ID: 901036435

View in Genome Browser
Species Human (GRCh38)
Location 1:6338820-6338842
Sequence GCTTCTTTTTATACCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901036435_901036438 -4 Left 901036435 1:6338820-6338842 CCAGCCTGGGTATAAAAAGAAGC 0: 1
1: 0
2: 1
3: 20
4: 318
Right 901036438 1:6338839-6338861 AAGCGTGAGCTGGTGAACACTGG 0: 1
1: 0
2: 0
3: 7
4: 76
901036435_901036441 24 Left 901036435 1:6338820-6338842 CCAGCCTGGGTATAAAAAGAAGC 0: 1
1: 0
2: 1
3: 20
4: 318
Right 901036441 1:6338867-6338889 CCCCCTCCTGCAGCGCCCAGTGG 0: 1
1: 0
2: 2
3: 32
4: 338
901036435_901036448 30 Left 901036435 1:6338820-6338842 CCAGCCTGGGTATAAAAAGAAGC 0: 1
1: 0
2: 1
3: 20
4: 318
Right 901036448 1:6338873-6338895 CCTGCAGCGCCCAGTGGGAAGGG 0: 1
1: 0
2: 2
3: 20
4: 207
901036435_901036443 25 Left 901036435 1:6338820-6338842 CCAGCCTGGGTATAAAAAGAAGC 0: 1
1: 0
2: 1
3: 20
4: 318
Right 901036443 1:6338868-6338890 CCCCTCCTGCAGCGCCCAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 230
901036435_901036446 29 Left 901036435 1:6338820-6338842 CCAGCCTGGGTATAAAAAGAAGC 0: 1
1: 0
2: 1
3: 20
4: 318
Right 901036446 1:6338872-6338894 TCCTGCAGCGCCCAGTGGGAAGG 0: 1
1: 1
2: 0
3: 16
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901036435 Original CRISPR GCTTCTTTTTATACCCAGGC TGG (reversed) Intronic