ID: 901032142

View in Genome Browser
Species Human (GRCh38)
Location 1:6313375-6313397
Sequence CTGGCTTCTGAGGTTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901032142_901032146 12 Left 901032142 1:6313375-6313397 CCAGCAAAAACCTCAGAAGCCAG 0: 1
1: 0
2: 3
3: 26
4: 260
Right 901032146 1:6313410-6313432 AAACGCTTCCAAGCCCTGTAAGG 0: 1
1: 0
2: 1
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901032142 Original CRISPR CTGGCTTCTGAGGTTTTTGC TGG (reversed) Intronic
900495377 1:2973742-2973764 CTGGCTTCTGAGGCTCTGGCAGG + Intergenic
901032142 1:6313375-6313397 CTGGCTTCTGAGGTTTTTGCTGG - Intronic
901062155 1:6476630-6476652 CTTGCCTCTGAGGTTATTACAGG + Intronic
901903367 1:12386727-12386749 CTGGATTCTGGGGTTGTTTCAGG - Intronic
903065426 1:20696806-20696828 CTGACTTCTCTGGTTTCTGCGGG + Intronic
903779080 1:25810241-25810263 CAGGGCTCTGAGGGTTTTGCTGG + Intronic
904718246 1:32485617-32485639 TTGGTTTCTGAGGGCTTTGCTGG + Exonic
904912887 1:33948699-33948721 CTGGCTTCTGAGGGCTGTTCTGG - Intronic
905956265 1:41999711-41999733 TTGACTTCTTAGGTTCTTGCTGG - Intronic
906462087 1:46042403-46042425 GTGGTTTCTGAAGCTTTTGCAGG - Exonic
906880126 1:49580724-49580746 CTGGCCTGTGTGGTTTCTGCTGG + Intronic
907476347 1:54708487-54708509 CTGGCTCCTGCAGTATTTGCAGG - Intronic
908587670 1:65590330-65590352 GTGACTTCTGTGGTTTTTCCTGG + Intronic
909125912 1:71669488-71669510 CTGTCTTTTGATGTTTTTACTGG + Intronic
909400725 1:75226638-75226660 CTCCCTTCTGAGGTTCTTTCTGG + Intronic
909867416 1:80690913-80690935 CTGCCTTTTGAGTCTTTTGCTGG - Intergenic
913160286 1:116139142-116139164 CTGAGATCTGAGGGTTTTGCAGG + Intergenic
915478431 1:156168518-156168540 CTGGCCTCTCAGGTTTTTGTTGG + Intronic
915718675 1:157967503-157967525 ATGGGTTCTGAGCTTCTTGCTGG - Intergenic
915832265 1:159142029-159142051 ATGGCTTCTGCGTTTTCTGCAGG - Intronic
916742858 1:167661578-167661600 GTGGCTGCTGTGGCTTTTGCAGG - Intronic
916925926 1:169520912-169520934 CTGTCTTCTGAGCTCTTTTCAGG - Intronic
917114374 1:171587328-171587350 CTGGGGTTTGAGATTTTTGCAGG - Intronic
917944593 1:179955295-179955317 CTGGGTTCTGAGGCTTTTCGGGG + Intronic
918441935 1:184576419-184576441 CCGGCTTCTGTGGCTTTTGAGGG + Intronic
918694075 1:187521180-187521202 CTGCCTTGTGAGGTTTTGGCAGG + Intergenic
919983519 1:202657437-202657459 CTGGCTTCTTAGGCATTTGAAGG + Intronic
920921224 1:210298792-210298814 CTGGCATTTGAGGTTTTTAAGGG + Intergenic
924621296 1:245663487-245663509 CTTGCATCTGTGGTTTCTGCTGG + Intronic
1063885251 10:10570874-10570896 CATGTTTCTGAGATTTTTGCAGG + Intergenic
1064770285 10:18715978-18716000 CTCTGTTCTCAGGTTTTTGCAGG + Intergenic
