ID: 901040027

View in Genome Browser
Species Human (GRCh38)
Location 1:6358239-6358261
Sequence CTGCATCTCCAGAAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901040023_901040027 -9 Left 901040023 1:6358225-6358247 CCACAGACACGCCACTGCATCTC 0: 1
1: 0
2: 1
3: 14
4: 214
Right 901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 314
901040020_901040027 0 Left 901040020 1:6358216-6358238 CCCTTCAACCCACAGACACGCCA 0: 1
1: 0
2: 0
3: 7
4: 160
Right 901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 314
901040022_901040027 -8 Left 901040022 1:6358224-6358246 CCCACAGACACGCCACTGCATCT 0: 1
1: 0
2: 1
3: 7
4: 109
Right 901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 314
901040018_901040027 22 Left 901040018 1:6358194-6358216 CCTAAGGCAGTTCCGGCGAAGTC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 314
901040021_901040027 -1 Left 901040021 1:6358217-6358239 CCTTCAACCCACAGACACGCCAC 0: 1
1: 0
2: 0
3: 11
4: 243
Right 901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 314
901040019_901040027 10 Left 901040019 1:6358206-6358228 CCGGCGAAGTCCCTTCAACCCAC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901040027 Original CRISPR CTGCATCTCCAGAAGAGGGA AGG Intronic
900808201 1:4781697-4781719 CTGCATCTCCGTCACAGGGATGG - Intronic
900861246 1:5233894-5233916 GTGCATCTCCAGAAGAGAAGAGG - Intergenic
901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG + Intronic
901342030 1:8503361-8503383 CTATATCCCCAGAAGCGGGATGG - Intronic
901627256 1:10631305-10631327 CTCCCTCCCCAGCAGAGGGAGGG - Intergenic
902404750 1:16176503-16176525 CTGCCGCTCCAGGGGAGGGAGGG + Intergenic
902532896 1:17101792-17101814 CTACATCTCCAGAAAATGGTTGG - Intronic
903002409 1:20275643-20275665 CTGCATTTCAGGCAGAGGGAAGG + Intergenic
903153368 1:21428575-21428597 CTGCACATCCAGAAGACGGGCGG + Intergenic
903358349 1:22761885-22761907 CTGGCTCCCCAGCAGAGGGAGGG + Intronic
904622010 1:31781424-31781446 CTGCACGTCCAGAGGAGGGAGGG + Intergenic
905387718 1:37615721-37615743 CTGCATCTACAGAGAAGGGATGG + Intronic
905456971 1:38094965-38094987 CTGCATCCCCAGAGGAGGCTGGG + Intergenic
905769813 1:40630186-40630208 CTGCATTACCAGTGGAGGGAGGG + Intronic
906608606 1:47187472-47187494 CTGCATGTGCAGGAGAGCGAGGG + Intronic
907369462 1:53991508-53991530 CTGCATTTCCTGGAGAGGGATGG - Intergenic
907497694 1:54855669-54855691 CGGCAGCTCCAGAGGAGTGAGGG - Intronic
907622810 1:55998828-55998850 GAGCATCTGCAGAAAAGGGATGG - Intergenic
907751249 1:57265221-57265243 CTGACTCACCAGAAGAGAGAAGG - Intronic
907880536 1:58546216-58546238 CAGTTTCTCCTGAAGAGGGAAGG + Intronic
908709953 1:67003914-67003936 CTGCATTTCCAGCAGAGGAAAGG + Exonic
908817355 1:68047900-68047922 GTGCAGCCCCAGAAGAGGCATGG + Intronic
909482533 1:76141265-76141287 CTCCATTTCCAGAAAAGAGAGGG + Intronic
910722810 1:90305623-90305645 GTGCATATCTAGAAGTGGGATGG + Intergenic
911091769 1:94022872-94022894 CTGCACCTCCAGAACAGGTGCGG - Intronic
911834343 1:102596984-102597006 TTTCATCTCAAGAAAAGGGAAGG + Intergenic
911935406 1:103963581-103963603 CTGCATCACAAGCAGAGGAAGGG - Intergenic
