ID: 901033787

View in Genome Browser
Species Human (GRCh38)
Location 1:6324012-6324034
Sequence GGCACTGGGGTCTTTCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901033787_901033794 28 Left 901033787 1:6324012-6324034 CCTGTTAGAAAGACCCCAGTGCC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 901033794 1:6324063-6324085 GCTGCTGTTCCCCATTGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901033787 Original CRISPR GGCACTGGGGTCTTTCTAAC AGG (reversed) Intronic
901033787 1:6324012-6324034 GGCACTGGGGTCTTTCTAACAGG - Intronic
901272247 1:7961569-7961591 GGCACCGGGGAGTTTCTAGCTGG - Intronic
903204391 1:21769790-21769812 GCCTCTGGGGTCTGTCTAAGTGG - Intronic
903301970 1:22385672-22385694 GTCACTGGGGCCTTTTTAATTGG - Intergenic
904972414 1:34429424-34429446 GGCACTGGGGACATTCCAAAGGG - Intergenic
906793469 1:48678400-48678422 GGGACTGGGATTTTTCTGACAGG - Intronic
907231178 1:53000475-53000497 GGCACAGAGGCCTTTCTAAAAGG - Intronic
907536122 1:55159575-55159597 GGCACTGGGGCCTATCTGGCTGG + Intronic
909565260 1:77046496-77046518 GGCACTGTGGCCTTCCTCACTGG + Intronic
913360116 1:117971018-117971040 GGGACAGGGATCTTTCAAACTGG + Intronic
913584118 1:120256535-120256557 AGCACTAGGATCATTCTAACTGG - Intergenic
913624062 1:120641806-120641828 AGCACTAGGATCATTCTAACTGG + Intergenic
914566109 1:148868403-148868425 AGCACTAGGATCATTCTAACTGG - Intronic
914606712 1:149261837-149261859 AGCACTAGGATCATTCTAACTGG + Intergenic
920611457 1:207442439-207442461 AGCACTGGGCTCTTTCTGCCTGG + Intergenic
922177929 1:223211484-223211506 TGCACTGGGGTGATTCCAACTGG + Intergenic
922182705 1:223247785-223247807 AGCCCTGGGGTGATTCTAACGGG + Intronic
924441499 1:244089222-244089244 GGTACTGGGGTCTGTCTCTCAGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1066417293 10:35233066-35233088 GGCACTGGTGGCTTTATAAGAGG + Intergenic
1067542258 10:47164595-47164617 AGCCCTGGAGTCTTACTAACTGG + Intergenic
1067543682 10:47176395-47176417 GGCACTGGGGACCTTGGAACAGG - Intergenic
1069587461 10:69617904-69617926 GGAACTGGAATCTTTCCAACAGG - Intergenic
1071115452 10:82213958-82213980 GGCACTGGGCTCTTTCTCTTTGG + Intronic
1073558939 10:104480958-104480980 GGCTCTGGGGCCTTTGTCACAGG + Intergenic
1074585027 10:114759795-114759817 GAGACTGTGGCCTTTCTAACTGG - Intergenic
1076142349 10:128089702-128089724 GGGACTGGGGTCCCTTTAACTGG - Intergenic
1081726101 11:45330473-45330495 GTCTCTGGGGTCATTCTAACTGG - Intergenic
1083713147 11:64560850-64560872 GGCTCTGGGGTCTGACTACCTGG + Intronic
1084766693 11:71313847-71313869 GGGACTGGTGTCTTTTTAAGAGG + Intergenic
1086935740 11:92743816-92743838 GGAACTGGGGGCTTTGTAAGAGG + Intronic
1087630434 11:100644496-100644518 GGGACTTGGGTTTTTCTAAAAGG + Intergenic
1088810589 11:113388929-113388951 GGGACGGGGGTCTCTCTGACTGG + Intronic
1089328141 11:117671476-117671498 GGCATTGGGGTCTTGGTAAATGG - Intronic
1093621699 12:21298262-21298284 GGCTCTGTGCTTTTTCTAACAGG - Intronic
1096079298 12:48823177-48823199 GGCACTGGGGCCCTTCTCAGGGG + Intronic
1096253039 12:50045594-50045616 GGCACTGGGGTCTTATTAGGGGG - Intergenic
1102224991 12:111222380-111222402 GGCCCTGTGGTCTTTCAAGCTGG - Intronic
1104209031 12:126669470-126669492 GGCATTGGGGCCATTCTCACCGG - Intergenic
1105342336 13:19539051-19539073 GGCACTGGTGGCTTTATAAGAGG - Intergenic
1114539969 14:23447862-23447884 GTGACTAGGGACTTTCTAACAGG - Intergenic
1115886746 14:37980738-37980760 GACACTGGGGTCTATGTTACAGG + Intronic
1117327600 14:54683656-54683678 GGCACAGGAGTCTTTTTAAAAGG + Intronic
1120098873 14:80421497-80421519 GCCACTGGGTTCTCTCTAATAGG + Intergenic
1121790992 14:96699481-96699503 AGAACTGGGCTCTTTCTACCTGG + Intergenic
1123020957 14:105397748-105397770 GGCACTCAGGTCTTTCCATCTGG - Exonic
1128736324 15:70055941-70055963 GGCACTGGGGCCTTCCCAGCAGG + Intronic
1132211755 15:100029073-100029095 TGCACTTGGGTCTTTCCATCTGG + Intronic
1137572614 16:49576614-49576636 GGCTCTGGGGGTTTTCCAACAGG - Intronic
1138954165 16:61950875-61950897 GGCACTGGGGTCTATTTGAGGGG + Intronic
1139902715 16:70340933-70340955 GTCTCTGGGCTCTTTCTAAGAGG + Intronic
1143618792 17:8069410-8069432 CGCACTGGGCTCTTTGTACCAGG + Intergenic
1149022046 17:51979488-51979510 GGCACTGGGGTCTATTTGATTGG - Intronic
1151926433 17:77200968-77200990 GGCACTGCTGTCTTTTTAATAGG - Intronic
1151995050 17:77603163-77603185 GGCTCTGGGCTCTTTCTCCCCGG - Intergenic
1153458753 18:5310267-5310289 GGCACTGGGGTGTTGCAATCTGG - Intergenic
1161699787 19:5788296-5788318 GGCAGTGTGGTCATTCCAACAGG - Intronic
1161848762 19:6727791-6727813 GTCACAGGGGTCTTTATAAGAGG - Intronic
1164935676 19:32208582-32208604 GGCACTTGGGTCCTTTTCACTGG - Intergenic
926940097 2:18126517-18126539 GCCACTGTGGGCTTTCAAACAGG + Intronic
931201388 2:60100643-60100665 AGAACTGGGGTCTTTCTAGCAGG + Intergenic
934487326 2:94727641-94727663 GGTACTGGGGTCTTTTTCAATGG + Intergenic
940667903 2:156631329-156631351 GCATCTGGGGTCTCTCTAACTGG - Intergenic
945578188 2:211558383-211558405 GTCACAGGGGTCTTTGTAAGTGG - Intronic
1168938105 20:1685493-1685515 TGTACTGAGGTCTTTCTTACTGG - Intergenic
1169068033 20:2705514-2705536 GGCGCTGGAGTCTTTCTCACTGG + Intronic
1173815495 20:45985078-45985100 GGCACTGAGGCCTCTCCAACAGG + Intergenic
1176838124 21:13813511-13813533 GGTACTGGGGTCTTTTTCAATGG + Intergenic
1177906936 21:26983032-26983054 GGCACTGTCTTCTTTCTGACAGG + Intergenic
952043137 3:29283947-29283969 GGTACTGGGGATTTTCTGACAGG + Intronic
961330813 3:126136883-126136905 GTCACTGGGGCCTTTCTTTCAGG - Exonic
966421652 3:179739941-179739963 GGCACTCGGCTCATTCTCACAGG - Intronic
967771195 3:193335066-193335088 GGCAATGGTGTCTTTGTAACAGG + Exonic
968063194 3:195741818-195741840 GTGACTGTGGTCATTCTAACAGG + Intergenic
968351925 3:198064856-198064878 GGCACTGGGGTTTCAATAACGGG + Intergenic
971312839 4:25540478-25540500 AGAACTGGGGTCTTTGTAAAAGG - Intergenic
974617489 4:64307873-64307895 GGTACTGCTGTCTTTCCAACTGG - Intronic
975080857 4:70278823-70278845 GGCACTGGGGTTTTACAAACTGG + Intergenic
981748517 4:148072664-148072686 TGCACTGGCGTATTTGTAACAGG + Exonic