1066993301 10:42538047-42538069 CTGGCTTGTAGGGTTTCTGCAGG + Intergenic
1068911352 10:62381629-62381651 CTGGCATCTGAGGTGTTGGGAGG + Intronic
1070716217 10:78723834-78723856 CTGGCATCTGAAGTTTCTGAGGG - Intergenic
1071135557 10:82449480-82449502 CTGGCTTCTGAGATTGCTGTAGG + Intronic
1073617182 10:105007824-105007846 CTGCCTTCTGAGCTCTTTGAAGG - Intronic
1073622501 10:105063759-105063781 CTGGATTCTGAGCTCTTTGAAGG - Intronic
1073822279 10:107277872-107277894 CTGGGTCCTAAGGTTCTTGCGGG + Intergenic
1076202452 10:128569323-128569345 ATGGCTGCTGTCGTTTTTGCTGG + Intergenic
1076873330 10:133204141-133204163 CTGGCTTCTGAGGATGGTGGTGG - Intronic
1079738937 11:24034049-24034071 CTGGCTTGTAGGGTTTCTGCTGG + Intergenic
1079813046 11:25019776-25019798 CTGACTTCTGAGGTTTCTTGAGG + Intronic
1086532170 11:87799522-87799544 CTGGCTTGTAGGGTTTCTGCAGG + Intergenic
1086555710 11:88108976-88108998 CTGGCTTGTAGGGTTTCTGCAGG + Intergenic
1087925334 11:103912281-103912303 CTGGCTTGTAGGGTTTCTGCCGG - Intronic
1089657012 11:119955725-119955747 CTGGCTGCTGAGATCTTAGCTGG - Intergenic
1089931660 11:122319169-122319191 TTGGCTTCTGAGGAATGTGCTGG - Intergenic
1089949481 11:122511963-122511985 ATGGCTTCTGGGGTTTGTGTTGG - Intergenic
1090860954 11:130651891-130651913 CTGGGTTCAGCGGTTTTTGCTGG + Intergenic
1090933396 11:131320126-131320148 CTGCCTCCTGTGGTTTTTCCTGG - Intergenic
1092569953 12:9710611-9710633 CTAGGGTCTCAGGTTTTTGCAGG - Intergenic
1093689129 12:22089818-22089840 CTGACTGCTGCAGTTTTTGCTGG - Intronic
1094550763 12:31448878-31448900 CTTGCTTCTGATGGTTTTTCAGG - Intronic
1095126451 12:38483916-38483938 CTGGCTTATGATGTTGTTACTGG + Intergenic
1096808330 12:54154210-54154232 CAGGCCTCTGAGGTTGTTGCTGG - Intergenic
1096926669 12:55155784-55155806 CTGGCTTGTAAAGTTTCTGCCGG + Intergenic
1097067029 12:56328187-56328209 GTGGGGTCTGAGGTTGTTGCGGG - Intronic
1097536137 12:60872915-60872937 CTGAGTCCTGAGGTTTTTGTGGG + Intergenic
1098223846 12:68299989-68300011 CTGCCTTGTAAGGTTTCTGCTGG - Intronic
1099253541 12:80288237-80288259 CTGGCTTATAGGGTTTCTGCAGG + Intronic
1100219067 12:92484237-92484259 CTGGCTTCTGAGATTTCTTGAGG - Intergenic
1101308370 12:103553941-103553963 CTTCCTTCTGAGGGATTTGCTGG - Intergenic
1101804109 12:108048406-108048428 CAGCCTTCTGAGGTTTGTGGAGG + Intergenic
1105672511 13:22635407-22635429 CTGGCTTGTAGGGTTTCTGCAGG + Intergenic
1106079388 13:26487905-26487927 CTGGCTTCCCAGGTTGTGGCAGG - Intergenic
1108403854 13:50081103-50081125 CAGGCTTTTGAGGTTGTAGCGGG - Intergenic
1110201608 13:72857275-72857297 ATGGCTTCTTAGGTTTTTAATGG - Intronic
