ID: 901052000

View in Genome Browser
Species Human (GRCh38)
Location 1:6429947-6429969
Sequence GTCGAGTCACATGCTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901052000_901052011 29 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052011 1:6429999-6430021 AGGCTGGGCTCACGCAGGAGGGG 0: 1
1: 0
2: 2
3: 23
4: 338
901052000_901052004 9 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052004 1:6429979-6430001 GGTGTCTTTGTGTGGTTGCCAGG 0: 1
1: 1
2: 0
3: 24
4: 246
901052000_901052010 28 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052010 1:6429998-6430020 CAGGCTGGGCTCACGCAGGAGGG 0: 1
1: 0
2: 4
3: 24
4: 291
901052000_901052009 27 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052009 1:6429997-6430019 CCAGGCTGGGCTCACGCAGGAGG 0: 1
1: 0
2: 3
3: 40
4: 369
901052000_901052007 24 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052007 1:6429994-6430016 TTGCCAGGCTGGGCTCACGCAGG 0: 1
1: 0
2: 2
3: 17
4: 210
901052000_901052005 13 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052005 1:6429983-6430005 TCTTTGTGTGGTTGCCAGGCTGG 0: 1
1: 1
2: 0
3: 40
4: 838
901052000_901052003 1 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052003 1:6429971-6429993 GATAAGAAGGTGTCTTTGTGTGG 0: 1
1: 1
2: 0
3: 16
4: 258
901052000_901052006 14 Left 901052000 1:6429947-6429969 CCCACAGCAGCATGTGACTCGAC 0: 2
1: 0
2: 0
3: 7
4: 84
Right 901052006 1:6429984-6430006 CTTTGTGTGGTTGCCAGGCTGGG 0: 1
1: 1
2: 4
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901052000 Original CRISPR GTCGAGTCACATGCTGCTGT GGG (reversed) Intronic