ID: 901037562

View in Genome Browser
Species Human (GRCh38)
Location 1:6345463-6345485
Sequence CTGTAAACACAGATAATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 394}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901037561_901037562 -9 Left 901037561 1:6345449-6345471 CCACGTCTCAGTCTCTGTAAACA 0: 1
1: 0
2: 1
3: 15
4: 147
Right 901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG 0: 1
1: 0
2: 1
3: 32
4: 394
901037559_901037562 14 Left 901037559 1:6345426-6345448 CCTTGTGCAGCGACACAACCTCT 0: 1
1: 0
2: 2
3: 14
4: 102
Right 901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG 0: 1
1: 0
2: 1
3: 32
4: 394
901037560_901037562 -4 Left 901037560 1:6345444-6345466 CCTCTCCACGTCTCAGTCTCTGT 0: 1
1: 0
2: 4
3: 52
4: 434
Right 901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG 0: 1
1: 0
2: 1
3: 32
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901037562 Original CRISPR CTGTAAACACAGATAATAAA TGG Intronic
901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG + Intronic
901667409 1:10834633-10834655 CTGCAAAAACAGAAAATGAAGGG + Intergenic
906969838 1:50500304-50500326 TTGTAAAGACAGAAAAAAAATGG + Intronic
907567644 1:55451259-55451281 CAGAAATGACAGATAATAAAAGG + Intergenic
907635766 1:56133442-56133464 CAGTAAGCTCAGATATTAAAAGG + Intergenic
907738128 1:57136104-57136126 CTGTAATCAAAAAGAATAAATGG - Intronic
908286327 1:62607655-62607677 CTGTAACTCCAGACAATAAAAGG - Intronic
908528982 1:65015455-65015477 CTATAAACAGAGTTAAAAAAAGG + Intergenic
908727486 1:67192448-67192470 CTGTAAATAGAGATAATAAAAGG - Intronic
909081470 1:71117657-71117679 ATGTAATCATAGAAAATAAAAGG + Intergenic
909751201 1:79163890-79163912 CTGCAAACTTAGAAAATAAATGG - Intergenic
909925347 1:81431595-81431617 CTGTAAACACAGAGACAAACTGG + Intronic
910009457 1:82443170-82443192 CTGAAAGTACAGATATTAAATGG + Intergenic
910981735 1:92965060-92965082 CTGTCAGCACATATAAAAAATGG - Intergenic
911144309 1:94538056-94538078 CTGTATAAACAGGTAATGAAGGG + Intronic
911381042 1:97115200-97115222 GTGTCAACACACAGAATAAAGGG + Intronic
911862748 1:102974301-102974323 CTCTAAACACATTTCATAAAAGG + Intronic
912028656 1:105210815-105210837 CTGAAAACAGAAATAAGAAAAGG + Intergenic
912389351 1:109291461-109291483 ATGAAAACAAAGATAATCAAGGG + Intergenic
913123516 1:115764036-115764058 GTGTCAACACAAATTATAAAGGG - Intronic
917246012 1:173001498-173001520 CTGTAAACACAGAAATTCAAAGG - Intergenic
917338208 1:173947278-173947300 CTAAAAACACTGATAGTAAATGG + Intronic
917573781 1:176297774-176297796 CAGTAAAGAAAGATAATGAAGGG - Intergenic
918337435 1:183532485-183532507 CTGTGAACACAGTTATTAGAAGG + Intronic
918519057 1:185394849-185394871 CTGTAAACACAGATAGTTCTGGG - Intergenic
919300150 1:195751802-195751824 CTGTAAATATAAATAATAATTGG + Intergenic
919612318 1:199760467-199760489 CTGTAATCACAGCTACTAACGGG - Intergenic
920061699 1:203231225-203231247 CAGTTTACACAGATAGTAAATGG - Intronic
920328136 1:205183044-205183066 CTGTGAACACCTATAAGAAAAGG - Intronic
920328806 1:205189546-205189568 CTGGAAACAAACAAAATAAATGG - Intronic
921162687 1:212484308-212484330 ATGTACACACACATAATACATGG - Intergenic
921782827 1:219188214-219188236 ATGTAGAGACAGAAAATAAAAGG + Intronic
921881074 1:220254668-220254690 TTTTAAACAGAGAAAATAAAAGG + Intronic
923814979 1:237367435-237367457 TTCTAAAAACAGATATTAAAAGG - Intronic
1063261462 10:4393861-4393883 CTGTAAATACACTGAATAAAGGG + Intergenic
1064023966 10:11832070-11832092 CCTTAAACACAGATTTTAAAAGG - Intronic
1064276084 10:13906247-13906269 CTATATAGACAGATAAAAAAAGG - Intronic
1065301666 10:24327833-24327855 CTGTGATCACAGCTAACAAATGG + Intronic
1065314210 10:24446438-24446460 CTGCAGACACACATACTAAATGG - Intronic
1065454664 10:25894534-25894556 CTCTAAAAAAATATAATAAAAGG + Intergenic
1065838751 10:29682531-29682553 CTTTACACACAATTAATAAAAGG + Intronic
1068565998 10:58576107-58576129 GTGTAAACACAGTTAATTAGGGG - Intronic
1069243791 10:66175551-66175573 CAGTTAACACAAATAACAAAAGG + Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1072310062 10:94146022-94146044 CTGTAACCACAGCTACCAAATGG - Intronic
1072362416 10:94672897-94672919 CTGTATTCACACATAACAAAAGG - Intergenic
1073838633 10:107472674-107472696 ATGTAAATACAGATAATTCAAGG - Intergenic
1074483330 10:113848636-113848658 CTGTAAATAACTATAATAAAAGG - Intronic
1074567241 10:114591430-114591452 CTGTAGAAACAAATATTAAATGG + Intronic
1075056329 10:119221385-119221407 CTATAAACACAGATATGGAAAGG - Intronic
1075272737 10:121067514-121067536 CTGTAACAAAATATAATAAACGG + Intergenic
1076715848 10:132363316-132363338 CTGTGAACGCAGAAAATCAAAGG - Intronic
1077640142 11:3873928-3873950 CTATAACCACAGAGATTAAAAGG - Intronic
1077813757 11:5665302-5665324 CCGAAACCACAGATAATATATGG - Exonic
1078803653 11:14673434-14673456 TTTTAAACAAAGAAAATAAAAGG - Intronic
1079871430 11:25802952-25802974 CTGTAATCCCAGATAATCAGGGG + Intergenic
1079984718 11:27188362-27188384 AGGTAAACACAGACAATAAACGG - Intergenic
1080201895 11:29681392-29681414 CTGTAAGCAAAGATAACACAGGG - Intergenic
1081047050 11:38288720-38288742 ATATAAACACAGATAACATATGG + Intergenic
1082796111 11:57379160-57379182 CAGGTAACACAGCTAATAAAAGG + Intronic
1085971293 11:81594297-81594319 CTGAAAACGCAAATAAAAAATGG + Intergenic
1086139558 11:83480253-83480275 CTTTGAATACAGATGATAAAAGG + Intronic
1088350121 11:108877025-108877047 CTAGAAACACAGAGAACAAAAGG + Intronic
1088571353 11:111227033-111227055 TTATAATCACATATAATAAAAGG - Intergenic
1090139479 11:124239499-124239521 CTGTAAACAGAAATAAAAGATGG + Intergenic
1090233914 11:125132303-125132325 ATGTAAACAAAGACAAGAAAAGG - Intergenic
1091002220 11:131919161-131919183 TTGTAAAAAAAGATAATTAATGG + Intronic
1091419595 12:324931-324953 CTGTAAAGTTATATAATAAATGG - Intronic
1092254494 12:6918857-6918879 CTGTAATCACAGATACTAGCGGG + Intronic
1092505086 12:9090483-9090505 CTGAAACCACACATAAGAAAGGG + Intronic
1092803746 12:12199411-12199433 TTTTAAACAGAGAAAATAAAAGG - Intronic
1092896350 12:13014587-13014609 CTGATCACACAGATATTAAAAGG - Intergenic
1093187602 12:16039045-16039067 CTTTAAACACAGAACATAGAAGG - Intergenic
1093409463 12:18846732-18846754 CTGTAAATAAAAATATTAAATGG + Intergenic
1093427467 12:19044549-19044571 CTGTTAACACAGTTAATAAGAGG + Intergenic
1094193566 12:27721733-27721755 CTGTAAAGACAGTTAACAAATGG + Intronic
1094457271 12:30650561-30650583 CTAAAAACACAGCTAATAAGTGG - Intronic
1095381520 12:41599646-41599668 ATGTAAACACTGAAAGTAAAGGG - Intergenic
1096932686 12:55231423-55231445 CTGTGAACAGAGAAAATAGAAGG + Intergenic
1099079293 12:78156235-78156257 CTGAAAAAACAATTAATAAATGG - Intronic
1099370704 12:81826314-81826336 CTATGAACCCAGGTAATAAATGG - Intergenic
1099546152 12:83982684-83982706 CTCTTAACTCTGATAATAAATGG + Intergenic
1099909769 12:88815377-88815399 ATTTAAACAAAGATAATGAAAGG - Intergenic
1100700494 12:97142593-97142615 CTGTAAACACGAATACCAAACGG + Intergenic
1100894391 12:99163252-99163274 CTTTAAAAAAAGAAAATAAAAGG - Intronic
1101013652 12:100476696-100476718 CTAGCAACACAGATTATAAAGGG + Intronic
1101422668 12:104562372-104562394 CTGTAAACACAGAGAAGATGAGG + Intronic
1102701248 12:114841369-114841391 CTAAAAAGACACATAATAAATGG - Intergenic
1103034081 12:117642213-117642235 CTGGGAACACAGATATAAAAGGG - Intronic
1104246390 12:127046077-127046099 CTGTAATCCCAGATACTCAAGGG + Intergenic
1105730965 13:23214976-23214998 CTTTAGACACCGATAATAATGGG - Intronic
1107042015 13:35958955-35958977 ATCTAAACACAGCTAATAAAAGG + Intronic
1108139508 13:47404884-47404906 GTGTAAACACAGAGAGGAAATGG - Intergenic
1108671919 13:52699136-52699158 CTCTTAACACAGAAATTAAAAGG + Intronic
1109380350 13:61551234-61551256 CTCTAAACAAAGACAATAACTGG + Intergenic
1109567535 13:64136822-64136844 CAGTAAAAACAAATAATTAATGG + Intergenic
1109664596 13:65516710-65516732 CAGTAAACACAGATTACAAGGGG - Intergenic
1109775229 13:67032103-67032125 ATGTAAACACAAATTCTAAATGG + Intronic
1110639487 13:77805829-77805851 TTGTAAAATCAGAAAATAAAAGG - Intergenic
1110907084 13:80904586-80904608 CTGTAAACAAAGATGAGAAAAGG + Intergenic
1112359903 13:98708068-98708090 ATATAAACAAAGATATTAAAAGG + Intronic
1112833834 13:103488900-103488922 CTGAAAATAAAGTTAATAAATGG + Intergenic
1112931186 13:104740334-104740356 AAGTAAACAAAGATAAGAAAAGG - Intergenic
1115901812 14:38159535-38159557 GTGTAAGCATAGAAAATAAATGG + Intergenic
1118086501 14:62424028-62424050 CTGTAAAAACAGAACATTAAAGG + Intergenic
1119163170 14:72470369-72470391 CTTTGAACACAGAAAATAACTGG - Intronic
1120106834 14:80505997-80506019 CTATAAAAACAGGTAATAACAGG + Intronic
1121032591 14:90671940-90671962 CTGTGAGCACAGTTATTAAAAGG + Intronic
1124048508 15:26173726-26173748 TTGTATACACAGATTCTAAATGG - Intergenic
1124075641 15:26441696-26441718 CCCTAAACACAGCTAATAAAAGG - Intergenic
1125149199 15:36511923-36511945 CTATAAGAACACATAATAAAAGG - Intergenic
1125456971 15:39869881-39869903 AAGTAAACACAGTTATTAAAGGG + Intronic
1125988574 15:44081298-44081320 CAGTAAAGACAGAAAATTAAAGG - Intronic
1126424820 15:48515941-48515963 CTGAAAACACCAATAACAAAAGG + Intronic
1128457817 15:67842524-67842546 CTGAAAACACAGATATTAGCCGG - Intergenic
1130745686 15:86651426-86651448 CTGTAGAAACACATAAGAAATGG + Intronic
1131279417 15:91008764-91008786 CTGTGAGCACATATATTAAAGGG + Intronic
1132132361 15:99294479-99294501 CTGTAAACAAATACCATAAATGG + Intronic
1133097219 16:3455827-3455849 CTGTAATCCCAGCTACTAAAAGG - Intronic
1133459554 16:5975535-5975557 CTGTGAAAACAGCTTATAAAGGG - Intergenic
1136028789 16:27487851-27487873 GCATAAACACAGATATTAAAAGG + Intronic
1137373921 16:47934771-47934793 CTGTAAAAACAAAAAATTAATGG - Intergenic
1137940634 16:52680354-52680376 CTGTAACCTCACATAGTAAAAGG + Intergenic
1138159432 16:54739561-54739583 CTATAAACACTGTTATTAAATGG - Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1139189421 16:64844403-64844425 CTCTAAACAAATACAATAAAGGG - Intergenic
1139408724 16:66741031-66741053 CTGGAGACACAGTAAATAAAAGG - Intronic
1139799023 16:69506156-69506178 CTGGAATTACAGATAAAAAATGG + Intergenic
1140276195 16:73511150-73511172 CTCTTTACCCAGATAATAAAAGG - Intergenic
1141000215 16:80300730-80300752 CAGGAAACACAGAAAAAAAAAGG + Intergenic
1143035416 17:3992975-3992997 CTGTGAAGAAAGATAATAAAGGG + Intergenic
1143346001 17:6249728-6249750 CAGGACACACAGATAATAAATGG + Intergenic
1144288325 17:13801109-13801131 CTGTAAATACAGGGAATCAATGG - Intergenic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1144428426 17:15168003-15168025 CTGGAAAGAAATATAATAAAAGG + Intergenic
1145266458 17:21381880-21381902 CAGTAAACACAGAGAGTGAATGG + Intronic
1148443289 17:47722865-47722887 CTGTAATCCCAGATACTAAGAGG - Intergenic
1148713933 17:49702123-49702145 CTGTATCCAAAGAAAATAAAAGG - Intronic
1149115104 17:53084458-53084480 CTGTAACCCCAGATGAAAAATGG + Intergenic
1149403018 17:56318213-56318235 ATGTAAAAATAGATAATTAATGG + Intronic
1149666260 17:58366686-58366708 CTGTAAACTGGGATAATAACAGG + Intronic
1150635325 17:66909070-66909092 CTGGAAACACAGACCCTAAAGGG + Intergenic
1150682752 17:67296420-67296442 CTGCAATCACAGCTACTAAAGGG + Intergenic
1150975385 17:70080232-70080254 CTGTAAACACAGTTATTCAGAGG - Intronic
1151064749 17:71136575-71136597 CTGAAAATACAGACAATACAGGG - Intergenic
1151123100 17:71814781-71814803 CTGTGAACCTAGAGAATAAAGGG + Intergenic
1155460160 18:26070607-26070629 ATCTAAACACTGAGAATAAAAGG - Intronic
1155562019 18:27088934-27088956 CTGTAAACAGAGAGGAGAAAAGG + Intronic
1155608040 18:27630500-27630522 CTGTAAAAACTGATAGGAAAAGG - Intergenic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1155971811 18:32090757-32090779 ATGTCAACATAGACAATAAATGG + Intergenic
1157390224 18:47295839-47295861 TTCCAAACACAGATAATTAATGG - Intergenic
1157673178 18:49548022-49548044 ATATAAACACAGAAAATAAAAGG - Intergenic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1159124877 18:64211184-64211206 CATTAAACACGGAAAATAAAAGG + Intergenic
1159178132 18:64865765-64865787 CTGTAAATATGGTTAATAAATGG - Intergenic
1159514110 18:69435361-69435383 ATGTAAATACAGATAAAATATGG + Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164558052 19:29268653-29268675 CTGCAAACACAGAGAAAAACTGG - Intergenic
1167784319 19:51625065-51625087 CTGTAAACACAGAAGAGAAGGGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
925539111 2:4947372-4947394 CTAAAAATACAAATAATAAATGG - Intergenic
925644600 2:6022797-6022819 CAGTATTCACAGTTAATAAAAGG - Intergenic
926551061 2:14301423-14301445 TTGTTAACAAAGTTAATAAAGGG + Intergenic
927365068 2:22285473-22285495 CTATAACCACAGATAAAACAGGG + Intergenic
927449678 2:23197827-23197849 CTATAGACAAATATAATAAAAGG + Intergenic
927532332 2:23818879-23818901 GCTTTAACACAGATAATAAAAGG + Intronic
927768130 2:25832528-25832550 GTGTAAACACACAAATTAAAAGG + Intronic
928216277 2:29364050-29364072 CTATAAACACAGATTCAAAATGG + Intronic
928236489 2:29546305-29546327 CAGCAAAAAAAGATAATAAAAGG + Intronic
929395840 2:41521293-41521315 CTATAAATCAAGATAATAAAAGG + Intergenic
929432128 2:41896085-41896107 TTTTATACACAAATAATAAACGG - Intergenic
930145602 2:47999935-47999957 CTGGAAAAAAAAATAATAAAAGG + Intergenic
931874699 2:66499085-66499107 CTGTAGCCTCAGATAATCAAAGG + Intronic
932076196 2:68665368-68665390 CTTTAAACACAGATCATTATAGG + Intergenic
933421402 2:82050487-82050509 CTCTAAGCAGAGATAATAAAGGG - Intergenic
933510790 2:83238810-83238832 GTGAAACCACAGATAAGAAAAGG + Intergenic
934043707 2:88152648-88152670 CTGATAACACAGAAATTAAAAGG + Intergenic
936007132 2:108899620-108899642 CTGTAAACAGAGAAGGTAAAGGG + Intronic
936415859 2:112310829-112310851 CTGTATGCAAAGATAATTAAAGG - Intronic
936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG + Intergenic
936827207 2:116596971-116596993 CTGTACACATAGATATTCAAAGG + Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939367061 2:141247192-141247214 CTGGAAAGACAAAAAATAAATGG + Intronic
940389320 2:153113215-153113237 CTGTACACTCAGGTAATAATGGG - Intergenic
940440441 2:153709095-153709117 CTGAAAGCACAGAGAATGAAAGG + Intergenic
940810866 2:158241458-158241480 CTTTAAACAGAGATGAGAAAGGG + Intronic
941699071 2:168584611-168584633 CTGTCAAAACAGATAATAGTGGG + Intronic
941705968 2:168658137-168658159 CTGTAAAATTAGATAATAATTGG + Intronic
942040949 2:172062286-172062308 CTGTAAACAAAGTTCATAAAAGG - Intronic
944158620 2:196635843-196635865 CTATCTACACAGGTAATAAAAGG + Intergenic
944188244 2:196973110-196973132 TTGAAAACAGTGATAATAAATGG - Intronic
944381790 2:199118946-199118968 CTGGAAACACATGTAAGAAATGG - Intergenic
944954346 2:204790786-204790808 CTATAAACTCAAATAATAAGCGG - Intronic
945040851 2:205742806-205742828 CTGTAAGCACAAATAGTTAATGG + Intronic
945289951 2:208117040-208117062 GTGTACACACAGATGATCAAGGG + Intergenic
945697859 2:213130912-213130934 ATGTAAACAAAGAGAATACATGG + Intronic
947121574 2:226820849-226820871 CTATTAACACAGATCAAAAAGGG + Intergenic
947669015 2:231925261-231925283 CTGTAAAGTGGGATAATAAAGGG + Intronic
948036418 2:234861847-234861869 CTGTATACCCAGATATTAAGAGG - Intergenic
948987750 2:241535594-241535616 TTAAAAACACAGATAATAAGAGG + Intergenic
1169106443 20:2999714-2999736 CTGTAAACACTGAAATTTAAAGG + Intronic
1169513424 20:6290869-6290891 CACTAAACAAAGATAAAAAATGG - Intergenic
1169724593 20:8715298-8715320 TTGTAAACACAGCTGATATAGGG - Intronic
1174436019 20:50507589-50507611 CTAAAAACACAGAAAATAGATGG - Intergenic
1174598167 20:51701540-51701562 CTGCAAACACAGAGGATTAAAGG - Intronic
1175083729 20:56442135-56442157 CTGTCAACACAGATATAGAAAGG - Intronic
1175242370 20:57559156-57559178 CTGTAAATGCAGGTAATGAAAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176938755 21:14898753-14898775 CTGTAAACAAATTTAATAACTGG - Intergenic
1179459620 21:41525097-41525119 CTGCAAACACAGAGATTCAAGGG - Intronic
1180032649 21:45222986-45223008 AAGTAATCACAGATAATACATGG + Exonic
1180888485 22:19266813-19266835 CAGTAGACACAGAAAATAGAAGG + Intronic
1181365796 22:22376160-22376182 CTGGAAACACAGACATTAATGGG - Intergenic
1181657398 22:24314692-24314714 CAATAAATACAGACAATAAAGGG - Intronic
1184874455 22:47264554-47264576 CAGTAAACAAAGACTATAAATGG + Intergenic
949688478 3:6606734-6606756 CAGAACACAGAGATAATAAAAGG - Intergenic
949707637 3:6837250-6837272 ATGAAAACACAAATAAAAAAAGG + Intronic
949809008 3:7985858-7985880 CTGTACACACAGCTAGTAGAGGG - Intergenic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951373553 3:21884597-21884619 CTAAAAACACAGGCAATAAATGG + Intronic
951381573 3:21990004-21990026 CTTTAAAGACAAATATTAAATGG + Intronic
951666708 3:25133460-25133482 CTGTAAGCACAAATATTAAAAGG + Intergenic
952888632 3:38026914-38026936 TTGTAAAAACAGAAAATAGAGGG - Intronic
953048243 3:39315103-39315125 ATTTAAAGAGAGATAATAAAGGG + Intergenic
955432249 3:58859123-58859145 TTGTAAACAAATAAAATAAAAGG + Intronic
955835602 3:63051476-63051498 CTGTCTACACAGCTAGTAAATGG + Intergenic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
956253612 3:67260929-67260951 CTATGAACAGAGATAAGAAATGG - Intergenic
956925476 3:73982587-73982609 AGGTAAACTCAGATAACAAATGG + Intergenic
957005283 3:74938450-74938472 AGCTAAACAGAGATAATAAACGG + Intergenic
957013498 3:75035590-75035612 CTGTTGAAACAGAAAATAAAAGG - Intergenic
957275113 3:78081094-78081116 CTTTAAACCGATATAATAAAGGG + Intergenic
957684690 3:83486571-83486593 CTGTAAAGACAAACAATATATGG + Intergenic
957809979 3:85209020-85209042 TTGTAAACACAGACAAGAAATGG + Intronic
957810123 3:85211104-85211126 CTGATAACACAGAAATTAAAAGG - Intronic
958121098 3:89289585-89289607 CTGTACACACATATATTAATAGG + Intronic
959685832 3:109145178-109145200 GTGTAAGGACAGATAGTAAAAGG - Intergenic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
960714763 3:120563969-120563991 CAGTAAACACAAATTTTAAAAGG - Intergenic
961104942 3:124232942-124232964 CTTTAAAATCATATAATAAATGG + Intronic
962045121 3:131750578-131750600 TTATAAACAGGGATAATAAAAGG - Intronic
964692749 3:159470339-159470361 CTGTATACACAGACAGTCAAAGG + Intronic
964800458 3:160551456-160551478 CTGGAAGCACAAATAAGAAACGG + Intronic
964954707 3:162338452-162338474 TTGTAAACACAAATATTATATGG + Intergenic
966039949 3:175471140-175471162 GTGTACACAAAGATTATAAAAGG - Intronic
966408368 3:179622836-179622858 CTATAAAAACAGAAAGTAAAAGG + Intronic
967050585 3:185780214-185780236 CTGGAAAGACAGATAATGAAAGG + Intronic
967421778 3:189281197-189281219 AAGGAAACACAGCTAATAAATGG + Intronic
970848440 4:20572237-20572259 CTGGAAGCACAGATGATAACTGG - Intronic
970951274 4:21758520-21758542 CTCTAAACCCATGTAATAAATGG + Intronic
971646608 4:29214433-29214455 CTGTACACACTGATACTTAAAGG + Intergenic
971665541 4:29478742-29478764 CAGTAAACACAACTAATGAAAGG + Intergenic
972175807 4:36404544-36404566 CTGAAATGACACATAATAAAGGG + Intergenic
974146031 4:57948643-57948665 TTCTAAAGACAGATTATAAATGG - Intergenic
974408851 4:61512122-61512144 CTGCCAACATATATAATAAAAGG - Intronic
974715451 4:65664433-65664455 TTGTAAACACAGATTAAAATGGG - Intronic
975215512 4:71749436-71749458 CTGTATAGACAGATAACAAAGGG + Intronic
976863671 4:89697848-89697870 ATGTACAGAAAGATAATAAAAGG + Intergenic
976910182 4:90295476-90295498 CAGAAAACACAAAGAATAAAAGG - Intronic
977148194 4:93473186-93473208 TTGTATAAACATATAATAAAAGG - Intronic
977325399 4:95569326-95569348 TTATAAACACTGAAAATAAAGGG - Intergenic
977785483 4:101028916-101028938 CTATAATCACAGAAAACAAAAGG - Intronic
978415191 4:108467585-108467607 CTGCAAACTCACATTATAAAGGG + Intergenic
978844544 4:113256675-113256697 ATGTAAACACATAGAAAAAAAGG - Intronic
978878018 4:113665554-113665576 CAGTAAAGACAGATTATAAAAGG + Intronic
980335076 4:131461960-131461982 ATATTAACACAGATAATAGAAGG - Intergenic
980828241 4:138097717-138097739 CTGTGAACAGTGATAATGAACGG + Intergenic
981593891 4:146396886-146396908 ATTTAAACACAAATAACAAAAGG + Intronic
982660091 4:158196352-158196374 TTGGAAGCACAGAAAATAAAAGG - Intergenic
982828044 4:160024830-160024852 CTATAAAGACTGAAAATAAAGGG - Intergenic
983770866 4:171547249-171547271 CTGTAAACATGGAGGATAAAAGG - Intergenic
983948756 4:173615787-173615809 TTTTAAACAGAGAAAATAAAAGG - Intergenic
984272770 4:177568012-177568034 CTGTAAAGCCAGAGAATGAAAGG + Intergenic
984326959 4:178267595-178267617 CAGTAAAGACAGAGTATAAAAGG - Intergenic
984748784 4:183251602-183251624 CTGATGACACAAATAATAAACGG + Intronic
985921212 5:2977296-2977318 CTGCAAACAAAGAGAACAAAAGG - Intergenic
986008707 5:3692052-3692074 TTGTAATCAGAGAAAATAAAAGG + Intergenic
986534227 5:8769934-8769956 TTGTGAACAGAGATAATAATTGG + Intergenic
987162315 5:15157027-15157049 ATGAAAACCAAGATAATAAATGG - Intergenic
987429697 5:17817426-17817448 TTGTAAACACAGATGATTTAAGG - Intergenic
988388441 5:30596928-30596950 CTGTGAAGACTGAGAATAAAAGG + Intergenic
988477735 5:31602295-31602317 CTGTAATGACAGCTAATGAAAGG - Intergenic
988950476 5:36253510-36253532 CTATAAACAGACATAATGAATGG + Intronic
989994296 5:50809260-50809282 CTGTAAATACAGAGAATTAAAGG + Intronic
990045768 5:51428880-51428902 TTGAAAACACAGATAAATAAAGG + Intergenic
991380339 5:66016055-66016077 CTGTCCTCACAGATAATCAAGGG - Intronic
992226911 5:74627681-74627703 CTGTAGAAACACATAACAAAGGG - Exonic
993496096 5:88610739-88610761 GTGTAAACACAAATGAGAAAAGG - Intergenic
993928181 5:93898942-93898964 CTGTTAACACAGTAAATAAATGG + Intronic
994069455 5:95583424-95583446 CTATAAACAGAGAAACTAAAAGG + Intronic
994468335 5:100168681-100168703 ATTTAAATACAAATAATAAAAGG - Intergenic
994728850 5:103468502-103468524 TTTTAAATACAAATAATAAATGG - Intergenic
995044408 5:107628933-107628955 CTGCAAATACAGAAAATAAATGG + Intronic
995296448 5:110529937-110529959 ATGTAAAAACAAATGATAAAAGG - Intronic
995824581 5:116280830-116280852 CTGTAGACATATTTAATAAATGG + Intronic
996354971 5:122585467-122585489 GTGTCAAGACAAATAATAAATGG - Intergenic
996709772 5:126532806-126532828 ATGTCAACAAAGAAAATAAAAGG - Intergenic
997910287 5:137864931-137864953 CTCCAAAAACAGATAACAAAAGG + Intergenic
997991273 5:138546067-138546089 CTGTAAACACAAACATCAAAAGG - Intergenic
998022589 5:138783187-138783209 TTGTAAACACCAATAGTAAAGGG + Exonic
999655328 5:153805259-153805281 ATGTAAATAGGGATAATAAAAGG - Intronic
999902976 5:156106765-156106787 CTGTATACACAGATATTAGTGGG - Intronic
999953872 5:156679288-156679310 ATTTAAACACAGGTAATATATGG - Intronic
1000224154 5:159242559-159242581 CTGCAACTACACATAATAAATGG + Intergenic
1001224935 5:169935943-169935965 CTCTAACCACAACTAATAAAAGG + Intronic
1001595810 5:172898067-172898089 CTGTAAACACAGAAATGAAGAGG - Intronic
1003385993 6:5668086-5668108 CTGTGTACACCGACAATAAATGG + Intronic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1004381452 6:15136119-15136141 CTACAAACACAGATAAAATATGG + Intergenic
1005411765 6:25556519-25556541 CTCCAAAGAAAGATAATAAAAGG + Intronic
1005426494 6:25708673-25708695 CAGCAAAGACAGATAACAAATGG + Intergenic
1005617555 6:27589276-27589298 CTCTAAACAGAGTTAACAAATGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007022712 6:38538347-38538369 TTGTCAACACTAATAATAAAAGG + Intronic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1008767947 6:54942376-54942398 CTATAAACACATGTTATAAAGGG - Intergenic
1011503731 6:88019001-88019023 CTGAAAACACAGAAAATTTAAGG - Intergenic
1011868325 6:91860463-91860485 CTATAAATACAGTTAATGAATGG - Intergenic
1012697846 6:102412056-102412078 CTGTCTACAAAGCTAATAAAAGG + Intergenic
1013650529 6:112190007-112190029 CTGTAAAGACAGTTAAGAAGTGG - Intronic
1013954759 6:115828212-115828234 CTGTAAAAGCAAATATTAAATGG - Intergenic
1014283815 6:119472331-119472353 CAGTAACCACAGTAAATAAAAGG + Intergenic
1014523195 6:122470252-122470274 CTATTAACACAGAAACTAAAAGG + Intronic
1015077390 6:129175910-129175932 CGGTAAACAAAGCTAATCAAGGG - Intronic
1016106178 6:140165704-140165726 CAGTAAAGACAGATAATATGTGG + Intergenic
1016236942 6:141879215-141879237 CTGAAAACATAGATATTACAAGG - Intergenic
1016487626 6:144559809-144559831 TTCTCAACACAGGTAATAAATGG - Intronic
1016511177 6:144845017-144845039 GTGTAGACACAGTTAAAAAACGG - Intronic
1016580367 6:145622866-145622888 CTGTGAACAGAGATTATAATGGG + Intronic
1016821539 6:148350764-148350786 CTGTACTCACAGGTATTAAATGG - Intronic
1018620194 6:165723338-165723360 CAGTCAACAGAGAAAATAAAGGG - Intronic
1018848010 6:167568495-167568517 CTGTGAACACACACAATCAATGG - Intergenic
1019040798 6:169102852-169102874 ATGCCAACTCAGATAATAAAAGG - Intergenic
1020708558 7:11576235-11576257 CTATAAATACCGACAATAAAGGG - Intronic
1020806045 7:12791430-12791452 CTAAAAACACAGAAAATTAACGG + Intergenic
1020912027 7:14142814-14142836 CTGTAAAAACAGTTGACAAATGG - Intergenic
1020928417 7:14361752-14361774 CCATATAAACAGATAATAAATGG + Intronic
1020959826 7:14788356-14788378 ATGAAAACACAGAAAATAAAAGG - Intronic
1021376616 7:19915827-19915849 CTGTAAAGGGTGATAATAAAAGG - Intergenic
1021775226 7:24047889-24047911 CTGCAATCAGAGATAATGAATGG - Intergenic
1021946163 7:25729835-25729857 CTGTGCAAACAGATAATAATAGG + Intergenic
1022036033 7:26535596-26535618 GTGTAAACAAAGAAGATAAATGG + Exonic
1022287584 7:28968962-28968984 CTAGAAATACATATAATAAAAGG - Intergenic
1023741712 7:43287165-43287187 CTGTAAAGAGAAATAATACAGGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024062605 7:45710148-45710170 CTGTAATCACAGATATTGAAAGG + Intronic
1024497159 7:50061576-50061598 CTGTAATCCCAGCTAATAAAGGG + Intronic
1024519872 7:50295857-50295879 CTATAATCATAGAAAATAAAGGG + Intergenic
1028002992 7:85524813-85524835 CTTTCAAAACAGATAGTAAAAGG - Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1029574567 7:101394993-101395015 CTGTAATCACAGCTATTCAAGGG - Intronic
1029852035 7:103472008-103472030 CTGTTATCACAGACAAAAAATGG + Exonic
1030707572 7:112710232-112710254 CTGTAAGCAGAGGTAATAAAAGG + Intergenic
1030782035 7:113612669-113612691 CTGATAACACAGTTAAGAAATGG - Intergenic
1030879763 7:114863306-114863328 CTATAAACTCAGATAAGTAATGG - Intergenic
1031365543 7:120896020-120896042 CTTTTAACACAGATAATACGTGG - Intergenic
1031365706 7:120898187-120898209 CTTTTAACACAGATAATACGTGG - Intergenic
1031447969 7:121878070-121878092 CTTTAAACACAGAGAAAAATTGG - Intronic
1031662887 7:124448589-124448611 AAGTAAACACAAATAATAAGAGG + Intergenic
1032232427 7:130086827-130086849 TTAAAAACACAGATATTAAAAGG - Intronic
1032999639 7:137489850-137489872 CTCCAAACACTGATAATAGAAGG - Intronic
1033309201 7:140247747-140247769 CTGTTAACACATACTATAAAAGG + Intergenic
1033990891 7:147285320-147285342 CAGTAAACACAGGTATAAAAAGG + Intronic
1034051137 7:147985518-147985540 CTGAAAGCAGAGATAAAAAAAGG + Intronic
1034712043 7:153201485-153201507 CGGGCAACACAGATAACAAAGGG + Intergenic
1035975628 8:4307559-4307581 CTGTAAACACAGATAAGCAGAGG - Intronic
1037422673 8:18720496-18720518 CTGTAAACACATATAATTCCAGG - Intronic
1038058353 8:23883809-23883831 ATATAAACACATATTATAAATGG + Intergenic
1038762828 8:30400567-30400589 ATGTTACCACAGATAATAACAGG - Intronic
1039949865 8:42161620-42161642 GTTTAAAGACAGAAAATAAAAGG + Intronic
1040835460 8:51725783-51725805 CTGCAAGGACAGATAGTAAATGG + Intronic
1041267878 8:56082751-56082773 CTGTAACCACAGAAAACGAAAGG + Intergenic
1042047638 8:64671789-64671811 CAGAAAACCCAGATGATAAAAGG + Intronic
1042553184 8:70012369-70012391 CTGGAGACAAAGATAAGAAATGG - Intergenic
1043115583 8:76249754-76249776 ATGTTAACACTGATAATAAAAGG + Intergenic
1044872792 8:96636633-96636655 GTGGCAACACAGCTAATAAATGG + Intergenic
1045172715 8:99688077-99688099 CTGCAAACTCAGATATTATAAGG + Intronic
1045727237 8:105188265-105188287 TGGTAAACACAGAAAATAATTGG + Intronic
1046556870 8:115785500-115785522 CTATAAACACAAACTATAAAAGG - Intronic
1047838820 8:128724837-128724859 CTGAAAACCAAGAGAATAAAAGG + Intergenic
1048944792 8:139434411-139434433 ATGCAAAGAGAGATAATAAAGGG + Intergenic
1050575562 9:6991493-6991515 CTCTAAACACAGAAAAAATAAGG - Intronic
1051320306 9:15896697-15896719 GTGTATACACAGATACTGAAGGG - Intronic
1051573660 9:18588997-18589019 CTGTAATCCCAGATACTAAGGGG - Intronic
1051767909 9:20544565-20544587 CTGAAAAAACAGAAAATAATAGG + Intronic
1051857710 9:21588439-21588461 CTGTAAATACAGAAAATAATAGG - Intergenic
1054742488 9:68821996-68822018 ATGAAAATACACATAATAAAAGG + Intronic
1055105826 9:72511897-72511919 GTGTAACCACACAAAATAAATGG + Intergenic
1055729216 9:79263454-79263476 CCGTAAACACATAGAATATATGG - Intergenic
1055789494 9:79907833-79907855 CTAAAACCAAAGATAATAAAAGG + Intergenic
1055938301 9:81623843-81623865 TTCTAAACACAGAAAATAACTGG + Intronic
1055995919 9:82159990-82160012 CTGAAAACATGGTTAATAAAGGG - Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1060632380 9:125171181-125171203 CTATAAAAAGAGAAAATAAAAGG + Intronic
1061951571 9:133939205-133939227 CTTCAAACACAGAAACTAAAGGG + Exonic
1062306468 9:135909687-135909709 CTGTAATCCCAGCTAAAAAAGGG + Intergenic
1187092188 X:16108285-16108307 ATGTAAACATATATAAGAAATGG - Intergenic
1187572158 X:20515744-20515766 CTGTAAATACATATAATTCATGG - Intergenic
1187656270 X:21478163-21478185 CTGACCACAAAGATAATAAAGGG - Intronic
1188862953 X:35279196-35279218 TTCTCAACACAGAGAATAAATGG - Intergenic
1189015410 X:37091806-37091828 ATGTTACCACAGATAATAACAGG - Intergenic
1189234753 X:39478358-39478380 CTGTAAACACAGTAAATGTAAGG + Intergenic
1189274620 X:39776560-39776582 CTAAAAACACAGGTTATAAAAGG - Intergenic
1189274628 X:39776684-39776706 CTAAAAACACAGGTTATAAAAGG - Intergenic
1189274636 X:39776808-39776830 CTAAAAACACAGGTTATAAAAGG - Intergenic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1191097641 X:56690460-56690482 CTAAAAATAAAGATAATAAAAGG - Intergenic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1191822491 X:65327837-65327859 TTTTAAACAGAGAAAATAAAAGG - Intergenic
1192236961 X:69302159-69302181 CTGTCCACACAGATAATACAAGG + Intergenic
1192388562 X:70699790-70699812 TTGTAAACCAAGATGATAAAAGG - Intronic
1193651768 X:84144142-84144164 CTAAAAACACAATTAATAAAGGG + Intronic
1193754522 X:85391372-85391394 CTGTACAGCCACATAATAAAAGG + Intergenic
1194541992 X:95185313-95185335 CTGAAAGCACAGACAATAAAAGG - Intergenic
1194691489 X:96991477-96991499 AAGATAACACAGATAATAAATGG + Intronic
1195369688 X:104161032-104161054 ATGTAAATAAAAATAATAAAAGG - Intergenic
1195465614 X:105176000-105176022 ACGTAAACACAAATAATAATGGG + Intronic
1195868167 X:109456097-109456119 CTGTAGAAACAGATCATGAATGG + Intronic
1196284235 X:113861624-113861646 ATGCAGACACACATAATAAAGGG - Intergenic
1196841998 X:119867616-119867638 GAGAAAACACAGATGATAAAAGG - Intergenic
1198118988 X:133572610-133572632 CTAAAAACAGAGATAAAAAAGGG + Intronic
1198666355 X:139027705-139027727 CTGTAAACACGCTAAATAAAAGG + Intronic