1111607809 13:90563595-90563617 CAGGCTTTTGAGGTTTTGCCGGG - Intergenic
1111823396 13:93240977-93240999 CTGGCTTGTGAGTTTTTTGCTGG + Intronic
1113482977 13:110635187-110635209 CTGGGTTCTGAGAGCTTTGCAGG - Intronic
1113485873 13:110652055-110652077 CTGTCTTCTGAGGTGGTGGCAGG - Intronic
1114393872 14:22339048-22339070 CTGGCTTCTGGGTGTTTTGTTGG - Intergenic
1116541826 14:46109467-46109489 CTGAGTTCTGAAGTTTTGGCTGG + Intergenic
1116565645 14:46440863-46440885 CTGTCTTTTTAGATTTTTGCTGG - Intergenic
1117442414 14:55772374-55772396 CTGGCTTCTGAGCAATTTGTGGG + Intergenic
1119851448 14:77869312-77869334 CTAGCTTCTGGGGGGTTTGCTGG + Intronic
1120596725 14:86448839-86448861 CTGGCTGCTGAGTTTCCTGCTGG + Intergenic
1120867175 14:89305249-89305271 CTGACTTCAGACGTTTATGCTGG + Intronic
1122232757 14:100315074-100315096 CAGGCTTCTGGGGTCCTTGCAGG + Intergenic
1122293620 14:100692971-100692993 AGGGCTTCAGAGGTTTTGGCAGG - Intergenic
1122368245 14:101211348-101211370 TTGGCTTGTGATGTTTTTGTCGG + Intergenic
1124452205 15:29805283-29805305 CTGGGATCTGAAGTTTTGGCAGG - Intronic
1126835647 15:52661906-52661928 CTGGCTTGTAAGATTTCTGCTGG - Intronic
1129864053 15:78889199-78889221 CTGGCTTCTGAGTCTTTTGAAGG + Intronic
1129922154 15:79328694-79328716 CTTGCTTCTGTGGTTTCTCCAGG - Intronic
1130077651 15:80703447-80703469 ATGGCTTCTGAGGTGTCTTCTGG + Intronic
1131119156 15:89812477-89812499 GGGCCTTCTGAGGTTCTTGCAGG - Intronic
1131316580 15:91343810-91343832 TTTGCTTCTGAGATTTTTGAGGG + Intergenic
1131907491 15:97159157-97159179 CTGGCTTCTCAGGTTGTTATGGG - Intergenic
1132153117 15:99476120-99476142 CTGGGTTCTGGGGTTTTGGAAGG - Intergenic
1133420588 16:5643099-5643121 CTGGCTGCTGAGGCTTTTAGAGG - Intergenic
1134415973 16:14043695-14043717 CTAGCTCCTGAGGTTATTGAAGG + Intergenic
1135659895 16:24287061-24287083 CTAGCTTCTGAGTTGTTTGCAGG - Intronic
1136054410 16:27677707-27677729 CTCTCTTCTGGGCTTTTTGCAGG + Exonic
1136855266 16:33650564-33650586 CTGGCTTGTAGGGTTTCTGCAGG - Intergenic
1138304081 16:55958219-55958241 CTGGATTCTGGGGTCTTTGTTGG - Intergenic
1203116851 16_KI270728v1_random:1499045-1499067 CTGGCTTGTAGGGTTTCTGCAGG - Intergenic
1143428500 17:6861106-6861128 CTGGCTTGTAGGGTTTCTGCTGG + Intergenic
1144170277 17:12653361-12653383 CAGGCTTCTGAGTTTTCTGAAGG - Intergenic
1144898899 17:18565249-18565271 CTGGCTTATAAGGTTTTTGCCGG - Intergenic
1145897874 17:28471046-28471068 CTGGCTTCTTCAGTCTTTGCTGG - Intronic
1145952195 17:28827398-28827420 CTGGATTGTGAGCTTTTTGTAGG - Intronic
1146198417 17:30832608-30832630 TTGGATTCTGAGATATTTGCGGG + Intronic
1147255187 17:39177109-39177131 CTGGTGTCTGTGGTTTTTGATGG - Intronic
1149828338 17:59849747-59849769 CTGGTGTCTGAGTTTTTTTCTGG - Intergenic
1150897646 17:69232893-69232915 CTGGCCTGTAAGGTTTCTGCTGG + Intronic
1151007257 17:70451909-70451931 CTGGATTCCTAGGTTTTTGGGGG + Intergenic
1151443857 17:74150686-74150708 CTGGCTTTCGAGGATTTTCCTGG - Intergenic
1153864227 18:9248185-9248207 CTTGCTTGTGGGGATTTTGCTGG + Intronic
1156288728 18:35725172-35725194 CTGGCTTGTAAGGTTTCTGCTGG - Intergenic
1156290121 18:35740900-35740922 CTGGTGTTTGAGGTTTTTACAGG + Intergenic
1159646262 18:70921656-70921678 GAGGCTGCTGAGGTTTTTGTGGG - Intergenic
1161174433 19:2832356-2832378 GTGACTTGTGAGGTTTGTGCTGG - Exonic
1163658088 19:18559565-18559587 CTGACTTCTGATGTTTCTCCAGG - Exonic
1167412570 19:49353662-49353684 CTGGGGGCTGAGGGTTTTGCAGG - Intronic
925396538 2:3537291-3537313 CTGGCCACTGGGGTTTCTGCTGG + Intronic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
927744577 2:25605404-25605426 GTGGCTTCTGAACTTTTTGGAGG - Intronic
928763848 2:34617527-34617549 CTTGCTTCTGAAGTCTTTGGGGG - Intergenic
929742531 2:44618339-44618361 ATGGATACTGAGCTTTTTGCTGG + Intronic
931222917 2:60304511-60304533 CTGGCTTCTGTGGTTTTAATTGG + Intergenic
931546084 2:63389201-63389223 CTGGCTTGTAATGTTTCTGCAGG - Intronic
931889846 2:66660130-66660152 CTGGCTTATAAGGTTTCAGCTGG + Intergenic
935399620 2:102646105-102646127 CTGGCTTGTAGAGTTTTTGCAGG - Intronic
935509903 2:103958848-103958870 GTGGCTGCTGCTGTTTTTGCTGG + Intergenic
935605138 2:104964721-104964743 CTGGCCTCTAAAGTTTCTGCTGG + Intergenic
936602784 2:113915266-113915288 CTGGCTTCTGATGTTTCCTCAGG + Intronic
936975523 2:118217702-118217724 CTGCCTTCTGAAGTTGTTGTGGG + Intergenic
937552783 2:123114967-123114989 CTGGCTTATAAGACTTTTGCTGG - Intergenic
937570294 2:123349854-123349876 GAGGCTTGTGAGGGTTTTGCAGG - Intergenic
938128801 2:128693497-128693519 GTGGCCTGTGATGTTTTTGCTGG + Intergenic
940815460 2:158292671-158292693 CTGCCTTCTGAGTTTCTTGCTGG + Intronic
940847334 2:158656205-158656227 CTGGATCCTGGGGGTTTTGCTGG - Intronic
940964696 2:159823751-159823773 CTGGCTTGTAAAGTTTCTGCAGG - Intronic
942051513 2:172145256-172145278 CTGTCTTCTGAGTTATTTGGTGG + Intergenic
942065637 2:172269042-172269064 CTGGCTTGTGGGGTTACTGCTGG + Intergenic
942549501 2:177100342-177100364 CTAACTTCTGTGTTTTTTGCAGG - Intergenic
942856699 2:180557136-180557158 CTGGCTTGTAGGGTTTCTGCTGG - Intergenic
945301974 2:208222855-208222877 CTGGCTTCAGCAATTTTTGCAGG - Intergenic
945467229 2:210183116-210183138 CTGGCTTGTAGGGTTTCTGCAGG - Intergenic
945819830 2:214650516-214650538 CTGTCTTCTGAAGTTTTAACTGG - Intergenic
