ID: 901035710

View in Genome Browser
Species Human (GRCh38)
Location 1:6334793-6334815
Sequence GTAAACCCCTAGACGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901035710_901035715 -1 Left 901035710 1:6334793-6334815 CCCAGAGACGTCTAGGGGTTTAC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 901035715 1:6334815-6334837 CCCAGGGTCACACAGCAACTTGG 0: 1
1: 7
2: 38
3: 233
4: 829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901035710 Original CRISPR GTAAACCCCTAGACGTCTCT GGG (reversed) Intronic
901035710 1:6334793-6334815 GTAAACCCCTAGACGTCTCTGGG - Intronic
903326100 1:22569452-22569474 GTAAGTCCCTTGACCTCTCTGGG - Intronic
921825201 1:219664639-219664661 GTAAACCCCTGGGCACCTCTTGG - Intergenic
1064851721 10:19715842-19715864 GTAAACAACTAGACCTCTCATGG + Intronic
1079150114 11:17891010-17891032 GTAAACCACAAGATGCCTCTAGG - Intronic
1086777297 11:90854418-90854440 TTTAACCCCTAGAGGCCTCTTGG + Intergenic
1096321203 12:50614641-50614663 GCAAGCCACTATACGTCTCTGGG - Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101814013 12:108131242-108131264 GCAAATCACTAGACCTCTCTGGG + Intronic
1104482076 12:129116118-129116140 GACAAACCCTAGACTTCTCTGGG - Intronic
1113167634 13:107460224-107460246 GTGAATCCCTAGAGGTGTCTGGG - Intronic
1122395631 14:101427533-101427555 GTAAACCCCTTGACTTTTCTAGG - Intergenic
1136547548 16:30964262-30964284 GGAACCCCCTACACGTCTCGGGG + Exonic
1136551085 16:30982979-30983001 GTCATCCCCTAGATGTCCCTGGG - Intronic
1144082327 17:11775506-11775528 GTCAATCCCTAGAGGTCTCCAGG + Intronic
1151142518 17:72007583-72007605 ATGAAACCCTAGAGGTCTCTAGG + Intergenic
1158903549 18:61988471-61988493 GTGAACCACTAGAAGTATCTGGG + Intergenic
1161565979 19:5003009-5003031 GTAAAGCCCTTTCCGTCTCTGGG + Intronic
932424467 2:71620345-71620367 GCAAGCCCCTTGACCTCTCTGGG - Intronic
939214257 2:139215778-139215800 GAAAAGCCCTGGACCTCTCTAGG - Intergenic
944967913 2:204956906-204956928 GTTAATCCCTAGATATCTCTAGG + Intronic
1172289056 20:33762139-33762161 GCAAACCCCATGACCTCTCTGGG + Intronic
954906195 3:54065131-54065153 GAAAATCCCTAGACCTCTCTAGG + Intergenic
959477669 3:106831197-106831219 CTTAACCCCTTGATGTCTCTTGG + Intergenic
976579683 4:86721604-86721626 CTAAAACCCTTGAAGTCTCTTGG - Intronic
990812283 5:59741844-59741866 GTAAACTTCTAGTAGTCTCTCGG + Intronic
991210544 5:64099527-64099549 GAAAATTCCTAGACATCTCTGGG + Intergenic
994613241 5:102072553-102072575 GCAAACTCCTACACATCTCTAGG + Intergenic
1001569245 5:172719334-172719356 GTAAACCCCAAGACGTGACCTGG + Intergenic
1015503120 6:133953426-133953448 GTAACCCCCTAGGCGACCCTGGG + Intronic
1023741737 7:43287304-43287326 GTGCACCCCCAGACATCTCTGGG - Intronic
1034931991 7:155169884-155169906 GGACACACCTAGACGTCTCTGGG + Intergenic
1060485854 9:124045743-124045765 GTAAACTCCTCGCCGGCTCTGGG + Intergenic
1060677872 9:125532621-125532643 GTAAACTCCTAGAAGTTTCTGGG - Intronic
1194672163 X:96747198-96747220 GTAAACCCATAGAAATTTCTTGG + Intronic
1195069689 X:101267152-101267174 GAAAACCCCCAGATGCCTCTTGG + Intergenic