ID: 901047354

View in Genome Browser
Species Human (GRCh38)
Location 1:6405220-6405242
Sequence GGCTCCGGCCTCTGCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901047354_901047364 11 Left 901047354 1:6405220-6405242 CCCACCCAGCAGAGGCCGGAGCC No data
Right 901047364 1:6405254-6405276 CCGAGTCGCTTCCTCACCGTTGG No data
901047354_901047365 19 Left 901047354 1:6405220-6405242 CCCACCCAGCAGAGGCCGGAGCC No data
Right 901047365 1:6405262-6405284 CTTCCTCACCGTTGGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901047354 Original CRISPR GGCTCCGGCCTCTGCTGGGT GGG (reversed) Intergenic
No off target data available for this crispr