946249971 2:218405943-218405965 CCTGCTTCTGTGGTTATTGCGGG + Intergenic
948196596 2:236101456-236101478 GTGGCTTCTCAGGGATTTGCTGG - Intronic
948359871 2:237412586-237412608 GGGACTTCTGAGGTTTTTGTTGG - Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1168812735 20:716613-716635 GCTGCTTCTGAGGTTTTTGTGGG + Intergenic
1168858536 20:1028102-1028124 CTGGCTTGTGAGGTTTGGGCTGG - Intergenic
1169949299 20:11025401-11025423 CTGCCTTTTGAGCTTTGTGCTGG - Intergenic
1171513211 20:25705034-25705056 CTGGCTTGTAGGGTTTCTGCTGG + Intergenic
1173807897 20:45938120-45938142 TTGGCTCCTGAGGCTGTTGCTGG + Intronic
1174489629 20:50883780-50883802 CTGGCCTCTGCAGTCTTTGCTGG + Intergenic
1175468092 20:59206702-59206724 CTAGCTTCAGAGGTTGTTGTAGG - Intronic
1176234386 20:64047557-64047579 CTGACATCTGTGGTGTTTGCAGG - Intronic
1177419696 21:20840334-20840356 GAGTCTTCTAAGGTTTTTGCAGG - Intergenic
1177808059 21:25894946-25894968 GTGGCTGCTGAGGTTTGTGGTGG - Intronic
1177845516 21:26283683-26283705 CTGGCTTTTGAGATATTTGAGGG - Intergenic
1179243083 21:39609014-39609036 CTGGAGTCTGAGGTGTGTGCCGG - Intronic
1183958829 22:41398678-41398700 CTGGCTTCTGAGGTTGGAGGGGG + Exonic
1184883652 22:47328652-47328674 CTGGCTACTGAGGTGTTGGAAGG + Intergenic
951462726 3:22968751-22968773 CAAGCTGCTGAGGCTTTTGCTGG + Intergenic
952891969 3:38049207-38049229 CTGGTTTCTCAGGTCTCTGCTGG + Intronic
953846922 3:46434934-46434956 CAGGTTTCAGAGGCTTTTGCAGG + Intergenic
954012306 3:47652265-47652287 CAGGCTTCTGTGGGTTTTGTTGG + Intronic
954655211 3:52190396-52190418 CTGCCTTCTGAGGATGTGGCTGG + Intergenic
955435767 3:58897717-58897739 CTGGCTTGTAGGGTTTCTGCTGG + Intronic
957521907 3:81329352-81329374 CTTGCTTCTGAAATTTTAGCTGG - Intergenic
960351843 3:116603397-116603419 CTGGGTTCTGGGATTTTTGTGGG - Intronic
960607205 3:119518818-119518840 CTGACTTGTAAGGTTTCTGCTGG - Intronic
962651787 3:137501834-137501856 CTGTCTTATAAGGTTTCTGCTGG + Intergenic
962998910 3:140657742-140657764 CTGGCTTGTAGGGTTTCTGCTGG - Intergenic
963134031 3:141884232-141884254 GTGACTTCTTAGGATTTTGCTGG + Intronic
965490890 3:169334529-169334551 CCGTCTTCTGTGGTTCTTGCAGG - Intronic
968158930 3:196408746-196408768 CTGGCTTCTGTTGTTGCTGCTGG + Intronic
969100786 4:4766616-4766638 CTGGCTTGAGAGCTTTTTGATGG + Intergenic
970671563 4:18402334-18402356 CAGGCTTTTGAGGGATTTGCAGG + Intergenic
971521016 4:27550522-27550544 CTGGACTCTGAGGTTTAAGCAGG - Intergenic
971768340 4:30863542-30863564 CTGGCTTGTTAGGTTTTTCCAGG + Intronic
973684823 4:53358774-53358796 CTGGCTTCTGATTTGTTTCCAGG - Intronic
974469848 4:62304168-62304190 CTGGCTTGTAAGTTTTTTGCTGG - Intergenic
975374023 4:73621431-73621453 CTGCCTGCTGAACTTTTTGCAGG - Intergenic
975753728 4:77551459-77551481 CTGGCTTGTAAGGTTTCTGCTGG + Intronic
976494570 4:85712552-85712574 CTGTCTTCTGAGGGTTTGGGGGG + Intronic
977203381 4:94142551-94142573 CTGGCTTGTAGGGTTTCTGCTGG - Intergenic
979404245 4:120289334-120289356 CTGCTTTCTGAGGTTGCTGCAGG + Intergenic
980556066 4:134407428-134407450 CTGGATTCTGAGATTCTTGGTGG + Intergenic
980841443 4:138266188-138266210 CTGGCTTCTGAGGGTGATGAAGG - Intergenic
982821954 4:159952375-159952397 ATGGCTTCTGATGTTCTTGCTGG + Intergenic
983488790 4:168363113-168363135 CTGGCCTGTGAGGTTTCTGCTGG - Intronic
984129746 4:175859321-175859343 CCAGCCTCTGAAGTTTTTGCAGG - Intronic
984246335 4:177279075-177279097 CTGGCTCCTGAGGTTTGAGGAGG + Intergenic
984863841 4:184263816-184263838 CTGGCTTCTGCCATTTTTCCTGG - Intergenic
986859469 5:11909711-11909733 CTGGGTTTTGAGGCTTTTCCTGG + Intergenic
987281509 5:16418673-16418695 CTGGCTTCTGAGTGCTTAGCAGG - Intergenic
988131923 5:27117759-27117781 CTGGCTTATGAGGGGTTTGAAGG - Intronic
988921476 5:35946517-35946539 CTGGGTTCTGGGGCTTCTGCAGG - Intergenic
989657369 5:43759536-43759558 CTGACCTTTGAGGTTTTTGTGGG + Intergenic
995258474 5:110074118-110074140 CTGGCTTGTAAGGTTTCAGCTGG + Intergenic
995316506 5:110780684-110780706 CTGGCTTGTAAGGTTTCTGCAGG + Intergenic
995692824 5:114846191-114846213 CTGGCTTTTAAAGTTTCTGCTGG - Intergenic
995811575 5:116113153-116113175 CTGCCTTGTAAGGTTTCTGCTGG + Intronic
995865179 5:116682822-116682844 CTAGACTCTGAGGTTTTTGATGG + Intergenic
996273980 5:121641966-121641988 CTGACTTGTAAGGTTTTTGCTGG - Intergenic
998751910 5:145332105-145332127 CTGGCTTGTAGGGTTTCTGCAGG + Intergenic
1000455600 5:161444955-161444977 GTGGGATCTGAGGTTTCTGCAGG - Intronic
1001908999 5:175498898-175498920 CTGGCCTTTGAGATTTTTGTGGG - Intronic
1002863598 6:1101685-1101707 CTGGATCTTGAGGTTTTTGAGGG - Intergenic
1004409189 6:15364504-15364526 CTGGCCTCTAGGGGTTTTGCAGG - Intronic
1006620893 6:35363219-35363241 GTGGCTTCTCAGGTCTTTTCTGG + Intronic
1006718088 6:36132695-36132717 CTGGGTTCTGGGGCATTTGCAGG + Intronic
1006968893 6:38019571-38019593 ATGGCTTCTGGGGTTTTTTTGGG + Intronic
1008315327 6:50032087-50032109 CTGGCTTGTAAGGTTTTTGCTGG - Intergenic
1008782551 6:55125452-55125474 CTGGCTTGTAGGGTTTCTGCAGG + Intronic
1008785297 6:55160139-55160161 CTGGCTTGTAGGGTTTCTGCAGG - Intronic
1009465921 6:63969325-63969347 CTGGTTTCTAAGATTTTTACTGG - Intronic
1012134503 6:95539300-95539322 CTGGCTTGTAGGGTTTCTGCTGG + Intergenic
1013168729 6:107617158-107617180 CTGGCTTTTGAATTTTATGCTGG + Intronic
1013731738 6:113176249-113176271 CTGGGTTCTAAGCTTTCTGCTGG + Intergenic
1014384878 6:120787102-120787124 CTGGCCACAGAGGTTTTGGCTGG + Intergenic
1016216166 6:141606602-141606624 CTAGCTTGTGAAGTTTCTGCTGG + Intergenic
1017533143 6:155317217-155317239 CTGATTTCTTAGGCTTTTGCAGG - Intergenic
1017628720 6:156374847-156374869 TTGGCTTCTGAGGGTTGTGAAGG - Intergenic
1018742705 6:166742831-166742853 CTGGCTTCTCAGTGTTTTGCAGG - Intronic
1019414390 7:920633-920655 CTGGATTCTTGGGTATTTGCCGG - Intronic
1022042297 7:26592470-26592492 CTGGCTTATTTGGCTTTTGCTGG + Intergenic
1022603064 7:31779907-31779929 CTGGTTTCTGATGTTCTTCCTGG - Intronic
1023022597 7:36023737-36023759 AAGGTTTCTGAGGTTTTTTCTGG - Intergenic
1023391257 7:39713798-39713820 CAGGCTTCTGAGGTCTTAGATGG + Intergenic
1023585204 7:41722607-41722629 CTTGCTTCTCAGGGTTTTGTGGG + Intergenic
1023732848 7:43208856-43208878 GTGGCTTCTGATGCTCTTGCAGG - Intronic
1024510681 7:50202284-50202306 CTGGTCTCTGTGGTTTTTGATGG + Intergenic
1024713162 7:52041053-52041075 CTGGCTTCTGTGGTTTCTAATGG - Intergenic
1026644641 7:72156848-72156870 TCTGCCTCTGAGGTTTTTGCAGG - Intronic
1027445875 7:78273275-78273297 CTGGCTTGTAGGGTTTCTGCAGG + Intronic
1027447374 7:78289758-78289780 CTGGCTTGTAGGGTTTCTGCAGG - Intronic
1027971904 7:85094458-85094480 CTGTCAGCTGAGGCTTTTGCTGG + Intronic
1029855037 7:103506362-103506384 CTGGCTTGTAGGGTTTCTGCAGG - Intronic
1030807430 7:113935049-113935071 CTGGCTTGTAGGGTTTCTGCTGG + Intronic
1031400883 7:121325369-121325391 TTGCCCTCTGTGGTTTTTGCAGG - Intronic
1032398108 7:131605299-131605321 CTGGGTTCTGAGGACTCTGCAGG - Intergenic
1033422520 7:141216638-141216660 CTGGCTTTTTAGGTGATTGCTGG + Intronic
1033792857 7:144813120-144813142 CTGGCTTCTGAATTTTTGGCAGG - Intronic
1035636892 8:1154625-1154647 CTGGCTGCTGGGGTTTTTAATGG - Intergenic
1038508679 8:28109279-28109301 CTGGCTTCTGAGGTGTTCTGAGG - Intronic
1039856225 8:41416680-41416702 TTAGCTTCTGATGTTTTTTCTGG - Intergenic
1041036758 8:53799547-53799569 CTGGCTTCTGGGAATTTGGCTGG + Intronic
1041434156 8:57819096-57819118 CTGGCTTGTAAGGTTTCTGCTGG - Intergenic
1041530338 8:58858552-58858574 CTGCTTTCTGTGGTCTTTGCAGG + Intronic
1043808057 8:84698927-84698949 CACGGTTCTGAGGTGTTTGCAGG - Intronic
1046657591 8:116912530-116912552 CTGGCCTTTGAGATTTTTGTGGG + Intergenic
1047225677 8:122953791-122953813 GTGGCCTCTGAGGGCTTTGCTGG - Exonic
1048174604 8:132140483-132140505 CTGGCTTCTGTGTCCTTTGCTGG - Intronic
1048382749 8:133882322-133882344 CTGGCTTCTAAGCATTTTGTTGG + Intergenic
1049732360 8:144185211-144185233 CTGGCCTCTGTGGTTTCTGCAGG + Intronic
1050407461 9:5325017-5325039 TTGGTTTCTGGGGTTTTTGAGGG - Intergenic
1050671855 9:8006711-8006733 CTGGCTTGTAGGGTTTCTGCTGG + Intergenic
1051221711 9:14856063-14856085 CTGGCTAATGAGTTTTTTACTGG + Intronic
1051940032 9:22494783-22494805 CTGGCTTGTAGGGTTTCTGCAGG + Intergenic
1052166894 9:25341138-25341160 CTGCCCTGTGAGGTTTCTGCTGG - Intergenic
1056820387 9:89837460-89837482 CTGACTTCTTAGGTTTTGGCGGG - Intergenic
1057229074 9:93308097-93308119 CTGGCTTCTGAGGTGGGTGATGG + Intronic
1058119685 9:101124889-101124911 TTGGTTTCTGCGGTCTTTGCTGG - Intronic
1059058766 9:111013444-111013466 CTGGCTTCTGAGGCTTATAATGG - Intronic
1059552245 9:115240917-115240939 TTGGCTTCTGAGGTTGGTGAAGG + Intronic
1059645511 9:116262849-116262871 GTGGCTTCTGAAGGCTTTGCTGG - Intronic
1059864502 9:118499827-118499849 CTGGCTTGTAGGGTTTCTGCTGG + Intergenic
1061257286 9:129460239-129460261 CTGGGGTCTGAGGGCTTTGCGGG - Intergenic
1061468779 9:130805694-130805716 CTGGCTTCTGTGGTTTGAGTTGG - Intronic
1062064949 9:134521761-134521783 CTGGCCTCTGGGGTTATAGCAGG - Intergenic
1062388861 9:136326222-136326244 CTGGCTTCTGTGGTCTTTGGGGG + Intergenic
1185505414 X:629945-629967 CTGGCGTCTGGGGTATTTACCGG - Intronic
1185749144 X:2596708-2596730 AAGGCTGCTGGGGTTTTTGCAGG + Intergenic
1186311169 X:8320585-8320607 GTGACTTCTGAGGTTTCTGATGG - Intergenic
1186789127 X:12980096-12980118 CTGGCTTCTGAGACTTTTGTAGG + Intergenic
1187760700 X:22580853-22580875 CTTCATTCTGAAGTTTTTGCTGG - Intergenic
1189129180 X:38480559-38480581 CTGGGTTCTGAAGATTTTACTGG - Intronic
1190376134 X:49790184-49790206 CTTGGTTCTGAGGTATTTGGGGG + Intergenic
1190534216 X:51409318-51409340 CGGGCTCCTGAGGTCTTTGGGGG + Intergenic
1192599951 X:72451595-72451617 CTGGCTTCTGTTGTTTCTGATGG - Intronic
1192691535 X:73370512-73370534 CTGGCTTTTGGGATTTCTGCTGG + Intergenic
1192956620 X:76077556-76077578 CTGGCTTGTAGGGTTTCTGCTGG - Intergenic
1193005033 X:76606817-76606839 CTGGTTTATGTGGTTTTTCCAGG - Intergenic
1193610717 X:83628887-83628909 CTGGCTTGTAGGGTTTCTGCTGG + Intergenic
1194210947 X:91067901-91067923 CTGGCTTGTAAGGTTTCTGCTGG - Intergenic
1194635447 X:96341090-96341112 CTGGCTTGTAGGGTTTCTGCTGG + Intergenic
1195140298 X:101951998-101952020 CTGGCTTGTAGGGTTTCTGCAGG - Intergenic
1195938368 X:110146228-110146250 CTGGCTTCTGAGGTGTGTGATGG + Intronic
1195962959 X:110404279-110404301 CTGTCTTCTGAAGTCTTTACAGG + Intronic
1197252252 X:124228398-124228420 CTGGCTTCTCAGCTTCTAGCAGG + Intronic
1197671948 X:129286645-129286667 CTGGCTTATGAGGTAGTTTCTGG - Intergenic
1200086970 X:153611720-153611742 CTGCCTGCTGAGGTTTCTGAAGG - Intergenic