Intronic
962912196 3:139863169-139863191 AGGTTGGGGCCAGAAATGGAAGG + Intergenic
963116419 3:141733812-141733834 AGGTTGGGGCCATATTGTGGTGG + Intergenic
964801027 3:160557756-160557778 CGCTTGAGCCCAGAAAGTGGAGG - Intronic
964902443 3:161675927-161675949 AGGATGGGGGCAGAGAGTGGTGG - Intergenic
965322394 3:167265950-167265972 GGGTTGCTGCCAGGAGGTGGGGG + Intronic
966537717 3:181052912-181052934 GGCTTGAGTCCAGAAAGTGGAGG - Intergenic
967943088 3:194781166-194781188 GGGTTGGTGCCAGACAGTGGTGG - Intergenic
968208738 3:196828302-196828324 AGGATGCTGCCAGAAAGAAGGGG - Exonic
970010607 4:11454781-11454803 TGGTTGAGCCCAGGAAGTGGAGG + Intergenic
972362164 4:38336818-38336840 AGCTTGAGCCCAGGAAGTGGAGG - Intergenic
972768386 4:42172634-42172656 AGGCTGCAGAGAGAAAGTGGAGG - Intergenic
976640014 4:87328213-87328235 AGCTTGAGCCTAGAAAGTGGAGG + Intergenic
976922397 4:90456001-90456023 AAATTGCAGCCAGAAACTGGTGG + Intronic
977079485 4:92506224-92506246 AGCTTGATGCCAGAATGTGGTGG + Intronic
977335972 4:95700143-95700165 AGCTTGAGCCCAGGAAGTGGAGG - Intergenic
978609404 4:110520875-110520897 AGGTGGCGGAGAGAAAGTAGGGG - Intronic
981028935 4:140104554-140104576 AGGTTGAGCCCAGGAGGTGGAGG - Intronic
982770397 4:159391714-159391736 AGGGTGCAGTTAGAAAGTGGTGG + Intergenic
983343312 4:166494422-166494444 TGGTTTGGTCCAGAAAGTGGGGG - Intergenic
983626571 4:169807600-169807622 AGGCTGCCCCCAGAAAGAGGGGG + Intergenic
984868015 4:184299720-184299742 GGGCTGTGGCCAGACAGTGGCGG + Intergenic
986074958 5:4326900-4326922 AGGTTGAGGGCAGCAGGTGGAGG - Intergenic
986316633 5:6593336-6593358 AGGAGGTGGCCAGAATGTGGGGG + Intergenic
988458607 5:31411708-31411730 AGCTTGAGTCCAGAAGGTGGAGG - Intronic
988769985 5:34422668-34422690 TGGTTCTGTCCAGAAAGTGGGGG - Intergenic
989986495 5:50705299-50705321 AGGTTGCTGACAAAAATTGGTGG + Intronic
990185697 5:53206779-53206801 AGCTGGGGGCCAGGAAGTGGTGG - Intergenic
992942073 5:81772407-81772429 AGGTTGAACCCAGAAAGTGAGGG + Intergenic
999974153 5:156894183-156894205 AAGTTGTGGCTAGAAAATGGTGG - Intergenic
1000122987 5:158215533-158215555 AGATTGTGGCAAGAGAGTGGCGG + Intergenic
1002303591 5:178271051-178271073 AGGGTGGGTCCAGAGAGTGGGGG + Intronic
1005990403 6:30898606-30898628 AGGTCAGGACCAGAAAGTGGGGG + Intronic
1007378294 6:41470862-41470884 AGCTTTGTGCCAGAAAGTGGGGG + Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007952257 6:45882989-45883011 GTGGTGTGGCCAGAAAGTGGTGG + Intergenic
1013246677 6:108294038-108294060 GGGTTGCGTCCAGGAGGTGGAGG - Intergenic
1013855379 6:114566059-114566081 AGGTTGCAGCCACAAATTTGAGG + Intergenic
1014531875 6:122568822-122568844 TAGGTGTGGCCAGAAAGTGGAGG + Intronic
1014921911 6:127223493-127223515 AGGTATAGGCCAGAAACTGGAGG - Intergenic
1015501763 6:133941908-133941930 AAGTTGGGGGAAGAAAGTGGAGG - Intergenic
1015633586 6:135254699-135254721 AGGGTGTGGCTAGAGAGTGGAGG - Intergenic
1017059183 6:150465288-150465310 AGGGTGCAGACAGAAAGTGCTGG + Intergenic
1018442869 6:163829080-163829102 AGCTTGCAGCCAGACTGTGGAGG + Intergenic
1019859551 7:3644687-3644709 AGCTTGAGGCCAGAAGTTGGAGG + Intronic
1020449735 7:8307276-8307298 AGGCTGGGGCAAGAAAGTGAAGG - Intergenic
1025953321 7:66163213-66163235 AGGTTGAGCCCAGGAGGTGGAGG + Intergenic
1029550382 7:101234272-101234294 AGTTACCGGCCAGAATGTGGAGG + Exonic
1029624457 7:101711391-101711413 TGCTTGAGGCCAGTAAGTGGAGG + Intergenic
1033078332 7:138270344-138270366 TGGTTGAGCCCAGAAAGTTGAGG - Intergenic
1033168460 7:139062485-139062507 AGGAAGCAGCCAGAAAATGGAGG - Intronic
1034237033 7:149580039-149580061 ATGCTGAGGCTAGAAAGTGGTGG + Intergenic
1035535305 8:386383-386405 ATGTGGAGGCCAGAAAGTGGAGG + Intergenic
1036396207 8:8373531-8373553 GGCTTGAGCCCAGAAAGTGGAGG - Intronic
1036463268 8:8973188-8973210 CGCTTGGGGCCAGAAAGTGCTGG - Intergenic
1036923813 8:12884135-12884157 TGGTTGAGGCCAGAAATTCGAGG + Intergenic
1037274150 8:17159327-17159349 AGGTTGGGACCAGAGTGTGGGGG + Intronic
1039669398 8:39579473-39579495 AGGTTGGGGTGAGGAAGTGGAGG + Intergenic
1039817470 8:41107183-41107205 AGGTGGCCTCTAGAAAGTGGAGG + Intergenic
1041416322 8:57612866-57612888 AGGCTGAGGCCAGAGAATGGCGG + Intergenic
1042239878 8:66652527-66652549 AGCTTGAACCCAGAAAGTGGAGG + Intronic
1042810381 8:72819259-72819281 CGGTTGCTGCCATGAAGTGGGGG - Intronic
1044306270 8:90645164-90645186 AGGAAGCGGCCTGAAAGTGGTGG - Exonic
1044429843 8:92095715-92095737 AGGATGGGGCCAGAAAGTGGGGG + Intronic
1044874275 8:96648898-96648920 AGGTTAGGGCCAGACAGTGATGG + Intronic
1047063183 8:121250789-121250811 AGGGTGGGGCAAGACAGTGGTGG - Intergenic
1048981774 8:139706307-139706329 AGCTTGGGGCCAGAAAGCAGCGG - Intergenic
1049920496 9:358763-358785 CGCTTGAGCCCAGAAAGTGGAGG + Intronic
1050066371 9:1763848-1763870 AGGTTGAGCCCAGGAAGTGGAGG + Intergenic
1050250965 9:3744653-3744675 AGACTGGGGACAGAAAGTGGGGG - Intergenic
1051369200 9:16343950-16343972 AGGTTGGGGGATGAAAGTGGAGG - Intergenic
1051409948 9:16779218-16779240 AGCTTGAGCCCAGAAGGTGGAGG + Intronic
1051590584 9:18773168-18773190 AGATTGAGCCCAGATAGTGGAGG - Intronic
1052617177 9:30855575-30855597 AGGTTCCGCCCAGGAAGTGGAGG - Intergenic
1052940726 9:34130091-34130113 AGCTTGAGCCCAGAAGGTGGAGG + Intergenic
1056138380 9:83650702-83650724 TGGATGCTGTCAGAAAGTGGGGG + Intergenic
1057525919 9:95801067-95801089 AGGATGTGGCCAGAAGGTGGGGG - Intergenic
1058145497 9:101406462-101406484 AGGTAGAGGACAGAAAGTTGAGG + Intronic
1059688523 9:116661193-116661215 AGGTTGTGGCCAGTAACAGGAGG + Intronic
1061003530 9:127915909-127915931 AGCTTGCGGGCAGAAAATGGTGG - Intronic
1189358846 X:40332666-40332688 AGGCTGGGGCCAGAAACTGATGG + Intergenic
1191797439 X:65035433-65035455 GGGTTGAGACCAAAAAGTGGTGG - Intergenic
1191817954 X:65269581-65269603 TGCTTGTGGCCAGAAAGTTGAGG - Intergenic
1196742189 X:119034721-119034743 AGCTTGAGCCCAGGAAGTGGAGG + Intergenic
1197776070 X:130119499-130119521 AGATTGGGGACAGAAAGAGGGGG + Intergenic
1198279712 X:135129729-135129751 TGGATGCTGCCAGGAAGTGGGGG - Intergenic
1198291245 X:135242785-135242807 TGGATGCTGCCAGGAAGTGGGGG + Intergenic
1198525363 X:137494947-137494969 AGGTTGTGGCCAGATTGAGGAGG - Intergenic
1199025534 X:142932765-142932787 TGGTTGCATCCAGAAAGTTGGGG + Intergenic
1200206758 X:154321858-154321880 AGGTGGTGGCCAGAGAGAGGAGG + Intronic
1200245982 X:154525935-154525957 CGCTTGAGGCCAGGAAGTGGAGG - Intergenic