984009939 4:174358415-174358437 GGAACTGGTGGCTTTCTAAGAGG + Intergenic
990518574 5:56554665-56554687 GACACTGAAGTCTTTCTAAAAGG + Intronic
993713954 5:91256036-91256058 TACACTGAGATCTTTCTAACAGG + Intergenic
994379337 5:99052911-99052933 GGGACTGGTGGCTTTCTAAGAGG + Intergenic
995022081 5:107378377-107378399 GTCACTGGGGTTTGACTAACTGG + Exonic
997008423 5:129848171-129848193 TGCCCTTGGGTCTTCCTAACAGG + Intergenic
997026927 5:130075433-130075455 GGCATTGGGTACTTTCAAACAGG - Intronic
997884027 5:137614893-137614915 GACACTGGGGTCTTTCCCAGAGG + Intergenic
1001736612 5:174009118-174009140 GACACTGGAGGCTTTCTAGCGGG - Intergenic
1007347393 6:41242548-41242570 GTAACTAGGGTCTTTCCAACAGG + Intergenic
1015327236 6:131937056-131937078 GACAATGGGGTGTTTCTATCTGG + Intergenic
1015495626 6:133880224-133880246 TGTACTGGGGTCTTTTCAACTGG - Intergenic
1019804401 7:3112772-3112794 GGCACTGGGGTTTTTCTTTGAGG - Intergenic
1021732307 7:23607900-23607922 TGCACGGTGGTCTTTCTGACAGG + Intronic
1021860669 7:24903090-24903112 GGTACTGGTGGTTTTCTAACTGG + Intronic
1023908168 7:44536629-44536651 GGCACTGTGGTTTTTCTGCCTGG - Intronic
1028831175 7:95327971-95327993 AGCACTGAGGTCTTAGTAACTGG - Intergenic
1029193989 7:98791528-98791550 GGCCCTGGGGTCCATCTACCTGG + Intergenic
1030553193 7:110990570-110990592 GGCACTGGGGTCAGACTGACTGG + Intronic
1031451067 7:121919932-121919954 CTCACTGGGATGTTTCTAACTGG - Intronic
1031886031 7:127246975-127246997 AGCACTGGGGTCTTTCTCCAAGG - Intronic
1032383386 7:131505748-131505770 GGCCCTGGACCCTTTCTAACAGG - Intronic
1033493770 7:141872264-141872286 GTCACTGGGGTATTTTTAATAGG + Intergenic
1034555470 7:151847717-151847739 GGCACCTGAGTCTTTCGAACTGG + Intronic
1035080980 7:156215721-156215743 AACACAGGGGGCTTTCTAACTGG - Intergenic
1040401777 8:47057737-47057759 GGCCCTGGGCTCTTTCTAGTTGG - Intergenic
1042468774 8:69159819-69159841 GTCACTGGAGGCTTTCTAAATGG - Intergenic
1045356187 8:101391098-101391120 GGCCCTGGAGTCCTTCTCACTGG + Intergenic
1047142666 8:122158823-122158845 GGTACTGGGGGCATTCTAAAAGG + Intergenic
1048591650 8:135826135-135826157 GGCCCTGGGGCCTTTCTCTCAGG + Intergenic
1053670481 9:40356789-40356811 GGTACTGGGGTCTTTTTCAATGG - Intergenic
1053920265 9:42983052-42983074 GGTACTGGGGTCTTTTTCAATGG - Intergenic
1054381599 9:64496773-64496795 GGTACTGGGGTCTTTTTCAATGG - Intergenic
1054514132 9:66019511-66019533 GGTACTGGGGTCTTTTTCAATGG + Intergenic
1057425069 9:94941719-94941741 AGCACTCAGGTCTTTCTAAGGGG + Intronic
1059824042 9:118007208-118007230 TGCACTGTGGTCGTACTAACTGG + Intergenic
1060683392 9:125585766-125585788 AGCAGTGGGGTCTGTATAACTGG - Intronic
1185863180 X:3598275-3598297 TTCACTGGGTTCTATCTAACTGG - Intergenic
1189765664 X:44369617-44369639 GGCACTAGGGACTTTCTAGGAGG - Intergenic
1196481503 X:116155385-116155407 GCCACTGGGGGCTTTTGAACGGG + Intergenic
1199915584 X:152336689-152336711 GAAACTGGGGTCTTTCTAGGAGG - Intronic
1202589988 Y:26472590-26472612 GGCACTGGTGGCTTTATAAGAGG + Intergenic