916419504 1:164623142-164623164 CTACATCTAGAGAAGAGAGAAGG - Intronic
916428442 1:164703993-164704015 CTGCTTTTCCAAGAGAGGGAGGG - Intronic
918199559 1:182254518-182254540 CTGCAGAACCAGAAGAGGAAAGG + Intergenic
918303165 1:183222338-183222360 GTGCAACCCCAGAAGAGAGATGG + Intronic
919589106 1:199477478-199477500 CTGCTTCTCTAGAAGATGGTAGG - Intergenic
920913090 1:210234951-210234973 CAGCATCCCCAGAAGACTGAGGG - Intronic
921367353 1:214386051-214386073 CTGCATTTCAAAAAGAGAGATGG - Intronic
922725999 1:227923354-227923376 CTGCAGTTCCTGAACAGGGATGG - Intronic
922994249 1:229943595-229943617 CTGCATCACCAGGGGAGGGAGGG + Intergenic
923777527 1:236993184-236993206 TTCCAGCTCCAGAAGACGGAGGG - Intergenic
1063279195 10:4606874-4606896 CTTCATATCCAGAAGAAAGAGGG + Intergenic
1063802285 10:9594057-9594079 CTGTATCTTCACAAGGGGGAAGG + Intergenic
1063942954 10:11149397-11149419 CTGCATCTGCTGATGAGGGTGGG - Intronic
1064947478 10:20806972-20806994 CTGCATCTACAGAACCAGGAAGG + Intronic
1065409328 10:25406284-25406306 CTGACTTTCCAGAAGATGGAAGG - Intronic
1066539140 10:36425757-36425779 CAGCATCTCCAGAAGTGATAGGG + Intergenic
1067270812 10:44789986-44790008 CTGTGTCTCCAGAAGAGATACGG - Intergenic
1070302063 10:75210841-75210863 CTGCAGCTCCAGCAGCTGGAGGG - Exonic
1070338795 10:75477969-75477991 CTGCCTCTGCAGAAGAGGACAGG - Intronic
1070488560 10:76954098-76954120 CTGCACTTCCAGAAGTGGGGTGG - Intronic
1071501029 10:86204531-86204553 CTGCATCTTGAGAAGAGTGAGGG + Intronic
1073051146 10:100668170-100668192 CAGCATCTCCAGGAGAGAGAAGG + Intergenic
1080351061 11:31386338-31386360 CTTCATCTCAAGCAGAAGGAAGG - Intronic
1081250137 11:40819758-40819780 CTGCATCTGCAGAAAACTGAAGG + Intronic
1082833993 11:57639034-57639056 CTGCACCTCCAGAAGTTGTAGGG + Intergenic
1084084729 11:66849794-66849816 CTGCAGATCCAGGGGAGGGAGGG + Exonic
1084287688 11:68142526-68142548 CAGCAGCCCCAGGAGAGGGAGGG - Intergenic
1084350140 11:68591278-68591300 CCGCATCTCCAGGACAGGGGAGG + Intronic
1084694639 11:70746254-70746276 CCGCCTCTCCAGGACAGGGAAGG + Intronic
1084694671 11:70746353-70746375 CCGCCTCTCCAGGACAGGGAAGG + Intronic
1084694702 11:70746452-70746474 CCGCCTCTCCAGGACAGGGAAGG + Intronic
1085081624 11:73639431-73639453 CTCCACCTACAGAAGAGGAAAGG + Intergenic
1085411252 11:76292027-76292049 CTCCATCTACAGGAGAGGCATGG + Intergenic
1086974787 11:93119366-93119388 CTTCATCCCCAGACCAGGGATGG + Intergenic
1088389224 11:109295521-109295543 CTACATTTTTAGAAGAGGGAGGG + Intergenic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1090730821 11:129572154-129572176 CTGCATGTCCAGCAGGGGTAGGG - Intergenic
1092658727 12:10716133-10716155 CTGAATCTCCGGAGGAGGAAAGG + Intronic
1095573874 12:43712644-43712666 CTGAAACTTGAGAAGAGGGAGGG + Intergenic
1095796253 12:46221998-46222020 CAGCCTCTACAGAAAAGGGAAGG + Intronic
1096737516 12:53667371-53667393 CTGAGTCTCTAGAACAGGGAAGG + Intronic
1099252402 12:80272551-80272573 TTTCATTACCAGAAGAGGGAGGG - Intronic
1099998191 12:89802692-89802714 CTGGATAACCAGGAGAGGGATGG - Intergenic
1100756712 12:97759204-97759226 CTGAATCTCCAGCAGAGAGAAGG + Intergenic
1103042251 12:117705337-117705359 CTGCATAACCAGAAGAGTGTTGG - Intronic
1103123464 12:118400256-118400278 CTGCAGCTCCCAAAGAGGGTGGG - Intronic
1105890913 13:24681427-24681449 CGGCCTCCCCAGAGGAGGGAAGG + Intronic
1106653696 13:31719501-31719523 TCCCATCTCCAGAAGAGAGATGG + Intergenic
1106939485 13:34762130-34762152 CTGAAACTCCAAAAGAGGAAAGG - Intergenic
1107181896 13:37471262-37471284 CTGCTTCTCCAGGAGGGGAAGGG + Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108116800 13:47137718-47137740 CTGCTATTCCAAAAGAGGGAAGG - Intergenic
1109969470 13:69748037-69748059 TTGTATCTCCAGTAGAGAGATGG - Intronic
1110646143 13:77886856-77886878 CTGGAGCTCCAGGAGAGGGTTGG + Intergenic
1110835930 13:80082925-80082947 CTGCTTTTGCAGAGGAGGGAGGG + Intergenic
1110857226 13:80310121-80310143 CTGCACCTCAGGAAGAGGAAAGG - Intergenic
1112344072 13:98576440-98576462 CTGCAGCTCCGGAAGAGTGTTGG + Intronic
1112560675 13:100510925-100510947 CTGCACCTCCAAAGGAAGGACGG + Intronic
1113458404 13:110465096-110465118 CTTCATCTCCAGAACAGCGAAGG - Intronic
1114377440 14:22163330-22163352 CTGCATCTTCACAGGAGGGATGG + Intergenic
1116370914 14:44130591-44130613 GTGCATGTCTAGAGGAGGGAGGG + Intergenic
1116635491 14:47389670-47389692 CTGCAGCTGCAGAAGTGAGAAGG + Intronic
1119520611 14:75281610-75281632 CTACATCTCCGGAAGAGGTAAGG - Exonic
1121197657 14:92088523-92088545 CAGCATCCTCAGAAGAGGAAGGG + Intronic
1122406425 14:101503753-101503775 CTGCAGAGCCACAAGAGGGAAGG + Intergenic
1122547516 14:102532262-102532284 CTGCATTCCCAGAAGTGAGAAGG + Intergenic
1122658949 14:103281655-103281677 CTTCCTTTCCAGCAGAGGGAGGG - Intergenic
1122773059 14:104105731-104105753 CTGCCTGTCCAGAAGAAGGGCGG + Intronic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1122985150 14:105208491-105208513 CTGCAGCTCCGCAGGAGGGAAGG - Intergenic
1123112625 14:105880343-105880365 CTGCATCCCCAGAGCCGGGATGG + Intergenic
1124046688 15:26156916-26156938 CTTCATATCCAGAGCAGGGATGG - Intergenic
1125413986 15:39433504-39433526 CTGCATGTCCAACTGAGGGAGGG - Intergenic
1125678850 15:41517972-41517994 CTCCATCTTCAGAGGAAGGAAGG - Intronic
1125872805 15:43117479-43117501 CTGCCTCTGCTGAAGAGGGCTGG - Intronic
1125966761 15:43881061-43881083 CAGCATTCCCAAAAGAGGGAGGG - Intronic
1126481563 15:49128029-49128051 CTGGATCATCAGAAGAGGGGTGG - Exonic
1126882567 15:53115116-53115138 CAGCTCCTCCTGAAGAGGGATGG - Intergenic
1127221857 15:56888044-56888066 CTGCATCTCCTCAAGGGGAAGGG - Intronic
1128714469 15:69897370-69897392 CATCAACTCCAGAAGTGGGACGG - Intergenic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1130149420 15:81299918-81299940 CTGCCTCCCCAGAGGAGGGCTGG - Exonic
1130637566 15:85639465-85639487 CTGCAGCTCCAGAAAATGAATGG - Intronic
1132609368 16:807592-807614 CTGCATTTAGAGAAGGGGGATGG + Exonic
1132794030 16:1709717-1709739 GTGCAGCTCCAGAGGAGGGCCGG + Intronic
1133008669 16:2898235-2898257 CTGAGACTCCAGCAGAGGGATGG - Intronic
1133455072 16:5934991-5935013 CTGCATCTGCAGAATATCGAAGG + Intergenic
1135346302 16:21691455-21691477 CTCCACATCCAGGAGAGGGAAGG + Intronic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1138093675 16:54195822-54195844 TTGCATCTCCAGAAGGGGCAGGG + Intergenic
1138194874 16:55044656-55044678 CTGGCTCTGCAGGAGAGGGAGGG - Intergenic
1138932952 16:61683824-61683846 CTTCATCTCCCTAAGAGGAAGGG + Intronic
1139912641 16:70407609-70407631 CTGCATCTCCTGAGGATGGAAGG - Intronic
1141289165 16:82701856-82701878 CTGTGTCTTCAGAAGAGGGGAGG - Intronic
1141532974 16:84659547-84659569 CTGAATCCCCAAAAGTGGGATGG - Intronic
1143297686 17:5883501-5883523 CTCCATCTCAAAAAAAGGGAAGG - Intronic
1144576586 17:16433578-16433600 CTCCATCTCCAGGACAGAGATGG - Exonic
1144782422 17:17814742-17814764 CTACGCCTGCAGAAGAGGGAGGG + Exonic
1145304870 17:21668275-21668297 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1145975004 17:28978810-28978832 CTGCATCATCAGGGGAGGGATGG + Intronic
1147062254 17:37889934-37889956 CTGAATCTCCAGATGAGGTTAGG + Intergenic
1147136284 17:38435923-38435945 CCACACCTCCAGAAGAGGAAAGG - Intronic
1147911453 17:43858510-43858532 CTGGCTCTGCTGAAGAGGGAGGG + Intronic
1151046291 17:70923428-70923450 CTGCTTGGCCATAAGAGGGATGG - Intergenic
1152247718 17:79193974-79193996 GGGCATCACCAGCAGAGGGAAGG + Intronic
1153526040 18:5995619-5995641 CTGTCTCTCCAGAAGTGCGAAGG - Intronic
1153700094 18:7683998-7684020 CTGCAGGCCCTGAAGAGGGAGGG - Intronic
1156486343 18:37468357-37468379 CTGGAGCTCCAGAAGAAGGTTGG + Intronic
1156627875 18:38931575-38931597 CTGCACCTCCAGAAAGAGGAGGG + Intergenic
1156649680 18:39210706-39210728 CAGCAACTCCAGATGAGAGATGG + Intergenic
1156763410 18:40621146-40621168 CTGCTTCTGCTTAAGAGGGAGGG - Intergenic
1157578421 18:48759105-48759127 CTAAACCTCCAGAAGAGGGATGG + Intronic
1158512624 18:58105026-58105048 CTGCTTCTAGGGAAGAGGGAAGG + Intronic
1161121106 19:2527329-2527351 CTGCACCCCCAGATGAGGGCCGG - Intronic
1161681566 19:5682258-5682280 CTGCATTGACAGAAGAGGCAGGG + Intronic
1161730787 19:5959358-5959380 CTGCGTCTGCAGGAGTGGGATGG - Intronic
1161911395 19:7197279-7197301 CTGCGGCTCCCGAAGCGGGAAGG - Intronic
1162777893 19:12990538-12990560 CCGCTGCCCCAGAAGAGGGAGGG - Intergenic
1162788971 19:13053424-13053446 CTGCAACTGCAGAGGGGGGAAGG + Intronic
1163507751 19:17718458-17718480 CTCCATCTCAAGAAAAGGAAAGG + Intergenic
1163587180 19:18170318-18170340 CTGAATCTGCATCAGAGGGAGGG - Exonic
1163658129 19:18560009-18560031 CTCCATCTCGAAAAGAAGGAAGG - Exonic
1165808043 19:38593873-38593895 CTCCATTTCAAAAAGAGGGAAGG + Intronic
1166321229 19:42020376-42020398 CTGCCTCTCCAGGACAGGAATGG + Intronic
1166399708 19:42469328-42469350 CTCCATCTCAAAAAAAGGGAGGG + Intergenic
1166917686 19:46206800-46206822 CTGCAGCTTCAGGAGAGGGGAGG + Intergenic
1167019559 19:46863198-46863220 TTGCCTCTGCAGCAGAGGGATGG - Intergenic
1167375574 19:49109213-49109235 CTGCAGCTCCAGGAGAGCAAGGG + Intergenic
1167820861 19:51926742-51926764 CTCCACCTACAGCAGAGGGAAGG + Intronic
930104941 2:47632229-47632251 CAGCCTCTCTAGGAGAGGGAAGG + Intergenic
931709164 2:64972949-64972971 CTGCATCTCAAGCAGGAGGAAGG - Intergenic
931821359 2:65955377-65955399 ATATATCTCCAGAGGAGGGAGGG - Intergenic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
935695401 2:105766773-105766795 CTGCATGCCCACAAGATGGAGGG - Intronic
936954721 2:118013263-118013285 CGGCTTCTCCAGAAGAGGGCGGG - Intronic
936982361 2:118276446-118276468 CTCCACTGCCAGAAGAGGGAAGG + Intergenic
937483731 2:122291954-122291976 CTGCGTCTCCAGAAGATCGCTGG - Intergenic
938073014 2:128318268-128318290 CTGCACATCCAGAAGACGGGCGG - Exonic
939117537 2:138077584-138077606 CTGCATCAGCAGAGCAGGGAGGG - Intergenic
940591372 2:155732128-155732150 CTGGATCTCAAGAAAAAGGAAGG + Intergenic
944132624 2:196363131-196363153 TTGCATGTCCAGAAGAGGCCTGG - Intronic
944780712 2:203014615-203014637 CTCCATGTCCAGCTGAGGGAAGG + Intronic
945051069 2:205824950-205824972 CCCCATCTCTACAAGAGGGAGGG + Intergenic
946082146 2:217130351-217130373 CTCCATTTCCAGAGGACGGAGGG + Intergenic
946475271 2:220000851-220000873 CTTCTTCTCCAGAGCAGGGAGGG - Intergenic
947031167 2:225797489-225797511 TTGTACCTCCAGAACAGGGAAGG - Intergenic
947668998 2:231925165-231925187 CTGCTTCTCCAGAAGAAGCCAGG + Intronic
1169360751 20:4946780-4946802 CTGCTTGTTCAGAAGAGCGATGG + Intronic
1171464792 20:25319882-25319904 CTGCAGCTCCAGATAGGGGACGG + Intronic
1171492673 20:25532298-25532320 TAGGATTTCCAGAAGAGGGAAGG + Intronic
1171522379 20:25785715-25785737 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171530128 20:25847660-25847682 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171554448 20:26070168-26070190 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1172038364 20:32026367-32026389 CTGCAAGTCCTGAAGAGGGTAGG - Intronic
1172576261 20:36011045-36011067 CTCCATGTGCAGAAGAGTGAGGG + Intronic
1172775960 20:37407130-37407152 CTCCATCTCAAAAAAAGGGAGGG - Intergenic
1173083491 20:39892200-39892222 CTGCAGCTCTAGAAGAAGCATGG + Intergenic
1176244710 20:64091922-64091944 CTGCAGCTCCAGAAGGGGAGGGG - Intronic
1177296384 21:19181690-19181712 TTCCATCTCCAGAAGTGAGAGGG - Intergenic
1177677790 21:24324612-24324634 CTTCATCTCCAGCTGAGAGAGGG - Intergenic
1178890723 21:36519090-36519112 CTGCAGCTGCAGAACAGGAAGGG + Intronic
1180997352 22:19972093-19972115 CTGGATCTCCAGGACAGGGTGGG - Intronic
1181645460 22:24229086-24229108 CTCCATCTCCAGAAAAAAGAAGG + Intronic
1182351152 22:29700747-29700769 CGTCATCTCCAGCAGAGAGAGGG + Intergenic
1182452766 22:30431010-30431032 CTGCATCTCCAGAATGGAGCAGG - Intergenic
1182524765 22:30908202-30908224 CTGCACTTCCAGGTGAGGGATGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1185317048 22:50183787-50183809 CTCCTTCTCCATGAGAGGGACGG - Intergenic
949279305 3:2327770-2327792 CTGGAACTCCAGAATAGGGGAGG - Intronic
949397203 3:3627321-3627343 CTGCAGCAACAGCAGAGGGAGGG - Intergenic
949619109 3:5790018-5790040 CTCCTTGTCCAGGAGAGGGAGGG - Intergenic
950516160 3:13466819-13466841 TGACATCTCCAGCAGAGGGAGGG - Intergenic
950622219 3:14215134-14215156 CTACAGCTGGAGAAGAGGGAGGG - Intergenic
951338166 3:21450168-21450190 CTGCACCTCCAGAGGAGAGGAGG + Intronic
951708806 3:25569438-25569460 CTGGATCTCTTGAAGAGAGAAGG - Intronic
952337366 3:32415486-32415508 CTTCATCTCCTGATAAGGGAGGG + Intronic
953338659 3:42115721-42115743 GGGGATCTCCAGAAGAGAGAAGG - Intronic
953824107 3:46235015-46235037 CTCCACCTCCAGTAGAGGGGTGG - Intronic
953868756 3:46607887-46607909 CTTTGTGTCCAGAAGAGGGAGGG + Intronic
955088772 3:55729072-55729094 CTGCAGCCTCAGAACAGGGAGGG - Intronic
956068864 3:65426295-65426317 CTCGATTTCCAGATGAGGGAAGG + Intronic
957122844 3:76118460-76118482 CTGTTTCTCCAAATGAGGGAGGG + Intronic
957828733 3:85487459-85487481 CTGCATCTGAAGAAGAAGAAAGG + Intronic
962471624 3:135714117-135714139 CAGCAGCTCCAGGAGATGGATGG + Intergenic
962897794 3:139731539-139731561 CTGCATCTCCAGTAGTGTGCTGG + Intergenic
962928779 3:140018732-140018754 CTGCATTTCCAAACGAGGGAGGG + Intronic
964292068 3:155192609-155192631 CAGGATTCCCAGAAGAGGGAAGG - Intergenic
964526290 3:157618409-157618431 CTGCATCTACACAAGCGAGAAGG + Intronic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
966297790 3:178444166-178444188 CTGCATCCCCACAAGGTGGAAGG - Intronic
966451899 3:180072928-180072950 CTGTATTTGGAGAAGAGGGAGGG + Intergenic
966838111 3:184065350-184065372 TTGGATTTCCAGAAGATGGAAGG - Intergenic
967463742 3:189778026-189778048 CTGTATTTCCAGTAGAGGCAGGG + Intronic
967829300 3:193905033-193905055 CTGACTCTTCAGAAAAGGGATGG + Intergenic
969220231 4:5754332-5754354 CTGCAAGTCCAGGAGAAGGAAGG + Intronic
969301603 4:6300438-6300460 CTCCAGGCCCAGAAGAGGGAGGG + Intronic
969828026 4:9773477-9773499 ATACATCTTCAGAAGAAGGAGGG + Intronic
971054539 4:22897689-22897711 CTGCATCACCACTAGGGGGAGGG + Intergenic
972430801 4:38979637-38979659 CTGCATCTCCCAAAGTGTGATGG - Intronic
973970362 4:56207398-56207420 CTGCCTATCCAGGAGAGTGAAGG + Intronic
974389317 4:61244996-61245018 CAGTATCTCCAGAAGAGTAAAGG - Intronic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
975141319 4:70921511-70921533 CTCCATCTCAGGAAAAGGGAAGG - Intronic
976319050 4:83690721-83690743 CTGCATCTTCACATGATGGAAGG + Intergenic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
979078170 4:116300911-116300933 CTGCACCTCCAGAGTGGGGAAGG - Intergenic
980499827 4:133634795-133634817 CTGCTACTCAAGAAGAGGAAAGG + Intergenic
982911051 4:161143818-161143840 ATGCATCTTCAGGAGAGGAATGG + Intergenic
984863609 4:184261469-184261491 CTTCCTCTGCAGAAGAGGAAAGG - Intergenic
985203039 4:187504493-187504515 CTGGATCTGCCGAATAGGGAGGG - Intergenic
986401194 5:7383400-7383422 CTGTAACCCCAGAAGAGGTAAGG + Intergenic
987039790 5:14051684-14051706 CTGAGTCTGCAGCAGAGGGAAGG + Intergenic
987360070 5:17098576-17098598 CTCCATCTCAAGAAAAAGGAAGG - Intronic
987621922 5:20346059-20346081 CTGCATTTTCAGAAAAGGGTTGG - Intronic
988101811 5:26689147-26689169 CTGCATCTCCAGTGGAGGACAGG + Intergenic
990449717 5:55923344-55923366 CGGCAGCTCCAGGAGCGGGAAGG - Intergenic
990987081 5:61650447-61650469 CTGAACCTCCTGAACAGGGATGG + Intronic
992198525 5:74362857-74362879 CTGCTTGTTCAGAAGTGGGAAGG + Intergenic
993152097 5:84174212-84174234 CTGCCTCTCCTGCAGAGAGATGG + Intronic
993628049 5:90249889-90249911 ATACATCCCCAGAAGAGAGATGG + Intergenic
994708058 5:103230390-103230412 TAGCAACTCCAGAAGAGGGGAGG + Intergenic
996095597 5:119395565-119395587 CTTCATCTCCCACAGAGGGAAGG + Intronic
996417503 5:123226311-123226333 CTGAATCTGCATCAGAGGGAGGG - Intergenic
997087057 5:130814007-130814029 CTGCATGTAGAGAAGAGGAAAGG + Intergenic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
998173708 5:139887279-139887301 CTCCTTCTCGAGAGGAGGGAGGG + Intronic
998471903 5:142390151-142390173 CTGCATTTCCAGGACTGGGAGGG - Intergenic
999282922 5:150376604-150376626 CTGCATCTCCAGCACAGGTGAGG + Exonic
1001419010 5:171572880-171572902 CTGCAGGTCCAGAGGAGGCATGG - Intergenic
1001827347 5:174755873-174755895 CTCCATCTCAAAAAAAGGGAAGG + Intergenic
1001933877 5:175691244-175691266 CTTCCTCTCCAGGAGTGGGAGGG - Intergenic
1002579394 5:180198561-180198583 CTGCATCTTCACATGGGGGAAGG + Intronic
1002637693 5:180616280-180616302 CTGCCTGTCCAGGAGAGGGAGGG - Intronic
1002674684 5:180901270-180901292 CTGCATGTGCATCAGAGGGAAGG - Intronic
1002938613 6:1696784-1696806 CTTCATCTCCAACAGAGGAAGGG + Intronic
1006096412 6:31659378-31659400 CAGCAGCTCCAGAAGATGCAGGG + Exonic
1006437726 6:34034979-34035001 CTGCAACTCCAGCCAAGGGAAGG + Intronic
1007176307 6:39900063-39900085 CTCCAGCTCCTGAGGAGGGAGGG - Exonic
1007726173 6:43917156-43917178 CTGCCTCTCAAGAATAGAGATGG + Intergenic
1008476276 6:51938940-51938962 CTGCATCACCAGAAAAGGAAAGG - Intronic
1012873286 6:104696517-104696539 CTCCTTCTGCAGAAGAGGAAAGG + Intergenic
1013602548 6:111718639-111718661 CTGCATCATCAGAAGACAGATGG + Intronic
1013781514 6:113733659-113733681 CAGCATGTCCAGAACAGGTAGGG + Intergenic
1015254844 6:131166655-131166677 CTGCCCCTCCAGAATAGGGGTGG - Intronic
1015346791 6:132169832-132169854 CTGCCTCTACAGAAGAGGATAGG - Intergenic
1015923661 6:138289597-138289619 CTCCAGCTCCAGAAGTGGGATGG - Intronic
1016007742 6:139106445-139106467 CAGCATCTCCAGAAATGGGTGGG + Intergenic
1017421226 6:154274955-154274977 CTGGTTCTCCAAAACAGGGATGG + Intronic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019943380 7:4308469-4308491 CTGGATCTCCAGAACGGAGAGGG - Intergenic
1020810563 7:12845797-12845819 AAGCATCCCCAGAAGAAGGAAGG - Intergenic
1021704946 7:23357575-23357597 CAACATCTCTGGAAGAGGGAAGG + Intronic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1021891771 7:25193575-25193597 CCCCATCTCAAGAGGAGGGATGG - Intergenic
1022067525 7:26874848-26874870 CTGGATCTCCAGAGAAGAGATGG + Intronic
1022287229 7:28965190-28965212 CTGCAGCTCTAGGGGAGGGAAGG - Intergenic
1022410790 7:30136692-30136714 GTGGCACTCCAGAAGAGGGATGG + Intronic
1022785756 7:33635236-33635258 CAGCATCTCCAGCTGATGGAGGG + Intergenic
1022789742 7:33675013-33675035 CAGCGTCACCAGCAGAGGGAAGG + Intergenic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1024186084 7:46949414-46949436 CCTCACCTCCAGCAGAGGGAGGG + Intergenic
1025282866 7:57640892-57640914 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1025301849 7:57824526-57824548 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1028752972 7:94403087-94403109 CTACATCTCAAGAAGAAGCAAGG + Intronic
1029503206 7:100946593-100946615 CTGTGTCTCCAGAACAGTGATGG + Intergenic
1029598650 7:101550994-101551016 CTGAGTCTGCAGAAGAGGAAGGG - Intronic
1031887252 7:127254707-127254729 CTGCAACCACAAAAGAGGGAGGG + Intergenic
1031905694 7:127457874-127457896 CTGCCTCTCAAGTAGAAGGAAGG - Intergenic
1032090600 7:128909851-128909873 CAGGATCCCCAGTAGAGGGACGG - Intronic
1032130780 7:129225454-129225476 CTGCCTCTCTAGGAGAGGAAGGG + Intronic
1033015409 7:137665900-137665922 CTGCTTCTCAGGAAGAGGAAAGG - Intronic
1034421870 7:150994918-150994940 CCCCATCTCCAGAAGAGGTGAGG + Intronic
1035590862 8:812086-812108 CTCCATCTCTGCAAGAGGGAGGG + Intergenic
1036026560 8:4915555-4915577 CTGCGTCTGCAGTAGAGGGCAGG + Intronic
1036579991 8:10065050-10065072 CTGCCTCTCAGGAAGAGGTAAGG - Intronic
1036699465 8:11002449-11002471 CTTCATCTCCAGGAGAAGGCAGG + Intronic
1036707085 8:11054206-11054228 GGCCATGTCCAGAAGAGGGAGGG - Intronic
1036783793 8:11671760-11671782 CTGAGTCTCCAGAAGAGCTAAGG - Intergenic
1039232305 8:35461724-35461746 CTGCTTCTCCAGGACAGGGCAGG + Intronic
1039571209 8:38587860-38587882 CTGCACCTGCAGAAGATGAAGGG - Intergenic
1039797862 8:40930767-40930789 CTGCATCTTCAGGTGAGAGATGG - Intergenic
1040045470 8:42959118-42959140 CTGTCTTTCCTGAAGAGGGAAGG - Intronic
1043385696 8:79745617-79745639 CTGCATCTCCTGAGAAAGGAGGG + Intergenic
1048058563 8:130893274-130893296 CTTCATCTCGAGATTAGGGATGG + Intronic
1049717336 8:144099166-144099188 CAGCACCCCCAGAAGATGGACGG - Exonic
1053868086 9:42461715-42461737 CTGCCTCCTGAGAAGAGGGAAGG - Intergenic
1054951678 9:70858911-70858933 CTGCCTCTCCAGGATGGGGAAGG + Intronic
1055369355 9:75580618-75580640 CTGCTTCTCCAGGATAGGCATGG - Intergenic
1055688772 9:78807688-78807710 CTGTATCTCCAGTAGAAGGCTGG - Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1057801199 9:98192458-98192480 CTGCAGCTCCCGGAGAGGGAGGG - Intronic
1060785835 9:126451085-126451107 CTGCATCACCAGAAGAGCAGGGG + Intronic
1061518674 9:131104404-131104426 CTGCAGCTGCCGAAGAGGAAAGG + Intronic
1061610735 9:131744002-131744024 CACCAACTCCAGCAGAGGGAAGG + Intergenic
1061941810 9:133887822-133887844 TTGCATCTTCAGGGGAGGGAAGG + Intronic
1062378453 9:136275510-136275532 GGGCATCTCCAGGAGAGTGATGG - Intergenic
1062725063 9:138068237-138068259 CTGCATCTGCAGAGGAGGAAGGG + Intronic
1185618221 X:1436178-1436200 CTCCATCTCAAGAAAAGGAAAGG - Intronic
1185886644 X:3789270-3789292 CTGCATTTCCAGATGATTGAGGG - Intergenic
1186371389 X:8951022-8951044 CTACTTCGCCAGAAGAAGGAAGG - Intergenic
1186484090 X:9919640-9919662 CTGGATCTTCAGAACAGGAATGG + Intronic
1187638390 X:21259700-21259722 CTGCTGCTCCAGAAGAAAGATGG + Intergenic
1189380238 X:40497562-40497584 CTGCATTTCCAGAATGGGAAGGG - Intergenic
1189440756 X:41033678-41033700 CTGCCACTGCAGAAAAGGGAGGG + Intergenic
1193414342 X:81203237-81203259 CTAAAGCTCAAGAAGAGGGAAGG - Intronic
1193985862 X:88239053-88239075 CTGCAACTCCAGGAAAGTGAGGG - Intergenic
1194011737 X:88570032-88570054 CTGCAACTCCAAATGAGGTAAGG - Intergenic
1195068117 X:101255543-101255565 CTGCAACTTCAGATGAGGGAGGG - Intronic
1196942830 X:120794481-120794503 CAGCCCCTCCAGGAGAGGGAGGG + Intergenic
1197460781 X:126737940-126737962 TTTCAGCTCCAGGAGAGGGAGGG - Intergenic
1198740194 X:139834084-139834106 CTGGCTCTACAGAAGAGGCACGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic