ID: 901052000

View in Genome Browser
Species Human (GRCh38)
Location 1:6429947-6429969
Sequence GTCGAGTCACATGCTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901052000_901052007 24 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052007 1:6429994-6430016 TTGCCAGGCTGGGCTCACGCAGG 0: 1
1: 0
2: 2
3: 17
4: 210
901052000_901052009 27 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052009 1:6429997-6430019 CCAGGCTGGGCTCACGCAGGAGG 0: 1
1: 0
2: 3
3: 40
4: 369
901052000_901052005 13 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052005 1:6429983-6430005 TCTTTGTGTGGTTGCCAGGCTGG 0: 1
1: 1
2: 0
3: 40
4: 838
901052000_901052011 29 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052011 1:6429999-6430021 AGGCTGGGCTCACGCAGGAGGGG 0: 1
1: 0
2: 2
3: 23
4: 338
901052000_901052010 28 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052010 1:6429998-6430020 CAGGCTGGGCTCACGCAGGAGGG 0: 1
1: 0
2: 4
3: 24
4: 291
901052000_901052004 9 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052004 1:6429979-6430001 GGTGTCTTTGTGTGGTTGCCAGG 0: 1
1: 1
2: 0
3: 24
4: 246
901052000_901052006 14 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052006 1:6429984-6430006 CTTTGTGTGGTTGCCAGGCTGGG 0: 1
1: 1
2: 4
3: 15
4: 193
901052000_901052003 1 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052003 1:6429971-6429993 GATAAGAAGGTGTCTTTGTGTGG 0: 1
1: 1
2: 0
3: 16
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901052000 Original CRISPR GTCGAGTCACATGCTGCTGT GGG (reversed) Intronic
900361163 1:2289742-2289764 GTCAACCCAGATGCTGCTGTGGG - Intronic
901052000 1:6429947-6429969 GTCGAGTCACATGCTGCTGTGGG - Intronic
901752220 1:11417382-11417404 GTTGAGACAACTGCTGCTGTGGG - Intergenic
902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG + Intergenic
916074670 1:161193534-161193556 GTTGATTCCCCTGCTGCTGTGGG - Intronic
918896168 1:190349684-190349706 ATGGTGTCACATGCTTCTGTAGG - Intronic
921289937 1:213648214-213648236 GCAGACTCACAGGCTGCTGTGGG - Intergenic
1063266645 10:4458798-4458820 GTGGAGTCACTTGCTGGTGAGGG - Intergenic
1066300866 10:34094413-34094435 ATTGAGTCACAGGCTGCTTTGGG - Intergenic
1068827635 10:61456805-61456827 GTGGAGTACCATGCAGCTGTGGG + Intergenic
1070996043 10:80783630-80783652 GTGGATTCACATGCAGTTGTAGG + Intergenic
1071949577 10:90687370-90687392 GTCGAGACGCATGCAGCTGCAGG + Intergenic
1073553063 10:104421372-104421394 CTTGAGTCACATACTGCTGATGG + Intronic
1079041854 11:17066798-17066820 GTCCAATCATATGCTTCTGTGGG + Intergenic
1079466401 11:20735176-20735198 GTCGGGTCAAATGCTGCTGAGGG + Intronic
1083886938 11:65577531-65577553 GCTGAGTCACAGGCGGCTGTGGG + Intronic
1083940408 11:65892429-65892451 GTCCAATCACCTGCTGCTGCTGG + Exonic
1086433062 11:86754322-86754344 GTCAATTCACAAGCTCCTGTGGG + Intergenic
1087375603 11:97336064-97336086 CTCAGCTCACATGCTGCTGTGGG - Intergenic
1091801753 12:3328833-3328855 GTGGAGTCCCATGCTCATGTGGG - Intergenic
1094499369 12:31008611-31008633 GTCTAGCCAGATGCTGCTGCTGG - Intergenic
1098741404 12:74178143-74178165 GTCCATTCTCATGCTGCTATAGG + Intergenic
1101653227 12:106696212-106696234 GTGGAGTCCCAAGCTTCTGTTGG + Intronic
1103830570 12:123775820-123775842 GTCCATTTTCATGCTGCTGTAGG + Intronic
1105644675 13:22304103-22304125 GTCCATTCTCATGCTGCTATAGG + Intergenic
1107804284 13:44139951-44139973 GTGGAGTCATGGGCTGCTGTAGG - Intergenic
1108693470 13:52881397-52881419 GTCGAGTCACATGCCTTTGTGGG - Intergenic
1109133488 13:58618268-58618290 CTTGAGTCAGATGCTGCTTTGGG - Intergenic
1111578392 13:90189842-90189864 GCAGAGTCACAGGCTGCTGATGG - Intergenic
1112230089 13:97581076-97581098 GTAGATTCACATGCAGTTGTAGG - Intergenic
1117535883 14:56702969-56702991 GTAGACTCACATGCAGTTGTAGG - Intronic
1126860485 15:52878100-52878122 ATCAAGTCTCATGCTGTTGTGGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1128569785 15:68725860-68725882 GTCGAATCTCATCCTGCTGCCGG - Exonic
1129111866 15:73341886-73341908 GTCGAGGCCCAGGCTGCTGCTGG + Intronic
1129799761 15:78405391-78405413 GTCGAGTCACCAGCTGGTGGGGG + Intergenic
1136056378 16:27692832-27692854 GTTGAGTGAGATGCTGCTCTTGG - Intronic
1138535187 16:57656219-57656241 GCAGAGTCACATTCTTCTGTAGG - Exonic
1139647578 16:68342693-68342715 TTAGTCTCACATGCTGCTGTCGG - Intronic
1139939222 16:70592414-70592436 TTTGACTCTCATGCTGCTGTGGG + Intronic
1141602351 16:85134429-85134451 GCCGGGTCACGTGCTGCTCTTGG + Intergenic
1144495190 17:15741381-15741403 GTCCAGACCCAGGCTGCTGTAGG - Intronic
1144639036 17:16927516-16927538 GTCCAGACCCAGGCTGCTGTGGG + Intergenic
1150628072 17:66856352-66856374 GTAGATTCACATGCAGTTGTTGG + Intronic
1150936041 17:69636837-69636859 ATCCAGTCCCTTGCTGCTGTAGG + Intergenic
1152927614 17:83094604-83094626 GATGAGTCACAGGCTGCGGTGGG + Exonic
1156092609 18:33489490-33489512 GGCTAGGCACTTGCTGCTGTGGG - Intergenic
1163682239 19:18689773-18689795 GTCGTGAATCATGCTGCTGTTGG + Intronic
1167854794 19:52228865-52228887 GTCGAGTCACTTGTTGCCTTTGG + Exonic
925971693 2:9110761-9110783 GTGGAGCCACAGGCTGCTCTTGG - Intergenic
926047259 2:9718675-9718697 ATCCAGGCAGATGCTGCTGTTGG + Intergenic
926607222 2:14909604-14909626 ATCGTCTCACATGCTGTTGTAGG + Intergenic
940366941 2:152858838-152858860 GTCAAGTCACATCCTGCTCATGG + Intergenic
947102389 2:226635437-226635459 GTGGAGTCTGAGGCTGCTGTGGG + Intergenic
947875474 2:233464773-233464795 GTGGAGTCACATTCTTCTGCAGG + Intronic
948135697 2:235634439-235634461 GTCCTGTCACAAGCAGCTGTGGG + Intronic
1172285239 20:33735659-33735681 GTAGATTCACATGCAGTTGTGGG + Intronic
1175756578 20:61533890-61533912 GCAGAGTCAGATGCTTCTGTGGG - Intronic
1175811111 20:61857702-61857724 GTAGAGTCACATGCAGTTGTAGG + Intronic
1181520767 22:23448331-23448353 GGCGAGGCCCATGCTGCTGGGGG - Intergenic
1185021541 22:48379584-48379606 ATCGAGACACTTGCTGCTGCTGG + Intergenic
1185091179 22:48774801-48774823 GTAGATTCACATGCGGTTGTAGG + Intronic
953386382 3:42508443-42508465 GGCGTGTCACATGCTGCGCTGGG + Intronic
959752780 3:109858109-109858131 GTAGTGTCAAATGCTGCTGATGG - Intergenic
960821722 3:121740346-121740368 GTAGAGTCACATGCAGTTGTAGG - Intronic
962074458 3:132066724-132066746 GTACAGTGACTTGCTGCTGTTGG - Intronic
966604392 3:181807892-181807914 GTAGACTCAAATGTTGCTGTAGG - Intergenic
973789460 4:54364911-54364933 ATTGAGTGACCTGCTGCTGTGGG - Intergenic
974451106 4:62061300-62061322 GTAGATTCACATGCTGTTGTAGG + Intronic
980063568 4:128156636-128156658 GTCCAATCACCTGCTGCTGCTGG - Intronic
982094499 4:151909655-151909677 GTTGGGTCACAGGCTGCTGGTGG + Intergenic
982104742 4:152001899-152001921 GTCTAGTCATAAACTGCTGTGGG - Intergenic
988716574 5:33834770-33834792 GTCTACACACATGCTGCTGTTGG + Intronic
1000872254 5:166591581-166591603 GTCGACTCACAAACTCCTGTTGG + Intergenic
1002215877 5:177632233-177632255 GGCGAGACACATCTTGCTGTGGG + Intergenic
1005812598 6:29528857-29528879 GGCCAGTCACAGGCTCCTGTGGG - Intergenic
1016141345 6:140615121-140615143 GTAGATTCACATGCTATTGTAGG + Intergenic
1019103124 6:169648202-169648224 TTCCAGTCTCATGCCGCTGTGGG + Intronic
1026627239 7:72006092-72006114 GTAGACTCACATGCAGTTGTAGG - Intronic
1036197227 8:6730145-6730167 TTCCATACACATGCTGCTGTTGG + Intronic
1037714579 8:21386277-21386299 GGGAAGTCACATGCTCCTGTTGG - Intergenic
1041413972 8:57587215-57587237 GGGGAGCAACATGCTGCTGTGGG - Intergenic
1044642253 8:94395636-94395658 GATGAGTCACATGCTACTGATGG - Intronic
1046097400 8:109577941-109577963 GTGGAGTCAAATACTGCTCTGGG + Exonic
1047409287 8:124611111-124611133 GTTGAGTCACATGCTGGGGGGGG - Intronic
1049360322 8:142209688-142209710 GTGGAGGCTCAGGCTGCTGTGGG - Intergenic
1057025093 9:91728850-91728872 GTGGAGTGGCATGCAGCTGTGGG - Intronic
1060387459 9:123245136-123245158 GTGGATTCACATGCTGTTGTAGG - Intronic
1060736067 9:126067235-126067257 CTGGAGTCAGCTGCTGCTGTGGG + Intergenic
1060773359 9:126348765-126348787 GTAGACTCACATGCAGTTGTAGG + Intronic
1061191201 9:129083722-129083744 ATTGAGTCTCATGCAGCTGTAGG + Intronic
1185717481 X:2354330-2354352 GGCGTGTTCCATGCTGCTGTAGG - Intronic
1187104171 X:16223139-16223161 CTGGAGTTACATGCTGCTGATGG + Intergenic