ID: 901042537

View in Genome Browser
Species Human (GRCh38)
Location 1:6374200-6374222
Sequence CTGTTTGGGCTGAGGGACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901042537_901042555 23 Left 901042537 1:6374200-6374222 CCCACGTCCCTCAGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 901042555 1:6374246-6374268 GGCCCTGGGAGCTCCAGTTAGGG 0: 1
1: 0
2: 3
3: 15
4: 172
901042537_901042552 9 Left 901042537 1:6374200-6374222 CCCACGTCCCTCAGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 901042552 1:6374232-6374254 GGAGGTGGCCAAATGGCCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 247
901042537_901042554 22 Left 901042537 1:6374200-6374222 CCCACGTCCCTCAGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 901042554 1:6374245-6374267 TGGCCCTGGGAGCTCCAGTTAGG 0: 1
1: 0
2: 0
3: 19
4: 217
901042537_901042549 -6 Left 901042537 1:6374200-6374222 CCCACGTCCCTCAGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 901042549 1:6374217-6374239 AAACAGAGGCGGGAGGGAGGTGG 0: 1
1: 0
2: 14
3: 105
4: 1028
901042537_901042551 8 Left 901042537 1:6374200-6374222 CCCACGTCCCTCAGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 901042551 1:6374231-6374253 GGGAGGTGGCCAAATGGCCCTGG 0: 1
1: 1
2: 2
3: 21
4: 253
901042537_901042547 -9 Left 901042537 1:6374200-6374222 CCCACGTCCCTCAGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 901042547 1:6374214-6374236 CCCAAACAGAGGCGGGAGGGAGG 0: 1
1: 0
2: 3
3: 21
4: 275
901042537_901042550 2 Left 901042537 1:6374200-6374222 CCCACGTCCCTCAGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 901042550 1:6374225-6374247 GCGGGAGGGAGGTGGCCAAATGG 0: 1
1: 0
2: 2
3: 30
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901042537 Original CRISPR CTGTTTGGGCTGAGGGACGT GGG (reversed) Intronic
901042537 1:6374200-6374222 CTGTTTGGGCTGAGGGACGTGGG - Intronic
903071452 1:20728875-20728897 CTGTTTGGGCTGAGTGAGGCAGG - Intronic
903841257 1:26242921-26242943 CTGTTTGGGGGGAGGTAGGTAGG - Intronic
904089151 1:27932412-27932434 CTGTTTGAGCTGAGAGCTGTGGG - Intergenic
904316445 1:29669197-29669219 CTGTTAGAGCTGAGTGAAGTTGG - Intergenic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906649591 1:47503224-47503246 CTCTTTGGGCTGGGTGGCGTGGG - Intergenic
907309412 1:53530730-53530752 CTGTGAGGGCTGAGGGAGGTTGG - Intronic
910702531 1:90091671-90091693 CTGTTTGGGATGATGGGCCTGGG + Intergenic
914805449 1:150987999-150988021 CAGTTTGGGCTGAGGAAGGTGGG + Intronic
915104853 1:153527442-153527464 CTGTGTCTGCTGAGGGACTTGGG - Intergenic
916489320 1:165287572-165287594 ATGTTTGGGCTGGGAGACCTGGG - Intronic
919102272 1:193109406-193109428 CTGTTGGGGCTGGGGGATGATGG - Intergenic
919737686 1:200963526-200963548 CTGCTTGGGTTGAAGGAGGTGGG - Intergenic
921021976 1:211244140-211244162 CTGTATGGGCTAAGGGACAGTGG + Intergenic
922089866 1:222385766-222385788 CTCTTTTGGCTGAGGGTGGTGGG - Intergenic
922473641 1:225891152-225891174 CTGTCTGGGCTGAGGAGGGTGGG + Intronic
924152216 1:241141000-241141022 CTGTTTGGGGTGAAGGTGGTGGG - Intronic
924421599 1:243915016-243915038 CTGTGGGGGCTGAGGGACCAAGG - Intergenic
1062785075 10:257799-257821 CTGTGTGGGATGTGGGATGTCGG + Intergenic
1062884926 10:1009203-1009225 CTCTTTGGCCTGAGGGAAGATGG + Intronic
1065047277 10:21755597-21755619 CTTTTTGGGATGAGGGAGTTGGG + Intergenic
1068712795 10:60152797-60152819 GTGTTTGGGGTGGGGGATGTGGG - Intronic
1070324415 10:75378521-75378543 CTGCCTGGGCTGAGGGAGGGAGG - Intergenic
1070352851 10:75610335-75610357 GTGTTTGTGGTGAGGGATGTGGG - Intronic
1072695595 10:97600666-97600688 CTGTTTGGGGTCAGGGTCCTTGG + Intronic
1079083670 11:17430655-17430677 CTGGTTGGTCAGAGGGACATTGG - Intronic
1080551875 11:33379441-33379463 CTGTTTTGGATGCGGGAGGTTGG + Intergenic
1080665835 11:34335342-34335364 CTCTTTGTGCTGAGGGATATTGG - Intronic
1080848344 11:36045960-36045982 CTGTTGGGGGTGGGGGACGAAGG - Intronic
1085053571 11:73391902-73391924 ATGTCTGGGCACAGGGACGTGGG - Intronic
1094539605 12:31352224-31352246 CTGTCTGGGATGTGGGACTTGGG - Intergenic
1095140974 12:38661452-38661474 CTGTTGGGGGTGGGGGACGTGGG + Intronic
1096345433 12:50842343-50842365 CCGTGTGGGCTGTGGGAAGTTGG - Intergenic
1097280332 12:57841560-57841582 CTGCCTGGGCTGTGGGACTTTGG - Intronic
1097680868 12:62647768-62647790 CTGTGTGGGCTGGAGGAGGTGGG + Exonic
1102577969 12:113868978-113869000 TTGTGTGGGCTGGGGGACGTTGG - Intronic
1103930793 12:124449727-124449749 CTGCATGGGATGTGGGACGTGGG - Intronic
1104660967 12:130611257-130611279 CTGTGGGGTCTGGGGGACGTGGG - Intronic
1105242237 13:18619196-18619218 CTGTTTGTGGTGGGAGACGTTGG - Intergenic
1106727904 13:32505047-32505069 TTCTTAGGGCTGAGGGAGGTGGG - Intronic
1107490523 13:40876766-40876788 CTTTCTGGGCTGAGGTACCTTGG + Intergenic
1113383220 13:109823216-109823238 CTGTGTGGGGTGGGGGAAGTGGG - Intergenic
1113905748 13:113818458-113818480 CTGGTTGGGCTGAGGATGGTCGG - Intergenic
1115779279 14:36751336-36751358 CTGTTTGAGCTGAAGAATGTAGG + Intronic
1116919742 14:50560441-50560463 CTGTTTGGGCGGAGGAACCATGG + Intronic
1121613025 14:95294089-95294111 CTGTTTAGGGTGAGGTAGGTAGG - Intronic
1121664344 14:95660542-95660564 CTCTTTTTGCTGAGGGAAGTGGG - Intergenic
1129376854 15:75138971-75138993 CTGTTTGTGCAAAGGGACATGGG - Intergenic
1129790195 15:78336056-78336078 CTGGTAGGGGTGAGGGAAGTGGG - Intergenic
1130712900 15:86301294-86301316 GAGATTGGGCTGAGGGACATAGG + Intronic
1131151998 15:90053194-90053216 CTGTTTGGAGTGAGGGAGCTGGG + Intronic
1132665862 16:1081086-1081108 GTGTTTGGGGTGGGGGAGGTAGG - Intergenic
1136579489 16:31142985-31143007 CTGTTCGGGCTGCGGGATGGGGG + Exonic
1137271720 16:46906729-46906751 CTGTTTGGGGTGAGGGTCTCGGG - Intronic
1138476599 16:57273848-57273870 GTGTTATGGCTGAGGGACCTTGG - Intronic
1141440954 16:84029286-84029308 GTGTCTGGGCTCAGGGAAGTGGG - Intronic
1142136747 16:88454980-88455002 CCGTTTGCGCTGAGGGAGTTGGG - Intronic
1142804112 17:2362577-2362599 GGGCTGGGGCTGAGGGACGTCGG - Intronic
1142894425 17:2964614-2964636 GTGTTTGGGGTGAAGGACGGTGG + Intronic
1143175585 17:4953151-4953173 CTGTCTGGGCTGAGGGAGCAGGG - Intronic
1143275348 17:5705887-5705909 CAGTTTGGGCTGAGGAAGGTGGG + Intergenic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1143719993 17:8802794-8802816 CTGCCTGGGCTGAGTGAGGTGGG + Exonic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1150226788 17:63528748-63528770 CAGTTTGAGTTGAGGGACATAGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1152042071 17:77909951-77909973 CTGGATGGGGTGTGGGACGTAGG - Intergenic
1154446712 18:14440682-14440704 CTGTTTGTGGTGGGAGACGTTGG + Intergenic
1160153971 18:76418924-76418946 GTGTTTGGGCTGGAGGAAGTGGG - Intronic
1160302917 18:77702496-77702518 CTTTTTCTGCTGAGGGACTTAGG - Intergenic
1162151176 19:8646701-8646723 CGGTGAGGGCTGAGTGACGTGGG - Intergenic
1167264804 19:48478203-48478225 CTCCTGGGGCTGAGGGAGGTGGG + Intronic
1167291452 19:48627418-48627440 GTGTTTGGGGTGAGGAAAGTGGG + Intronic
1167578571 19:50329207-50329229 CTGATTGGCCTGGGGGAGGTGGG + Exonic
1168327727 19:55546680-55546702 CTCTTGGGTCTGAGGGAGGTGGG - Intergenic
1168330322 19:55564259-55564281 CTCTTTGGGCTCAGGGAGGGAGG - Intergenic
925615545 2:5741327-5741349 GAGTTTGGACTGAGGGTCGTGGG - Intergenic
929443276 2:41982860-41982882 CTGTTTGTGCTGAGTGGCCTTGG - Intergenic
930500878 2:52215843-52215865 CTGTTTGGGCACATGGACTTTGG - Intergenic
931867376 2:66426722-66426744 CTGGTTTGGCGCAGGGACGTAGG - Intergenic
934652083 2:96098575-96098597 CTGTTTTCTCTGAGGGAAGTAGG - Intergenic
936517961 2:113193901-113193923 CTGAATGGGCTGAGGGATGGCGG + Exonic
938407894 2:131042740-131042762 CTGTTTGGGATGAGTGACTCTGG - Intronic
948531163 2:238606551-238606573 CTGTTGGGGCTGAGGCACGGTGG + Intergenic
949017991 2:241724370-241724392 CTGTTAGGGCGGAGGGCCCTGGG + Intronic
1169684162 20:8251761-8251783 CTTTTTGGGGAGAGGGACCTAGG - Intronic
1173338085 20:42129595-42129617 CTGGTTGGGAGGAGGGACCTTGG + Intronic
1175358105 20:58385023-58385045 CTGTATGGGCTTAGGAACATGGG + Intergenic
1180876389 22:19177079-19177101 CTGATAGGGCTCAGGGACCTGGG - Intronic
1181762048 22:25065354-25065376 ATGTCTGGGCTGTGGGATGTGGG + Intronic
1181829678 22:25550195-25550217 ATGTTTAGGCTGAGGTACTTTGG + Intergenic
1183358672 22:37372366-37372388 CCCTTGGGGCTGAGGGACTTGGG - Exonic
951527026 3:23663260-23663282 CTATTTGGACTGAGGGCCGTGGG + Intergenic
952800136 3:37282807-37282829 CTGTTTGGTCTAAGGGAGGAAGG + Intronic
954115380 3:48464346-48464368 CTGTCTTGGCTTTGGGACGTGGG + Intronic
954211147 3:49098158-49098180 AGGTTTGGGGTGAGGGAGGTAGG - Intronic
954497617 3:50979588-50979610 CTGTTTCGGGTGAGGGATTTAGG - Intronic
956062816 3:65365146-65365168 CTGTTTGGGAGGAGGGTCATGGG - Intronic
964211570 3:154234171-154234193 CAGCTGGGGCTGAGAGACGTGGG + Intronic
964726894 3:159822904-159822926 CTGTTTGGCAAGAGGGAGGTGGG + Intronic
968847330 4:3052293-3052315 CTGTTTGGCCTGATGAAAGTTGG + Intergenic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
969002717 4:3995101-3995123 GTGTTTGTCTTGAGGGACGTCGG + Intergenic
969811217 4:9649711-9649733 GTGTTTGTCTTGAGGGACGTCGG - Intergenic
970195026 4:13544233-13544255 CTCTTTGGGGAGAGGGACGCGGG - Exonic
976388223 4:84483470-84483492 CTGTTTGGGATTTAGGACGTTGG - Intergenic
978315247 4:107428416-107428438 CTGCATGGGCTGTGGGATGTAGG - Intergenic
980808953 4:137851095-137851117 CTGTTGGGGGTGAGGGAGCTAGG - Intergenic
982436337 4:155385529-155385551 TTGTTTGGGTTGTGGGACCTCGG - Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
983077392 4:163343494-163343516 TTGTTTGGGGTGGGGGACGGTGG - Intronic
987715976 5:21571529-21571551 CTGTGAGGGCTGAGAGAGGTGGG + Intergenic
991940639 5:71849040-71849062 TTGTTTGGGCTGAGTCAAGTTGG - Intergenic
992173549 5:74127478-74127500 ATGTTTGGTCTGTGGGATGTAGG - Intergenic
995362112 5:111309263-111309285 CTGCCTGGGCTGAGAGATGTAGG + Intronic
995621393 5:114029910-114029932 CTGTTTGTGCTGGGGAAGGTGGG + Intergenic
995742384 5:115368735-115368757 CTGTTTGTGCTGAGGGGCGCTGG - Intergenic
997263797 5:132483374-132483396 CTGCTTTGGCTGAGGGGCTTGGG - Exonic
1002389774 5:178900656-178900678 CTGGCTGGGGTGGGGGACGTGGG - Intronic
1002401624 5:178994427-178994449 CTGTTTGCGGTGAGGGCCGCGGG - Exonic
1004313401 6:14565477-14565499 CTGTTTTGGCTGGGGGTGGTAGG - Intergenic
1006333927 6:33410879-33410901 CTGTTGGAGGTGAGGGAGGTGGG + Intronic
1006442079 6:34059208-34059230 CTTCTGGGGGTGAGGGACGTGGG - Intronic
1007234062 6:40378064-40378086 CTGTTGGGGCTAAGGGAGGTGGG - Intergenic
1007324203 6:41047934-41047956 CTGTGTGGGCTGGGCGACCTGGG - Intronic
1007737038 6:43988141-43988163 CTGTTTTGGCTGAGGCAGGCTGG + Intergenic
1009314530 6:62201079-62201101 CTGTTTGGGGTGAGGGGAGCAGG + Intronic
1009426410 6:63518614-63518636 CTGGTTGGGCTGTGTGACCTTGG - Intergenic
1012056641 6:94420614-94420636 CTGTTTGGGGTGAGGGGCTGGGG + Intergenic
1012644104 6:101658201-101658223 CTGTTGGGGGTGAGGGACTAGGG - Intronic
1015822247 6:137276716-137276738 CTGGATGGGCTGAGAGACTTTGG + Intergenic
1016837500 6:148493067-148493089 CTCTTTTGGCTGAGAGGCGTAGG + Intronic
1017310135 6:152966505-152966527 CTGTTGGGGCTGGGGGACTGGGG - Intergenic
1020568299 7:9824697-9824719 CTGTTGGGGGTGAGGGATGAGGG - Intergenic
1023584639 7:41716533-41716555 CAGTTTGGCCTGAGGGACGGTGG - Intergenic
1025566057 7:62435379-62435401 CTGTTAGGGCATAGGGAGGTTGG + Intergenic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036441298 8:8783226-8783248 CTGTTGGAGCTGTGGGAGGTGGG - Intergenic
1037946763 8:22994457-22994479 CTATCTGGGCTGAGCGACCTTGG + Intronic
1039459841 8:37735074-37735096 CTGTTTGGGGTGGGGGATGCAGG + Exonic
1039924318 8:41915598-41915620 CTGTTTGGGCTGAGTGACCCGGG - Intergenic
1039948711 8:42152005-42152027 CTGGGTGGGCTTAGGGACGCTGG - Intergenic
1045429167 8:102097174-102097196 ATGTTTAGGCTGTGGGACTTAGG - Intronic
1045704925 8:104911359-104911381 CTGTCAGGGGTGAGGGACGAGGG - Intronic
1047794909 8:128245250-128245272 CTATGAGGGCTGAGGGAGGTGGG - Intergenic
1051477587 9:17525134-17525156 ATGTTTTGGCTGAGGGATGTTGG - Intergenic
1057150306 9:92790817-92790839 CTGTCTGGGCTCAGGCCCGTGGG - Intergenic
1057484267 9:95469961-95469983 CTGATTGGGCGGAGGCATGTTGG - Intronic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1059352725 9:113677058-113677080 CTGCAGGGGCTGAGGGCCGTGGG - Intergenic
1060730638 9:126034693-126034715 CTCTCTAGGCTGAGGGACATGGG + Intergenic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1062003743 9:134229239-134229261 CACTGTGGGCTGAGGGACGGAGG + Intergenic
1062427444 9:136512498-136512520 CTGTTTGGGCTGAGCGGGGAGGG - Intronic
1187699085 X:21947507-21947529 CTGGTTGGGCTGAGTGAGGTAGG - Intronic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic
1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG + Intergenic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic