ID: 901037847

View in Genome Browser
Species Human (GRCh38)
Location 1:6347072-6347094
Sequence ACTTCCAGCCACAGACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901037839_901037847 2 Left 901037839 1:6347047-6347069 CCCCAGCCAGAGACAGAACCTTG 0: 1
1: 0
2: 1
3: 23
4: 280
Right 901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 221
901037842_901037847 0 Left 901037842 1:6347049-6347071 CCAGCCAGAGACAGAACCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 174
Right 901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 221
901037844_901037847 -4 Left 901037844 1:6347053-6347075 CCAGAGACAGAACCTTGGGACTT 0: 1
1: 0
2: 0
3: 6
4: 143
Right 901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 221
901037840_901037847 1 Left 901037840 1:6347048-6347070 CCCAGCCAGAGACAGAACCTTGG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 221
901037838_901037847 10 Left 901037838 1:6347039-6347061 CCAAGAGGCCCCAGCCAGAGACA 0: 1
1: 0
2: 4
3: 31
4: 343
Right 901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 221
901037837_901037847 23 Left 901037837 1:6347026-6347048 CCAGATGGGCTGGCCAAGAGGCC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG 0: 1
1: 0
2: 2
3: 16
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901037847 Original CRISPR ACTTCCAGCCACAGACTGGA AGG Intronic
900305034 1:2001738-2001760 ACTGTGAGCCACTGACTGGATGG + Intronic
901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG + Intronic
901512567 1:9724745-9724767 ACTCCCAGCCACAGGCCAGAGGG - Intronic
903579179 1:24358214-24358236 ACTCCCTGCCGCAGACTGAAGGG - Exonic
904288760 1:29470522-29470544 ATGTGGAGCCACAGACTGGAGGG + Intergenic
906612837 1:47215046-47215068 GCTTCCAACCACAGATAGGAGGG - Intergenic
906908534 1:49921618-49921640 GCCTTCAGCCACAGACTGAAGGG - Intronic
908666544 1:66497619-66497641 ACTTGCAGCAACAGTCTGCAGGG + Intergenic
909180757 1:72420519-72420541 ACTTACACCCACAACCTGGAAGG + Intergenic
910443851 1:87280793-87280815 ACTTCCAGCTTCAGGCTGGGTGG - Intergenic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
911318658 1:96385587-96385609 AAGACAAGCCACAGACTGGAAGG + Intergenic
913596130 1:120378898-120378920 ACTAAATGCCACAGACTGGATGG - Intergenic
913602271 1:120433459-120433481 TTTTCCAGCCACACACAGGAGGG + Intergenic
914084779 1:144443178-144443200 TTTTCCAGCCACACACAGGAGGG - Intronic
914091148 1:144500078-144500100 ACTAAATGCCACAGACTGGATGG + Intergenic
914190787 1:145408344-145408366 TTTTCCAGCCACACACAGGAGGG - Intergenic
914307456 1:146434117-146434139 ACTAAATGCCACAGACTGGATGG - Intergenic
914363443 1:146957065-146957087 TTTTCCAGCCACACACAGGAGGG + Intronic
914488234 1:148130069-148130091 TTTTCCAGCCACACACAGGAGGG - Intronic
914588596 1:149085189-149085211 TTTTCCAGCCACACACAGGAGGG - Intronic
914594651 1:149139014-149139036 ACTAAATGCCACAGACTGGATGG + Intergenic
916320217 1:163497252-163497274 AAATCCAGCAGCAGACTGGAGGG - Intergenic
918602369 1:186378540-186378562 ACTTCCATCCACAGACCAGAGGG + Intronic
919479121 1:198064647-198064669 CTTTCCAGCCAAAGGCTGGAGGG - Intergenic
919867693 1:201794583-201794605 ACATCCAGCCACAGATTGAGAGG + Intronic
920156077 1:203952740-203952762 ACTTACAGCAATATACTGGATGG + Intergenic
920521985 1:206634910-206634932 ACAGTCAGCCACAGACGGGAAGG - Intergenic
921317705 1:213907668-213907690 AATTCCACCCTCAGGCTGGAAGG + Intergenic
921429567 1:215049426-215049448 AAGACAAGCCACAGACTGGAAGG - Intronic
922534431 1:226369364-226369386 CCTTCCAGCTACATCCTGGAGGG - Intronic
922813758 1:228434275-228434297 GCCTCCTGCCACAGCCTGGAGGG + Intergenic
923835104 1:237602682-237602704 ATCTCCAGCCACATTCTGGAAGG - Intronic
1062859857 10:802972-802994 GCTTCCAGCCCCACTCTGGAGGG - Intergenic
1066454400 10:35560555-35560577 ACTTACAGCCACAAACTGTGGGG + Intronic
1069725761 10:70576835-70576857 ACTTCCATCCACAGATTTGGAGG - Intergenic
1071567128 10:86677104-86677126 ACTTCCAGCCACAGCTTGTAGGG + Intronic
1072504891 10:96055906-96055928 AATTCCAGAGAGAGACTGGAGGG - Intronic
1072654470 10:97320312-97320334 AGCGCCAGCCTCAGACTGGAGGG + Exonic
1072695624 10:97600826-97600848 ACAACCAGCCAAAGTCTGGAGGG - Intronic
1073116713 10:101095553-101095575 ACTTCCAGGTAAAGGCTGGAAGG - Intronic
1073553475 10:104425688-104425710 ACTTCTCACCACAGACTGCACGG - Intronic
1075276204 10:121094914-121094936 TCTTGCAGCCACAAACTTGATGG + Intergenic
1076220254 10:128728088-128728110 ACTTCCAGACACAGAGCTGAAGG - Intergenic
1077710055 11:4527190-4527212 ACCTTCAGCCACAGACTGAAGGG + Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079069762 11:17333993-17334015 ACTTCCTGCCACAGAGACGAAGG - Intronic
1084870175 11:72093390-72093412 CCCTCCAGCTACAGCCTGGATGG + Intronic
1085186633 11:74581425-74581447 TGTTCCAGACACAGTCTGGATGG - Intronic
1087135329 11:94710879-94710901 ACTACCTGCTACAGAGTGGAAGG - Intronic
1087332906 11:96805401-96805423 ATCCCCAGCCACAGACTGGGAGG - Intergenic
1089137863 11:116263873-116263895 ACCTCCAGCAACAGACAGGGCGG + Intergenic
1090405799 11:126475270-126475292 CCTTCCAGCCTCAGCCTGCATGG + Intronic
1091061222 11:132464217-132464239 ACTTCCAGACAGAGACATGAAGG - Intronic
1092058829 12:5531422-5531444 AATTCCAGCCAGAGGGTGGAGGG + Intergenic
1092571135 12:9722760-9722782 ATGTCCTGCCAAAGACTGGAAGG - Exonic
1096194325 12:49639955-49639977 ACTTTTAGCCACAGAGTGGCTGG + Exonic
1096307006 12:50486445-50486467 AATACAAGCCACAGACTGGGGGG + Intergenic
1096678071 12:53236347-53236369 ACATCCACCCACACACTGGCTGG - Intergenic
1100564685 12:95783894-95783916 ACCTCCATCAACAGAGTGGAAGG - Intronic
1102529179 12:113533329-113533351 ACTTCCACCCCTAGGCTGGAGGG - Intergenic
1104538177 12:129638094-129638116 TCTTCCAGCCCCTGGCTGGACGG - Intronic
1104932720 12:132348260-132348282 CCTTGCAGACACAGACAGGATGG - Intergenic
1104962851 12:132496343-132496365 ACTGCCAGCCACAGACAGCAGGG - Intronic
1108103521 13:46983645-46983667 ACTACCAGCCACATTCTGAAAGG - Intergenic
1111451594 13:88425878-88425900 ATTTCAAGTCACAGACTAGATGG - Intergenic
1113028200 13:105964481-105964503 ACTTCCAGGTAGAGAATGGAAGG - Intergenic
1113589910 13:111491200-111491222 ACTCCCAGCCCCAAGCTGGATGG - Intergenic
1116280308 14:42898537-42898559 ACTTGAAGACACAGAATGGAAGG - Intergenic
1117033979 14:51707642-51707664 AATTTCAGCCACAGACTGGGAGG - Intronic
1119426173 14:74535858-74535880 ACTCCCAGCACCAGACAGGAGGG - Intronic
1119682740 14:76605019-76605041 ACCTCCAGGCACTGTCTGGAGGG - Intergenic
1120549405 14:85850669-85850691 ACTTCAAGCCACCAACTTGAGGG + Intergenic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1121707494 14:96009686-96009708 AAGACCAGCCACAGACTGGGAGG + Intergenic
1127130330 15:55855596-55855618 TGTCCCAGCCACAGCCTGGATGG - Intronic
1128933953 15:71729815-71729837 ATTTCCAGCCACAGACCGAGAGG + Intronic
1129119044 15:73383978-73384000 ATTTATAGCCACAGACTGGGAGG + Intergenic
1130519139 15:84648956-84648978 ACTTCCAGCGGGAGAATGGAGGG - Intronic
1133896063 16:9930039-9930061 ACTTCCAGCCATAAAAGGGAGGG + Intronic
1134825273 16:17279509-17279531 ACTTCCAGCCTGGGACTTGAAGG - Intronic
1136587777 16:31198741-31198763 AATCCCAGCCCCAGTCTGGATGG - Intergenic
1136742381 16:32548350-32548372 ACATCCAGACAAAAACTGGAAGG + Intergenic
1137372316 16:47919010-47919032 AATTCCAGCCCAAGACAGGAAGG - Intergenic
1137477129 16:48818521-48818543 ACTTCCAGCCCCATCCTGGGTGG - Intergenic
1137493790 16:48953263-48953285 ACTTCCAGGCACAGTGTGTAAGG - Intergenic
1137568897 16:49551789-49551811 TGTCCCAGCCACAGACTTGAGGG - Intronic
1137593223 16:49706555-49706577 ACTTCCAGCCACTGGTGGGATGG + Intronic
1139542746 16:67630719-67630741 ACTTCGACCACCAGACTGGAAGG - Intronic
1140033618 16:71357329-71357351 ACTTGCAGGAACAGACTGGGGGG - Intergenic
1141249965 16:82346785-82346807 GCTTCCGGTCACAGTCTGGAAGG - Intergenic
1203027218 16_KI270728v1_random:526878-526900 ACATCCAGACAAAAACTGGAAGG - Intergenic
1203044503 16_KI270728v1_random:807553-807575 ACATCCAGACAAAAACTGGAAGG + Intergenic
1143822881 17:9578836-9578858 ACACCCAGCCACAGGGTGGAGGG + Intronic
1143862391 17:9900349-9900371 GCTTCCAGCCACTGACTGACAGG + Intronic
1143867933 17:9937571-9937593 CCTGCCAGCCACAGACCGCAGGG - Intronic
1144522922 17:15966368-15966390 CAGTCCAGCCACAGGCTGGATGG - Intronic
1144873876 17:18386733-18386755 ACTTGAAACCACAGATTGGAAGG - Intronic
1147018077 17:37508310-37508332 TCTTCCAGCCCCACTCTGGAGGG + Intronic
1148123484 17:45225290-45225312 ACTGCCAGCCCCAGAAGGGAAGG - Intronic
1151999517 17:77636722-77636744 GCTTCAAGCCAGAAACTGGAAGG - Intergenic
1152242548 17:79167967-79167989 ACCTCCAACCACAGAGTGGGGGG + Intronic
1203163147 17_GL000205v2_random:70182-70204 ACATCCAGCCACAGGTGGGATGG - Intergenic
1155235435 18:23813912-23813934 ACTTCCAGGCACAGAATGGATGG + Intronic
1156090032 18:33455968-33455990 ATTTCCAGCAAGAGATTGGAGGG - Intergenic
1157891692 18:51424155-51424177 GCTTCCATCCCCAAACTGGACGG - Intergenic
1163842958 19:19622619-19622641 ACTTCCAGCCACAGGTTGTGGGG - Intergenic
1164745153 19:30606694-30606716 ACTCCCAGGCACAAACGGGAGGG + Intronic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1167156571 19:47742673-47742695 AGTTCCAGCCACAGACACGTGGG - Exonic
925604815 2:5648243-5648265 ACTAAATGCCACAGACTGGATGG - Intergenic
925994052 2:9277302-9277324 TCTTCCAGCCGCAGACTCGCGGG - Intronic
926308837 2:11659888-11659910 ATTTCAAGGCACAGACTGCACGG + Intronic
926364269 2:12118713-12118735 AATTCCAGCCACTGGCTGGGAGG - Intergenic
926633633 2:15158909-15158931 ACAACCAGCCACAGACAGCAGGG - Intergenic
927128461 2:20035731-20035753 ACTTAGTGCCTCAGACTGGAAGG - Intronic
927747912 2:25639573-25639595 ACAGGCTGCCACAGACTGGAAGG - Intronic
927844900 2:26466301-26466323 ACTGACAGCCCCAGACTGGGAGG - Intronic
928800772 2:35088596-35088618 ACTTCCAGTCACATACAGAAAGG - Intergenic
929449679 2:42028324-42028346 ACTTCCTGCCACGGAAGGGAGGG + Intergenic
930113487 2:47698716-47698738 TCTTCCAGCCAGAGACTGCATGG - Intronic
930223486 2:48768519-48768541 ACTTCCTGGCACAGCCTTGATGG - Intronic
933173924 2:79156090-79156112 ACTTGCAGCCACAGACTCCAGGG - Intergenic
933503841 2:83152246-83152268 ACTTCCAGTCACAGACTGATGGG + Intergenic
935481091 2:103591413-103591435 ACTTCCCACAACAGGCTGGAAGG - Intergenic
939935139 2:148282368-148282390 ACTTCCAGACTCAAATTGGATGG + Intronic
939958527 2:148546460-148546482 ACTTCCTGCCTGAGGCTGGAAGG - Intergenic
942100948 2:172582928-172582950 ATTTCCAGCCTCAGGCTGCATGG - Intronic
943903572 2:193471284-193471306 ACTTCCAGCCATGGACTAGGAGG - Intergenic
944100097 2:196015937-196015959 TCTTTCACCCACAGACTGCAAGG + Intronic
947517789 2:230822486-230822508 CCTTCCAGCCACAGTGGGGACGG - Intergenic
947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG + Intronic
1170416983 20:16154837-16154859 AAGACAAGCCACAGACTGGAAGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1174413721 20:50353254-50353276 ACTTCTAGCCCCAGACAAGAAGG + Intergenic
1175036297 20:56004316-56004338 ACTTCAAGCCACAGAATTGGTGG - Exonic
1175309863 20:58004251-58004273 TCATCCAGGCACAGCCTGGAAGG + Intergenic
1175414404 20:58792416-58792438 TCTGCCAGCCAGAGCCTGGATGG + Intergenic
1175618155 20:60420882-60420904 ATTTCCAGCACCAGCCTGGAGGG - Intergenic
1176338331 21:5619685-5619707 ACATCCAGCCACAGGTGGGATGG + Intergenic
1176339739 21:5682758-5682780 ACATCCAGCCACAGGTGGGATGG + Intergenic
1176471993 21:7114911-7114933 ACATCCAGCCACAGGTGGGATGG + Intergenic
1176495554 21:7496689-7496711 ACATCCAGCCACAGGTGGGATGG + Intergenic
1176505088 21:7641698-7641720 ACATCCAGCCACAGGTGGGATGG - Intergenic
1178720958 21:35008383-35008405 ACTTCCAGCCACCATTTGGAAGG + Intronic
1179019981 21:37630979-37631001 AGTTCCAGCAAGAGACTGGTTGG - Intronic
1182238390 22:28895066-28895088 ACTTCCAGAGACAGAAAGGATGG - Intronic
1182933875 22:34201589-34201611 GCATCCAGCCCCAGGCTGGAAGG - Intergenic
1183315327 22:37133853-37133875 ACTTCCAGGAACAGAGTGCAGGG - Intronic
1184391174 22:44204538-44204560 ACCTCCAGCCACCTGCTGGATGG - Intronic
951233064 3:20201805-20201827 ACCTCCAGCCAAAGACTGCCAGG - Intergenic
951446336 3:22784136-22784158 ACTTCAAGACACAGACTTTAAGG + Intergenic
951580739 3:24160116-24160138 ACTGCCAGCCACACCCTGGTGGG - Intronic
952991602 3:38835635-38835657 ATTTCCATCCTTAGACTGGAAGG + Intergenic
953388899 3:42523185-42523207 GTTTCCAGGCCCAGACTGGAGGG + Intronic
953898679 3:46824807-46824829 ACATTCAGCCAAAGACTGAAAGG + Intergenic
954665894 3:52251831-52251853 AATTCCAGCTACAGGCTGGGAGG - Intergenic
955003078 3:54945280-54945302 ACTGCCACAGACAGACTGGAGGG - Intronic
955876269 3:63493092-63493114 ACTTCCAGCCACCTGCTTGAGGG - Intronic
955994127 3:64660565-64660587 ATTTCCAGCCCCAGGCAGGATGG - Intronic
958782636 3:98561295-98561317 ACTGCCTGCCACAGTTTGGAAGG + Intronic
960814471 3:121658671-121658693 ACCTCCAGCCACTGCCTGGCTGG - Intronic
960891110 3:122449302-122449324 AGTTCCAGGCTCATACTGGATGG - Intronic
962644809 3:137427320-137427342 AATACAAGCCACAGACTAGAAGG + Intergenic
964517167 3:157524534-157524556 ACTTTAAGCCACAGACTGGGAGG - Intronic
964734116 3:159898882-159898904 ATTTCTAGCCAGAGACTGCATGG - Intergenic
965687427 3:171319346-171319368 AGTTCTAACCACAGTCTGGAAGG + Intronic
966821824 3:183930830-183930852 AGTTTAAGCCACAAACTGGATGG - Intronic
967028408 3:185584256-185584278 ACTTTCAGCAACAGCCTGGTTGG + Intronic
968263001 3:197340105-197340127 ATTTCCAGCCACACACCCGAGGG - Intergenic
968880767 4:3298196-3298218 ACTTCTATCCTCAGACTGAAAGG - Intronic
971387431 4:26154145-26154167 GCCTCCACCCACAGAGTGGAGGG - Intergenic
978616068 4:110597359-110597381 ACTTCCAGTCAGAGTTTGGAAGG - Intergenic
988393769 5:30669913-30669935 GCCTACAGCCACAGACTGAAGGG + Intergenic
989305276 5:39947978-39948000 ACTTCCAGTCACACACTGGAGGG - Intergenic
989413754 5:41149902-41149924 ATTTCCAGACACAGTCTGTAGGG + Intronic
990178095 5:53129567-53129589 ACATTGAGCCACAGACTGTAGGG - Intergenic
992319731 5:75601721-75601743 GCCTTCAGCCACAGACTGAAGGG + Intergenic
995317975 5:110797744-110797766 ACTTCCGGCCACCCTCTGGAAGG + Intergenic
997030635 5:130123592-130123614 ACCCCAGGCCACAGACTGGAAGG - Intronic
998935061 5:147226334-147226356 ACTTCCACCCACAGAGAGCAAGG + Intergenic
1001301849 5:170539332-170539354 ACTCCCAACCACAGACTTCAAGG + Intronic
1001756775 5:174176404-174176426 CCTTTCAGCCAGAAACTGGAAGG - Intronic
1002059667 5:176619120-176619142 TCTTCCAGCTAGAGGCTGGAGGG + Intergenic
1003472147 6:6446897-6446919 ACTTCGTGTCACAGCCTGGATGG + Intergenic
1006829769 6:36961758-36961780 ACTGCCAGCCACTGACTTGCTGG - Intronic
1007276534 6:40678400-40678422 GCTTCCAGCCACTGACTGAATGG - Intergenic
1011721521 6:90161790-90161812 AGTGCCAACCACAGACAGGATGG + Intronic
1012007282 6:93729200-93729222 AGTTTCAGCCACATACTGGCCGG - Intergenic
1018369467 6:163154566-163154588 ACATCTAGGCACAGAATGGAGGG - Intronic
1019176958 6:170164883-170164905 ACTTCCAGCCACAGAGCTGTAGG + Intergenic
1019177015 6:170165181-170165203 ACTTCCAGCTACAGACTCCTGGG + Intergenic
1023411791 7:39895131-39895153 ACTTCCAGGGAAAGAATGGAGGG - Intergenic
1025581460 7:62724092-62724114 ACGTCCATTCACAGAATGGATGG - Intergenic
1028254707 7:88579609-88579631 AAGACCAGCCACAAACTGGAAGG - Intergenic
1028701106 7:93781237-93781259 AAGTCAAGCCACAGACTGGAAGG + Intronic
1028980772 7:96965730-96965752 ACCTCCAGCCATAGACTCTAAGG - Intergenic
1030703306 7:112665346-112665368 ACAAACAGCCACAGACTGGGAGG - Intergenic
1032056935 7:128691208-128691230 ACTTCCAGCCATGGAAGGGAAGG - Intergenic
1033737809 7:144241094-144241116 ACTTCCAGCCAGTGATGGGAAGG - Intergenic
1033745246 7:144309863-144309885 ACTTCCAGCCAGTGATGGGAAGG + Intergenic
1036815909 8:11902707-11902729 CCCTCCAGTCACAGACAGGAAGG - Intergenic
1039941806 8:42097786-42097808 ACCTCCAGCCTGGGACTGGATGG - Intergenic
1041112039 8:54492345-54492367 ATATGCAGCCACAGACTCGAAGG + Intergenic
1041477252 8:58280012-58280034 GCTTCCAGCCAAAGACAAGAAGG + Intergenic
1041775237 8:61515616-61515638 ATTTCCAGCCACCTCCTGGATGG + Intronic
1045393730 8:101739724-101739746 GCCTTCAGCCACAGACTGAAGGG + Intronic
1045402421 8:101832341-101832363 ACTTAGACCCACACACTGGACGG + Intronic
1046271186 8:111899481-111899503 AAGTGCAGCCACAGCCTGGAAGG - Intergenic
1047160345 8:122371063-122371085 GCCTTCAGCCACAGACTGAAGGG + Intergenic
1048534271 8:135277723-135277745 ACTCCCAACCCCAGGCTGGAGGG - Intergenic
1048907679 8:139104253-139104275 GCCTTCAGCCACAGACTGAAGGG - Intergenic
1049259096 8:141629319-141629341 ACTTGCAGCCTCAGTCAGGAAGG - Intergenic
1049270085 8:141690969-141690991 ACTTCCAGCAACCCTCTGGAGGG - Intergenic
1049295090 8:141828787-141828809 ACAACCTGCCACAGACTGGGTGG + Intergenic
1049661795 8:143822881-143822903 ACTTCCAGACACAGCCTTGAGGG + Intronic
1050416516 9:5423346-5423368 ACTTCCAGACACATACTGGGAGG - Intronic
1051115680 9:13691714-13691736 AAGACAAGCCACAGACTGGAAGG - Intergenic
1051125934 9:13805827-13805849 ACCTTCAGCCACAGACTGCACGG - Intergenic
1051442880 9:17105370-17105392 ACTGCCAGCAACATACTGAATGG - Intergenic
1056034004 9:82584567-82584589 ACTGCCAGGCACAGCCAGGAAGG + Intergenic
1056805869 9:89728531-89728553 ACTTCCATCCACAGACTCCTTGG + Intergenic
1057617280 9:96602989-96603011 GCTTCCAGCCAGCTACTGGATGG + Intronic
1058083585 9:100724858-100724880 ACTTCCAGCAACACAGAGGATGG - Intergenic
1060204248 9:121673251-121673273 ACTTCCAGCCCCAGAGAAGATGG - Intronic
1061570148 9:131473093-131473115 ACTACCAGGAACAGACTGGCGGG - Intronic
1203423334 Un_GL000195v1:15235-15257 ACATCCAGCCACAGGTGGGATGG - Intergenic
1191127608 X:56974463-56974485 ACTTGCAGCCAGAGGCTGCATGG - Intergenic
1191737970 X:64407274-64407296 TCTTCCAGCCCCAGAATGGTTGG - Intergenic
1195175770 X:102314140-102314162 AGTTCTAGCCACAGTCTGCAGGG + Intronic
1195183094 X:102372953-102372975 AGTTCTAGCCACAGTCTGCAGGG - Intronic
1195334537 X:103838084-103838106 ACATTAAGCCACAGACTGGAAGG + Intergenic
1196244728 X:113387505-113387527 ACAGCCAGCAACATACTGGATGG - Intergenic
1199917878 X:152363919-152363941 ACTTCCAACCCCAGACTCTAAGG - Intronic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1201349906 Y:13028374-13028396 ACTGAGAACCACAGACTGGAGGG + Intergenic
1201733367 Y:17229982-17230004 ACTTGAAGCCAGAGACTGCATGG + Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic