ID: 901050058

View in Genome Browser
Species Human (GRCh38)
Location 1:6421468-6421490
Sequence CAGCATCTGCATCTTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901050051_901050058 -8 Left 901050051 1:6421453-6421475 CCACAAGTCCGCCTGCAGCATCT 0: 1
1: 0
2: 0
3: 17
4: 228
Right 901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG 0: 1
1: 0
2: 3
3: 39
4: 347
901050048_901050058 27 Left 901050048 1:6421418-6421440 CCAAGCGACTTAGCTTGGCTGAC 0: 1
1: 0
2: 1
3: 5
4: 59
Right 901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG 0: 1
1: 0
2: 3
3: 39
4: 347
901050050_901050058 -7 Left 901050050 1:6421452-6421474 CCCACAAGTCCGCCTGCAGCATC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG 0: 1
1: 0
2: 3
3: 39
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901050058 Original CRISPR CAGCATCTGCATCTTGGGGA GGG Intronic
901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG + Intronic
901405659 1:9043550-9043572 CAGCAAGAGCATCTTGGTGAAGG + Intronic
901804128 1:11726931-11726953 CAGCATCAGAATCCTGTGGACGG + Intergenic
901883319 1:12206657-12206679 CTGAATCTGCATCTTGGGCAGGG + Intronic
902199016 1:14820137-14820159 CTGAATCTGCATATTTGGGAAGG - Intronic
903596767 1:24501588-24501610 CAGCGCCTGCATCATGGGGCAGG - Intergenic
903729798 1:25484075-25484097 CAGCATTTTCATCTAGGTGAGGG - Intronic
903889721 1:26561351-26561373 CAGCATCCTCCTTTTGGGGAAGG + Intronic
903898740 1:26626756-26626778 CAGCTTGTGCATTTTGGGCAGGG - Intergenic
904113173 1:28142682-28142704 AAGCATCTGTATTTTGGGGGTGG + Intergenic
904454381 1:30638598-30638620 CAGCATCTGCCTTATGGGGTGGG - Intergenic
904768703 1:32869590-32869612 CCCCACCTGCATCTTGGGGCTGG - Intronic
904876394 1:33657853-33657875 CAGCAGCTGCATCTTGGGCCTGG - Intronic
905915948 1:41684357-41684379 CAGCAGCTGCAGCCTTGGGAAGG - Intronic
906985178 1:50675464-50675486 CAGCATCTGCCTCTTTGGATAGG - Intronic
907848876 1:58235090-58235112 CAGCATCTTCATCTGTGTGATGG + Intronic
909678803 1:78268254-78268276 CAGCATCTGCTTCTTGAAAATGG + Intergenic
910947805 1:92613156-92613178 AAGCCATTGCATCTTGGGGAAGG + Intronic
911077386 1:93890683-93890705 CATCATCTGCATCATTGTGACGG - Intronic
911404545 1:97420257-97420279 CAGTATCTGCATCTGGAAGACGG - Intronic
911924549 1:103812129-103812151 CAGGTTCTGCATTTTGGGCATGG + Intergenic
912264077 1:108137834-108137856 CATCATAACCATCTTGGGGATGG - Intronic
912284352 1:108352952-108352974 CAGCATTTGCTTGTTGGGAAAGG + Intergenic
913273528 1:117117088-117117110 CAGGATCTGGAGCTTAGGGAGGG - Intronic
915118705 1:153615560-153615582 CAGCAGCTACAGGTTGGGGAAGG + Intronic
915965873 1:160307608-160307630 GAGCAGCTGCATCCTGTGGAGGG - Intronic
917557725 1:176108567-176108589 AACCATGTGCATATTGGGGAAGG - Intronic
920199861 1:204252895-204252917 CTGGATCTGCGTGTTGGGGAAGG - Intronic
924679708 1:246219736-246219758 CTGCAGCTGCATCTGGGGGCTGG - Intronic
1063099313 10:2935720-2935742 CAGCATCAGCAGGTTGGGGAAGG + Intergenic
1063718320 10:8552728-8552750 CAACATATGAATTTTGGGGAGGG + Intergenic
1064952755 10:20872550-20872572 CAGCAACTCCATCTTGAGAAGGG + Intronic
1065057460 10:21861478-21861500 CAGCAACTCCATCTTGAGTAGGG + Intronic
1065845454 10:29739228-29739250 CTGGATCTGGAGCTTGGGGAGGG - Intergenic
1067174113 10:43930496-43930518 CAGAGACTGCATCCTGGGGAGGG + Intergenic
1067822287 10:49540659-49540681 CAGCATATGAATTTTGGGGAGGG - Intergenic
1068859199 10:61829786-61829808 CAACATATGAATTTTGGGGAGGG - Intergenic
1069135803 10:64763753-64763775 AGGCATCTGCATTATGGGGATGG - Intergenic
1069425958 10:68288895-68288917 CTGCATCAGCACTTTGGGGAGGG - Intronic
1069682979 10:70298533-70298555 CAGAATCTGAAACTCGGGGATGG - Intergenic
1070363959 10:75717674-75717696 CAGCAACTGCAGCTTGTGCAGGG - Intronic
1071472749 10:85995705-85995727 CTGCATCTGCCTCTAGGGCAAGG - Intronic
1072540883 10:96397207-96397229 CAGCAGCAACATCTTGGGCAAGG - Exonic
1072898918 10:99390472-99390494 TAGCATCTTCCTCTTGGGGGAGG + Intronic
1074151774 10:110765909-110765931 TAGCATATGCATGTGGGGGAAGG - Intronic
1077487390 11:2845377-2845399 CAGTGTCTGCATCTGTGGGATGG + Intronic
1078860666 11:15243497-15243519 CAGCCTCTGCTTCTCTGGGAGGG - Intronic
1079327295 11:19505175-19505197 GAGCAACTGAACCTTGGGGAGGG + Intronic
1079551957 11:21710804-21710826 CAGCATATGAATTTTGGTGAGGG + Intergenic
1079739956 11:24045790-24045812 CAACTTCTGAATTTTGGGGAAGG - Intergenic
1080653985 11:34244138-34244160 CAGCATCCCCCTCCTGGGGAAGG - Intronic
1081856542 11:46307805-46307827 CATGCTCTGCATCTAGGGGAAGG - Exonic
1081942518 11:46955906-46955928 CAGCCTCTGCCTCTTGGGTTCGG - Intronic
1082098079 11:48147582-48147604 CAGCTTCTGCATCCTTGGAAGGG - Intronic
1082628481 11:55513550-55513572 CAGCTTCTGCTTCTGGGGGAGGG - Intergenic
1082707035 11:56505170-56505192 CAGCATATGAATTTTGGAGAGGG - Intergenic
1082854619 11:57795602-57795624 CGGCTCCTGCATCCTGGGGATGG - Exonic
1083831358 11:65236000-65236022 CAGCACCTGCTTCATGGGGTTGG - Intergenic
1084014604 11:66371285-66371307 CAGCTTCTTCATCCTGGGGCTGG - Exonic
1084400451 11:68940010-68940032 CAGCCTCTGGATCCTGGGGAAGG + Exonic
1085338754 11:75717793-75717815 CAGCTTCTACAACCTGGGGAGGG + Intergenic
1086177901 11:83914309-83914331 CAGCATCTGCTTCTAGCAGAGGG - Intronic
1086286125 11:85253546-85253568 CAGCAGCAGTATCTAGGGGAGGG + Intronic
1087967503 11:104435975-104435997 CATCATCTTCCTCTTGGAGAAGG + Intergenic
1088334646 11:108690380-108690402 CAGCAGCAGCTTCTTGGGCATGG + Intronic
1088811689 11:113396658-113396680 CAGGATCTGCATCACGGGGCTGG + Intronic
1088833200 11:113555542-113555564 CAGCAGCTGCATCTCGGGCTGGG + Intergenic
1089048165 11:115521999-115522021 CCTCATGTGCCTCTTGGGGAGGG - Intergenic
1090187916 11:124750420-124750442 CAGCAGCTCCATCATGGGGGAGG - Intronic
1090968000 11:131615274-131615296 CAGTATCTGCATCATGGGGTTGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091293438 11:134455435-134455457 CAGCAACTCCATCTTGAGTAGGG + Intergenic
1092087664 12:5776959-5776981 CAGCTTCTAGATCTTAGGGAAGG + Intronic
1092244818 12:6857830-6857852 AAGCCTGTGTATCTTGGGGATGG - Intronic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1092455196 12:8636825-8636847 CAGCAGCTGCATCTTGTCCATGG - Intergenic
1093191756 12:16082706-16082728 CAGCATCTGCTTCTTGGTGAGGG - Intergenic
1095215991 12:39548521-39548543 CAGCATCTGCATGTTGAAAAAGG + Intergenic
1096559269 12:52424193-52424215 CAGCCTCTGCATCTGGAGGGAGG + Exonic
1097186132 12:57197473-57197495 CCACATTTGCATCTGGGGGAGGG - Intronic
1097615804 12:61882310-61882332 CAGCATCTGCACTTTGGCGTCGG + Intronic
1098194290 12:67983520-67983542 CAGCATCTGCTTTCTGGTGAGGG - Intergenic
1098740885 12:74171754-74171776 CAGCATCATCTTCTTGCGGAAGG - Intergenic
1099403796 12:82234456-82234478 CAGGCTCTTCATATTGGGGATGG + Intronic
1101195283 12:102375823-102375845 CAGCTTCTGCATCATGTGGATGG - Intergenic
1101232001 12:102751100-102751122 TAGGACCTGCAACTTGGGGATGG + Intergenic
1102107829 12:110340805-110340827 CCGCATCGGCATCTTCGGGCAGG + Exonic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102797985 12:115705963-115705985 CTGCATGTGCATGTTGGGCAAGG - Intergenic
1103474420 12:121208245-121208267 CAGCATCTGCCTCTAAGAGATGG - Intergenic
1104524208 12:129502832-129502854 CACCATCTGACTCTAGGGGAGGG - Intronic
1105282145 13:18971994-18972016 CAGCAGCTGCAGCTTGAGGGAGG + Intergenic
1105443247 13:20432378-20432400 CAGCAGATGCATCTTTGGAATGG + Intronic
1105639769 13:22250228-22250250 CTGCAACAGCATCTAGGGGAGGG - Intergenic
1105899486 13:24743128-24743150 CAGCATCTGCGTACTGGGCACGG - Intergenic
1107203275 13:37749016-37749038 CAGCGACTGGATCATGGGGATGG + Intronic
1108285999 13:48908494-48908516 TAGCATCTGCATTTTAGGTAGGG + Intergenic
1108546266 13:51498172-51498194 CAGTATCTGCCTCTTAGTGATGG - Intergenic
1108660984 13:52586136-52586158 CACCATGTTCATTTTGGGGAAGG + Intergenic
1110460610 13:75740783-75740805 CAGCCTCTGCAACTTAAGGAGGG + Intronic
1111989874 13:95105787-95105809 CTGCATCAGCATCTTGGGGTTGG - Intronic
1112242501 13:97695698-97695720 CAGCCTCTGCATCTTGCTGGTGG + Intergenic
1113212011 13:107994304-107994326 CAACATATGCATTTTGGGGGTGG + Intergenic
1116182367 14:41551239-41551261 CATCATCTGTGTCTTGGGGGAGG - Intergenic
1119805109 14:77477395-77477417 CAGCATCTGGATCCTGGGGAAGG - Intronic
1120310420 14:82819916-82819938 CATCATCATCATCTTGTGGAAGG - Intergenic
1120362693 14:83525703-83525725 CAGCATCTTCAGCTTGTGGATGG - Intergenic
1120389519 14:83888350-83888372 GAGCAACTCCATCTTGGAGAGGG + Intergenic
1120730998 14:88001684-88001706 CAGCATATGAATTTTGGGAAAGG + Intergenic
1121521269 14:94587616-94587638 CAGGATCTGCATCTTTGTGCTGG - Exonic
1121693585 14:95894914-95894936 CAGCATGTGCATATTGGTGCAGG + Intergenic
1121939375 14:98055260-98055282 CAGCCTCCACATCTTGGGGAAGG + Intergenic
1122327180 14:100889808-100889830 GAGCATCTGCCTCTCTGGGAGGG + Intergenic
1124455665 15:29840553-29840575 CAGGAGCTGAATCTTGGGCATGG + Intronic
1126994132 15:54420350-54420372 TAGCAGCTGTATCTTGGAGATGG - Intronic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1127184989 15:56469521-56469543 GAGCAGCAGCATCTTGGGAAAGG + Intergenic
1131054304 15:89366642-89366664 AATCCTTTGCATCTTGGGGATGG + Intergenic
1131533177 15:93212113-93212135 CAACATATGAATTTTGGGGAGGG - Intergenic
1132421248 15:101672073-101672095 CAGCTTCTGCCTCCTGGTGACGG + Intronic
1132772992 16:1574928-1574950 ATGCATCTGCATCCTGAGGAGGG + Intronic
1133035225 16:3030584-3030606 CAGCATCTGGTTCTGGGGAAAGG + Exonic
1135591906 16:23711106-23711128 CTGCATCCCCATCTGGGGGAAGG - Intronic
1136316248 16:29455987-29456009 TAGCATCAGCATCTTAGAGATGG - Intronic
1136430825 16:30195329-30195351 TAGCATCAGCATCTTAGAGATGG - Intronic
1136474914 16:30506831-30506853 CAGCATCTCCACCTTGCGGAAGG - Exonic
1136565160 16:31065418-31065440 CAGCAGCTGCTGCTGGGGGAAGG + Intronic
1137063179 16:35810762-35810784 TAGCATCTGCTTCCTAGGGATGG - Intergenic
1138310382 16:56018637-56018659 CAGCATATGAATTTGGGGGAGGG - Intergenic
1138547501 16:57728621-57728643 CAGCATCTGCATCCAGGAAATGG + Intronic
1138552396 16:57754827-57754849 CAGCATCTGCAATGGGGGGATGG - Intronic
1139428833 16:66900329-66900351 CACCATCTCCACCCTGGGGAGGG - Intergenic
1140343388 16:74188176-74188198 CAGCATCTGCTTCGGGGGGTGGG + Intergenic
1140659322 16:77172432-77172454 CATCATCTTCCTCTTGGGGAAGG + Intergenic
1140663673 16:77210885-77210907 CAGCATGTGCTTCCTGGGAAGGG - Intronic
1141783311 16:86179924-86179946 CAGTATTTTCATCTTGCGGAAGG + Intergenic
1141887568 16:86903115-86903137 CTCCATCTTCATCTTGGAGAGGG + Intergenic
1142193092 16:88726852-88726874 CCGCATCAGCATCTTCGGGCTGG - Exonic
1142475115 17:184089-184111 CAGGAGCTGGCTCTTGGGGAGGG + Intergenic
1142587675 17:984035-984057 CAGCATCTGGCACCTGGGGAAGG + Intergenic
1142736261 17:1901835-1901857 CAGCCTCTGCCTCACGGGGAGGG - Intergenic
1142761649 17:2045599-2045621 CAGAATCTGCGTATTGGGGGTGG - Intergenic
1143776261 17:9201124-9201146 CAGAATTTGCATCTTGAAGAAGG + Intronic
1144185647 17:12792725-12792747 CAGAACCTGCAACTTAGGGAAGG - Intronic
1144599826 17:16601639-16601661 CAGCTTCTGCCTCTGGGGGGTGG + Intergenic
1144783004 17:17817222-17817244 CAGCCTGGGCATCTTTGGGAGGG - Intronic
1145038182 17:19555844-19555866 CAGCATGAGCATGCTGGGGATGG - Exonic
1146484880 17:33234862-33234884 CAACATATACATCTTGGGGAGGG + Intronic
1146820686 17:35981822-35981844 CACCATCTGTATGTTGGGGAAGG + Intergenic
1147817637 17:43221520-43221542 GCTCATCTGCATTTTGGGGATGG + Intergenic
1148676431 17:49448287-49448309 CGGCATCGGCATGGTGGGGAAGG - Intronic
1149520916 17:57317813-57317835 CAGAATGTGCCTCTTGGGAAGGG + Intronic
1152183811 17:78841357-78841379 GAGCACCTGCAGTTTGGGGAGGG + Intronic
1152714026 17:81889754-81889776 CAGAATCTGCCTTTGGGGGAGGG - Intronic
1155269445 18:24125521-24125543 CATCCTCTGCAGGTTGGGGAAGG - Exonic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1159259983 18:66001959-66001981 AACCATCTGCATATGGGGGAGGG + Intergenic
1160939176 19:1612142-1612164 CAGCATCTGCACCTGGGTGTGGG + Intronic
1161569867 19:5024541-5024563 CAGCAGCTGCATCTTATGGGCGG - Intronic
1161731821 19:5965275-5965297 CAGCATCTTTATCTAGGGAAAGG + Intronic
1162128660 19:8512431-8512453 CAGCTCCTGCATGCTGGGGAAGG + Exonic
1162134604 19:8547704-8547726 CAGGCTCTGCTTCTGGGGGAGGG + Intronic
1163985490 19:20943489-20943511 CGGCATCTGCCTCTGGTGGAAGG - Intronic
1164053746 19:21604903-21604925 CATCATCTGCATCCTGGTGGGGG - Intergenic
1165190439 19:34058553-34058575 CAGGTTGTGCATTTTGGGGAGGG - Intergenic
1166935329 19:46329197-46329219 GAGCATCAGCATCCTGCGGAGGG - Exonic
1167724246 19:51199993-51200015 CAGCATTTGCATCTCAGGGACGG + Intergenic
1168687848 19:58359047-58359069 CAGCATCTGCTCCTTGGAGCAGG + Intronic
925127682 2:1472082-1472104 GAGCATTTGCATCATGGGAAGGG - Intronic
926217231 2:10913034-10913056 CAGCACCTGCAGCTCGGGGATGG - Exonic
927553093 2:24015997-24016019 CGGGATCAGCATCCTGGGGAAGG + Intronic
927813675 2:26195185-26195207 CAGCAGCTGCATCTTGTCCACGG + Exonic
929822393 2:45283982-45284004 CTGCATCAGAATCTTGGAGAGGG + Intergenic
930937341 2:56970090-56970112 TAGCGGCTGCTTCTTGGGGAGGG - Intergenic
931648720 2:64449709-64449731 CAGTATCTGCATCATGAAGAGGG - Intergenic
931851088 2:66251420-66251442 CAGCTGCTGCATCTTAGGAAAGG - Intergenic
932366517 2:71156645-71156667 AAGCAGCTGCCTCTGGGGGAGGG - Intergenic
932668979 2:73720262-73720284 CCGCATCTGCACCTGGGGAAAGG - Intergenic
932815004 2:74854453-74854475 CAGGTACTGCATCTGGGGGATGG + Exonic
933473804 2:82763670-82763692 CAGCAACTCCATCTTGAGTAGGG + Intergenic
933943636 2:87266045-87266067 CAACATATGCATTTTGGGGTGGG + Intergenic
935470707 2:103456359-103456381 CAGCATCTTCAGCTTGTGGATGG + Intergenic
936087144 2:109477110-109477132 CAGCAACTCCATCTTGAGTAGGG - Intronic
936088151 2:109483777-109483799 CAGCGCCTGCAGCCTGGGGAGGG - Intronic
936336585 2:111595534-111595556 CAACATATGCATTTTGGGGTGGG - Intergenic
938691118 2:133790271-133790293 CAGGATCTTCATCATGGAGAAGG - Intergenic
938775058 2:134534364-134534386 CAACATCTGCATCTGTGGAATGG - Intronic
938989410 2:136612497-136612519 CAGCAGCTGCTTCTTGGGCATGG - Intergenic
939068831 2:137515939-137515961 CAGCACCTGCATCTTTGAGGAGG + Intronic
939471750 2:142631066-142631088 AAGCATCTGGATTTTGGTGAGGG + Intergenic
940216826 2:151311092-151311114 CAGCACTTGCTTCTGGGGGAGGG - Intergenic
940556896 2:155240254-155240276 CAGGTTATGCATTTTGGGGAAGG - Intergenic
944029271 2:195214278-195214300 CAGTATCAGCATTTTGGGGCTGG + Intergenic
944349782 2:198713304-198713326 CAGCATTTGCATTTTGGGCCAGG - Intergenic
944375634 2:199038579-199038601 CAGCACCTGTATTTTAGGGAAGG - Intergenic
944399235 2:199306178-199306200 CAGCCTCTGTGACTTGGGGAGGG - Intronic
944534252 2:200694203-200694225 AAGCAGCTGCATCTATGGGAAGG - Intergenic
944652344 2:201843718-201843740 CTCCATTTGCATTTTGGGGAAGG - Intronic
945743437 2:213691096-213691118 CAACATCTGAATTTTGGAGAGGG + Intronic
946009863 2:216555663-216555685 TTGCATCTGCAGCCTGGGGAGGG - Intronic
946823714 2:223655552-223655574 CAGCATATGGATCTTGGTGGGGG - Intergenic
947361688 2:229351792-229351814 CAGAATCTGCATATGGTGGAAGG + Intergenic
947542359 2:230987779-230987801 CTGCATCTGCAGCCTGGGAATGG + Intergenic
947975785 2:234364647-234364669 CAGCAACTCCATCTTGAGTAGGG + Intergenic
948155675 2:235778962-235778984 CAGGATATGCTTCTTGGGGTTGG - Intronic
948261260 2:236606072-236606094 CAGCATATGAATTTTGGGGGTGG + Intergenic
1169286374 20:4310838-4310860 CAGCAACTCCATCTTGAGTAGGG - Intergenic
1172534489 20:35662541-35662563 CAGTCTCTGCATTTTAGGGAGGG + Intronic
1173388112 20:42607509-42607531 CAGCCTCTGAATCTTGGGTTTGG - Intronic
1173741024 20:45402048-45402070 CAGCATCTGCATCTTGCACCTGG + Intronic
1173815866 20:45987661-45987683 AAGCATCTGCATCTTTTGGAAGG - Intergenic
1175799390 20:61792431-61792453 CAGCAGCTGCATCTTGGAAGAGG - Intronic
1177019381 21:15835056-15835078 CAGTAGCTCCATCTTGGGGCAGG - Intronic
1179138253 21:38699407-38699429 CTGCATCACCACCTTGGGGAGGG + Intergenic
1180260142 21:46662924-46662946 CAGCCTCTGCAGCTTAGGCAAGG + Intronic
1180937843 22:19637760-19637782 CAGCATCTGCACCGTGGGGGTGG + Intergenic
1181005494 22:20011500-20011522 CAGCCTCTTCATCATGGGAAGGG + Intronic
1181341079 22:22180488-22180510 AACCATCTCCTTCTTGGGGAGGG - Intergenic
1181726522 22:24814873-24814895 CTGCATCGCCATCATGGGGAGGG + Intronic
1181967928 22:26669600-26669622 CAACATATGCATTTGGGGGAGGG + Intergenic
1182115727 22:27755220-27755242 CCTCATCTGCAACTTGGGGGTGG + Intronic
1182233259 22:28855073-28855095 CAACATATGAATCTTGGGGGTGG + Intergenic
1183122174 22:35738449-35738471 CAGCAGTTGAATCTAGGGGAGGG + Intergenic
1184158200 22:42682748-42682770 CAGCCTCAGGATCTTGGAGAAGG - Intergenic
1184292039 22:43502550-43502572 CAGCTTCTGCAGCCTGGAGAAGG - Intronic
1184357474 22:43992193-43992215 CCGCATCAGCATGTAGGGGATGG + Intronic
1184636869 22:45839679-45839701 CATCATGTTCATCTTGGGGTTGG - Intronic
1185347314 22:50316281-50316303 CAGCAGCTTCTCCTTGGGGAGGG - Intronic
949657336 3:6235731-6235753 AGGTAACTGCATCTTGGGGATGG + Intergenic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
950256433 3:11510462-11510484 CAGCATCTGTATCACTGGGATGG - Intronic
953081697 3:39625716-39625738 CAGCATCTGGAGCTTGGTGAGGG - Intergenic
953914651 3:46910424-46910446 CAGCCTCTTCATCTTGGGAGAGG - Intergenic
954635754 3:52069943-52069965 CTGCCTCTGCTTCTTGGGGTTGG - Intergenic
954991528 3:54844447-54844469 CAGCGTCTGCATTCTGGGGGAGG + Intronic
955978642 3:64502121-64502143 CACTATCTGTATTTTGGGGAGGG - Intergenic
956114530 3:65904820-65904842 CAGCACCTGCCACATGGGGAGGG + Intronic
956993083 3:74791458-74791480 CAACATATGAATCTGGGGGAGGG + Intergenic
957539141 3:81546400-81546422 CAGCAACTCCATCTTGAAGAGGG + Intronic
957754363 3:84467470-84467492 CAGCATCTGCATCTTTGAAGAGG + Intergenic
959355164 3:105317552-105317574 TAGCATATGAATCTGGGGGAGGG + Intergenic
961175325 3:124830616-124830638 CAGCATCTGCCACCTGGGTATGG + Intronic
961528372 3:127523675-127523697 CACCCTCTGCATCCAGGGGAGGG - Intergenic
961989795 3:131176230-131176252 CAGCTTCTCCATCTTGGGCTGGG - Intronic
962009843 3:131382035-131382057 GCGCATCTGCATCTGCGGGAGGG - Exonic
964474158 3:157083719-157083741 CAGCATCAGCATCTAAGGGAGGG + Intergenic
965317238 3:167207986-167208008 GAGAATCTGCATTTGGGGGAGGG + Intergenic
967301773 3:188021329-188021351 CAGCATCTTTTTCTTGGGGGCGG - Intergenic
967691678 3:192481425-192481447 CAGTATCTCCAACTAGGGGAAGG + Intronic
968039801 3:195579450-195579472 CAGCATCACCATCTTGGGGCTGG + Exonic
969410536 4:7025216-7025238 CTGCATCTGGATCGTGGCGATGG - Exonic
969451156 4:7274198-7274220 CAGCATCTGCCTATGGGGAAAGG - Intronic
970027497 4:11639226-11639248 TAGCCTCTGAATTTTGGGGAAGG - Intergenic
971464057 4:26935609-26935631 CTGAATCAGCAGCTTGGGGATGG + Intronic
973550651 4:52032312-52032334 GAGAATCTGCTTGTTGGGGAGGG - Intronic
974042705 4:56871284-56871306 CAGCATCTGCTTCCTGGGGTTGG - Intergenic
975471351 4:74772689-74772711 CCGCATCTGCAACCTGAGGATGG + Intronic
976245320 4:83001254-83001276 CAAGATATGCATCTTGGGTAAGG + Intronic
977632777 4:99262011-99262033 CAGCATTTGCTTGTTGGGAAAGG + Intergenic
978683037 4:111405904-111405926 AAGCATCTGGATTTTGGAGAGGG - Intergenic
979669498 4:123347167-123347189 CACCATCTGCATCTGGGGAGGGG - Intergenic
980598240 4:134984728-134984750 CAGCATATACATTTTGGGCAGGG - Intergenic
981045146 4:140257910-140257932 CAGTCTCTGCCTCTTGGGCAAGG + Intronic
981975451 4:150722882-150722904 CAGAAACTGCACTTTGGGGAAGG + Intronic
982041863 4:151405551-151405573 CAGCATCTGCTTCTGGGTGAGGG + Intergenic
982821344 4:159943825-159943847 CTGCATCTGCCTCTTGAGGATGG - Intergenic
986830303 5:11569777-11569799 CAACATGTGAATCTTGGGCAGGG - Intronic
987749493 5:22020830-22020852 CAACATATGAATTTTGGGGAGGG + Intronic
987761296 5:22165610-22165632 CAGCAACTCCATCTTGAGTAGGG + Intronic
988008940 5:25458150-25458172 CAGCATCTTGATTTTGGTGATGG + Intergenic
988450819 5:31341434-31341456 CAGCTTTTGCATGTTGGAGATGG - Intergenic
988538454 5:32088937-32088959 CACCATCTGAATCTTGGAGTCGG - Exonic
988585137 5:32501278-32501300 CAGCAGCTGCTATTTGGGGACGG + Intergenic
989272468 5:39549288-39549310 AAGTATCTGCATATTGGGGAAGG - Intergenic
991085986 5:62648660-62648682 CAGCAACAGCCTCTTGGGGAAGG - Intergenic
991302754 5:65145061-65145083 CTGGATCTGCATCTGGGGCAAGG - Intergenic
991392780 5:66166481-66166503 CTGAAACTGCATCTTGGGGGGGG - Intronic
991896087 5:71399074-71399096 CAGCAACTCCATCTTGAGTAGGG + Intergenic
995020993 5:107367299-107367321 CACCAACTTCAACTTGGGGAGGG - Intergenic
995799986 5:115983580-115983602 CAGCATCCACACCTTGGAGATGG + Intronic
997365086 5:133320541-133320563 CAGCACCTGCATCTGGGAGGTGG - Intronic
997880158 5:137582225-137582247 AAGGATGTGCATTTTGGGGAAGG - Intronic
1000338511 5:160259668-160259690 CAGCAGCTCCTTCTTGGTGAGGG + Exonic
1000889789 5:166788663-166788685 AAGCATCAGCATCTTGAGCATGG + Intergenic
1001132472 5:169075944-169075966 CAGAATCTACATCTTGGGGAGGG + Intronic
1001264005 5:170258866-170258888 CATCATCTTCATCCTGGGAAGGG + Exonic
1001547080 5:172577005-172577027 CAGCAGCTGGATCATGGGGTAGG - Intergenic
1002494610 5:179603326-179603348 CAGCACCTGCATCTGGGAGTGGG - Intronic
1002682230 5:180975580-180975602 CAGCAGCAGCTTCTTGGGTAAGG - Intergenic
1006735473 6:36269960-36269982 CCGCAGCAGCATGTTGGGGAGGG + Intronic
1007190464 6:40012169-40012191 GAGAATCTGCATTTGGGGGAGGG - Intergenic
1008762422 6:54868649-54868671 CAGCATCTGAATTCTGGTGATGG - Intronic
1008762424 6:54868672-54868694 CAGCATCTGAACTTTGGGGATGG - Intronic
1009848713 6:69167740-69167762 CAGCTTCTGCACCTTGTGGGAGG - Intronic
1011597500 6:89030024-89030046 AAGCTTCTGCATCTGGAGGAAGG - Intergenic
1012221968 6:96659446-96659468 CAGCATTTGCTTATTTGGGAAGG - Intergenic
1013538028 6:111081272-111081294 CAACATATGAATTTTGGGGATGG + Intergenic
1016179309 6:141124381-141124403 CAGCATCTTCTTCTTCGGGGGGG - Intergenic
1016915519 6:149240869-149240891 CAACATATGCATTTAGGGGAGGG - Intronic
1017348407 6:153411503-153411525 GAGCAACTCCATCTTGAGGAGGG - Intergenic
1017363642 6:153605958-153605980 CAGCATCTGCTTCTGGGTGGGGG + Intergenic
1017976796 6:159365365-159365387 CAGCATCTGCCTGTAGGAGATGG - Intergenic
1018267365 6:162039596-162039618 TGGCATCTGCTTCTGGGGGAGGG - Intronic
1020535512 7:9391365-9391387 CAGCAACTCCATCTTGGGTGAGG + Intergenic
1022442493 7:30445846-30445868 CAGTATTTGCCTTTTGGGGATGG - Intronic
1022551331 7:31242268-31242290 CAGCATCTGCATCTTTTGGTTGG - Intergenic
1022788654 7:33664531-33664553 CAGCATTTGCTTCCTGGGGGTGG + Intergenic
1023305195 7:38818575-38818597 CATCATTAACATCTTGGGGAGGG + Intronic
1023821524 7:43983204-43983226 CAGAGGCAGCATCTTGGGGAGGG - Intergenic
1023841526 7:44101152-44101174 CAGCATGTGTATCTGGGGGAGGG - Intergenic
1024202903 7:47124721-47124743 TTGCCTCTGCATTTTGGGGAGGG + Intergenic
1024772121 7:52735838-52735860 CAGCTTCTGCATCTTCAGGGAGG - Intergenic
1025016020 7:55439761-55439783 CAGCATCTGCTGCCTGAGGATGG + Intronic
1026084900 7:67254936-67254958 CAGCAACTCCATCTTGAGTAGGG - Intergenic
1026197973 7:68189375-68189397 CAACATCTGAATCTTGGTGTGGG - Intergenic
1026198048 7:68189957-68189979 CAACATCTGAATCTTGGGGCAGG - Intergenic
1026231584 7:68488704-68488726 CAGGCTGTGCATCTTGGGGGGGG - Intergenic
1026932926 7:74234818-74234840 CAGCATCTGCTTCTAGGGAGGGG - Intronic
1027052475 7:75028853-75028875 CCGCCTCTGAATCTTGGGGAGGG - Intronic
1027440206 7:78211235-78211257 CAGGATCTGCCCCATGGGGAGGG + Intronic
1027678914 7:81194504-81194526 CAGTATCTGCATGTTAGGCAAGG + Intronic
1029749786 7:102536625-102536647 CAGAGGCAGCATCTTGGGGAGGG - Intergenic
1029767736 7:102635730-102635752 CAGAGGCAGCATCTTGGGGAGGG - Intronic
1032198094 7:129800815-129800837 CAGCATCTGCAGCATGAGGCAGG + Intergenic
1032211213 7:129915796-129915818 AAGCAACTGCATGCTGGGGATGG - Intronic
1032367925 7:131317384-131317406 CAGCATTTGCCTGTTTGGGAAGG - Intronic
1032613362 7:133440485-133440507 GAGCAACTCCATCTTGGGTAAGG + Intronic
1032839041 7:135699504-135699526 CAGCTTCTGCTTCCTGGGGCTGG + Exonic
1034353226 7:150430697-150430719 CTGCATCTGCACCAAGGGGAAGG - Intergenic
1035407856 7:158611699-158611721 CAGCAGGTGCATCCTGGGAAAGG - Intergenic
1035416774 7:158695844-158695866 CAGCTTCTGCATCCGGGGGCTGG - Intronic
1035934130 8:3818219-3818241 CAGGGGCTGCATCTTGGGGTGGG - Intronic
1035960078 8:4126873-4126895 CAGCATCTGTCTCCTGGGAATGG + Intronic
1036656806 8:10682125-10682147 CAGCCTCTGCAGCCTGGGAAAGG + Intronic
1037752033 8:21688911-21688933 CAGCCTCAGCATCCTTGGGAGGG + Intergenic
1038530141 8:28311950-28311972 CAGCATAGGAATCTGGGGGATGG - Intergenic
1039141936 8:34400417-34400439 CAGCATCAGCAACTAGGGGTAGG - Intergenic
1039208780 8:35187384-35187406 CACCATCTGCATTTAGAGGAAGG + Intergenic
1039575979 8:38624370-38624392 CAGCATCTGCGTCTTGAGTAGGG + Intergenic
1040335382 8:46413374-46413396 GAGGATCTGTATCTTGTGGAAGG + Intergenic
1041657127 8:60363998-60364020 CAGCATATGAATTTTGAGGAAGG + Intergenic
1041658070 8:60374397-60374419 TAGACTCTGCATCTTGGGAATGG + Intergenic
1042576826 8:70229814-70229836 AAGCATCAGAATCATGGGGAAGG - Intronic
1043419987 8:80088225-80088247 CAGAGTCTGCATCCTGGTGATGG + Intronic
1044108162 8:88237685-88237707 AAACAACTGCATCTTGGGTATGG + Intronic
1044606824 8:94054973-94054995 CAGCATTAGTATTTTGGGGATGG - Intergenic
1045905494 8:107339874-107339896 CAGCATCTGAATATAGGAGAAGG + Intronic
1047296649 8:123576356-123576378 CAGAATTTGGATCTTGGGGCTGG + Intergenic
1047777896 8:128088686-128088708 CATCCTCTGCAGTTTGGGGATGG + Intergenic
1047887680 8:129270574-129270596 CAGCCTCTGCATCTGGAGGCAGG + Intergenic
1048327962 8:133453237-133453259 GAGGATCTGCATTTTGGGGAGGG + Intergenic
1048496737 8:134941910-134941932 CAGCATCTGCATCTGTGACAGGG + Intergenic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1049247301 8:141569688-141569710 CAGCACCTGGATCCAGGGGAGGG - Intergenic
1049707785 8:144050837-144050859 CCGCCTCGGCATCTTGGGGGAGG - Intergenic
1049723641 8:144134521-144134543 CAGCATATGCATTTTTTGGAGGG + Intergenic
1050390198 9:5134617-5134639 CAGCATTTGCTTCTTCGTGAGGG - Intronic
1050447438 9:5740042-5740064 CAGTATCTGCTTCTGGGAGATGG + Intronic
1051617107 9:19016865-19016887 CACCATATTCATCTTGTGGAAGG + Intronic
1053100428 9:35367084-35367106 CATAAGCTGCATCCTGGGGAAGG + Intronic
1055993393 9:82131373-82131395 CAGCAGCAGCTTCTTGGGCATGG - Intergenic
1056819359 9:89826557-89826579 CAGTGTCTCCATCTTGGTGATGG + Intergenic
1057236423 9:93365537-93365559 CAGCTTCTGCATCTGTGGAATGG + Intergenic
1057906490 9:98987408-98987430 CAGCAGCCGCAGCCTGGGGAGGG + Intronic
1058940130 9:109805685-109805707 CAGTCGCTGCATCTTGGGAAAGG - Intronic
1059250786 9:112886425-112886447 CAGCATCTGCTGCTTGGGCTGGG - Intronic
1060987209 9:127826592-127826614 AAGGATCTGGGTCTTGGGGAAGG + Exonic
1062388387 9:136324270-136324292 CAGTAGCTGCTTGTTGGGGAAGG + Intergenic
1062650725 9:137575547-137575569 CAGCATCTGCATCGGAGTGAGGG + Intronic
1186710131 X:12185387-12185409 CAGAATCAGAATCCTGGGGAGGG + Intronic
1189331839 X:40148921-40148943 GAGCATCTGCATGGAGGGGAAGG + Intronic
1189369170 X:40414212-40414234 CAGGATCTGCTTCTGGGGGAAGG - Intergenic
1192001866 X:67159630-67159652 CAGCACCTGCATCTTGCTCAAGG - Intergenic
1192304559 X:69944996-69945018 GAGAATCTGCACTTTGGGGAGGG - Intronic
1192905616 X:75547330-75547352 AAGAATCTGCATTTAGGGGAGGG + Intergenic
1194552557 X:95319831-95319853 CACGAGCTGCATCTAGGGGAAGG - Intergenic
1198264964 X:135000391-135000413 CAGCATCTGCCTTCTGGTGAGGG - Intergenic
1198670227 X:139072092-139072114 CAGCATATGAATTTTGGGGAGGG - Intronic
1198758222 X:140002832-140002854 CAGCATTTGCTTGTTGGGAAAGG - Intergenic
1199394801 X:147323291-147323313 GAGCAACTCCATCTTGGGTAGGG + Intergenic
1199484969 X:148337715-148337737 GAGAATCTGCACCATGGGGAGGG + Intergenic
1199595457 X:149503237-149503259 CAGCATTCCCATCCTGGGGATGG - Intronic
1199598421 X:149525974-149525996 CAGCATTCCCATCCTGGGGATGG + Intronic
1199728624 X:150608795-150608817 CATCATCATCATCCTGGGGAAGG - Intronic
1200241389 X:154496324-154496346 CAGCATCAGTATCCTGGGAATGG - Intergenic
1202020882 Y:20463594-20463616 CAGGATCTGGATATTTGGGATGG - Intergenic
1202175645 Y:22096658-22096680 AAGTATCTGCATCTTGGAAAAGG - Intergenic
1202215716 Y:22489725-22489747 AAGTATCTGCATCTTGGAAAAGG + Intergenic
1202378938 Y:24260113-24260135 CAGCATCTCCTTGTTTGGGAGGG - Intergenic
1202491844 Y:25410008-25410030 CAGCATCTCCTTGTTTGGGAGGG + Intergenic