ID: 901052570

View in Genome Browser
Species Human (GRCh38)
Location 1:6432627-6432649
Sequence CACACTGCTGGGGCATCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901052565_901052570 -4 Left 901052565 1:6432608-6432630 CCTGGGGCTCTGTAAGCAGCACA 0: 1
1: 2
2: 4
3: 20
4: 256
Right 901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG 0: 1
1: 0
2: 3
3: 20
4: 173
901052557_901052570 27 Left 901052557 1:6432577-6432599 CCCTTCTAAGGGGGAGAGCTGAG 0: 3
1: 0
2: 0
3: 15
4: 134
Right 901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG 0: 1
1: 0
2: 3
3: 20
4: 173
901052564_901052570 -3 Left 901052564 1:6432607-6432629 CCCTGGGGCTCTGTAAGCAGCAC 0: 3
1: 0
2: 0
3: 47
4: 324
Right 901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG 0: 1
1: 0
2: 3
3: 20
4: 173
901052558_901052570 26 Left 901052558 1:6432578-6432600 CCTTCTAAGGGGGAGAGCTGAGC 0: 3
1: 2
2: 0
3: 13
4: 119
Right 901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG 0: 1
1: 0
2: 3
3: 20
4: 173
901052563_901052570 4 Left 901052563 1:6432600-6432622 CCTTGGACCCTGGGGCTCTGTAA 0: 3
1: 0
2: 4
3: 19
4: 212
Right 901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG 0: 1
1: 0
2: 3
3: 20
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901052570 Original CRISPR CACACTGCTGGGGCATCCTA GGG Intronic
900302814 1:1986437-1986459 CACCCTGCTGGGGCCTTCCAGGG + Intronic
900425357 1:2575896-2575918 CAGACTGCTCGGGCCTCCTTGGG + Intergenic
901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG + Intronic
902481673 1:16715409-16715431 CACGCTGCTGGGGCATCCCAGGG - Intergenic
904323214 1:29709998-29710020 CACACAGTTGGGGCATGCTGGGG - Intergenic
904838414 1:33354554-33354576 CACACTGCTGGGGCTGTCAAAGG + Exonic
904919591 1:33996608-33996630 CAGGCAGCTGGGGCATCCAAAGG + Intronic
905247497 1:36625309-36625331 CCCACTACTGGGCCATCCTTTGG + Intergenic
905279716 1:36841372-36841394 CCCATAGCTGGGGCATCCTCTGG + Intronic
905530921 1:38678050-38678072 CACACTGCTGTGGGATCCATTGG + Intergenic
906806910 1:48787917-48787939 CACATTGCTGGGCCATCAAATGG + Intronic
908746666 1:67383092-67383114 CACAGGGCTGGGGAAGCCTAAGG + Intronic
912207905 1:107528355-107528377 CACACTGCTGGAGCATCAGCTGG - Intergenic
913118796 1:115720696-115720718 CAAAGTGCTGGGGTATCCAAAGG - Intronic
913285070 1:117218352-117218374 CACACGGCTGGGTACTCCTATGG + Intergenic
913598269 1:120398071-120398093 GCAACTGCTGGGGAATCCTAAGG - Intergenic
914089061 1:144481245-144481267 GCAACTGCTGGGGAATCCTAAGG + Intergenic
914309551 1:146452967-146452989 GCAACTGCTGGGGAATCCTAAGG - Intergenic
914512141 1:148343618-148343640 GCAACTGCTGGGGAATCCTAAGG + Intergenic
914592559 1:149120171-149120193 GCAACTGCTGGGGAATCCTAAGG + Intergenic
915556691 1:156664778-156664800 CACACAGCTAGGACATCCTGTGG - Intergenic
915805126 1:158840320-158840342 CGCACGGCTGGGGAGTCCTAAGG + Intronic
922062299 1:222104241-222104263 ACCTCTGCTGGGGCACCCTATGG - Intergenic
924936891 1:248779416-248779438 CACATTGCTGGGGAAGCCTCAGG + Intergenic
1064426320 10:15232820-15232842 CACACTCATGGGACATCCTAGGG - Intronic
1067442628 10:46318143-46318165 CCCACTGCTGAGGGATCCTCCGG - Intronic
1067738352 10:48876844-48876866 CACACATCTGGGGCACCCTGGGG - Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069544115 10:69317107-69317129 CACACTGCTAGGCCCTCCCAGGG + Intronic
1070697248 10:78572360-78572382 CCCACTACTTGGGCATCCCATGG - Intergenic
1071437013 10:85656862-85656884 CACTCTGCTTGGCCTTCCTAGGG - Intronic
1077056028 11:593631-593653 GACACTGCAGGGGCCTCCTTGGG + Intronic
1083073891 11:60017265-60017287 CCCTCTGCTGGGGCAGCCCAGGG - Intergenic
1083292977 11:61700024-61700046 GGCACTGCTGGGGCAGCCTTGGG - Intronic
1084432641 11:69120083-69120105 CACAGTGCTGGGGCACCGCAGGG + Intergenic
1088878207 11:113953053-113953075 CACACTGCTGAGCCATGCTAGGG - Intergenic
1090008106 11:123020487-123020509 CAGACTGATTGGGCACCCTAGGG - Intergenic
1091070867 11:132561596-132561618 CACAATGCTGGGGGACCATATGG + Intronic
1091649966 12:2302569-2302591 CTCACTGGTGGAGCATCCGAGGG - Intronic
1095465372 12:42483563-42483585 CACCCTGCTGGGGTCTCCTCCGG - Intronic
1096656716 12:53096973-53096995 CACAATGCTAGGGTCTCCTACGG + Intergenic
1096780389 12:53988478-53988500 AACAGAGCTGGGGCAACCTAAGG - Intronic
1097503728 12:60438540-60438562 CACACTGCTGGTGGAGCCTGGGG + Intergenic
1099356418 12:81641468-81641490 CTCACTTCTGGGGCATTCTTTGG - Intronic
1101939749 12:109091063-109091085 CACACTGCTGGGGTCTCTTGTGG + Intronic
1102119329 12:110428768-110428790 CACTCTGCTGCAGCATCCTAGGG + Intergenic
1108511582 13:51161056-51161078 CACACTGCTGTGGAATCTTCAGG + Intergenic
1110447724 13:75605723-75605745 CAAACTTCTATGGCATCCTATGG - Exonic
1110831238 13:80033618-80033640 CACACAGCTGGGGAAGCCTCAGG - Intergenic
1113100058 13:106707501-106707523 CACATTGCTGGGGAAGCCTCAGG + Intergenic
1113811391 13:113144497-113144519 CACACTGCAGGGGCATCAGCGGG + Intronic
1119401258 14:74364196-74364218 CACACTGCTGGGTAATCACAGGG + Intergenic
1120071960 14:80113558-80113580 CACACTGCTCAGTGATCCTAGGG + Intergenic
1121814090 14:96915768-96915790 CACACAGCTGGGGAAGCCTCAGG - Intronic
1122349290 14:101078188-101078210 CACCCTGTTGGAGCACCCTAGGG + Intergenic
1122640533 14:103156643-103156665 CACTCTGCTTGGGTATCCCAGGG - Intergenic
1124512390 15:30338226-30338248 CACACTGCCTGAGCAGCCTACGG - Intergenic
1124730524 15:32192525-32192547 CACACTGCCTGAGCAGCCTACGG + Intergenic
1124959337 15:34383020-34383042 GACACTGCTGGGGCATCCGGGGG + Exonic
1124975963 15:34529241-34529263 GACACTGCTGGGGCATCCGGGGG + Exonic
1125230915 15:37453802-37453824 CACATGGCTGGGGAATCCTCAGG - Intergenic
1125854082 15:42932456-42932478 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1126494850 15:49278872-49278894 CACATTGCTGGGGCAGCCTCAGG + Intronic
1127389450 15:58493345-58493367 CACAAAACTGGGGCATCGTAGGG + Intronic
1128452918 15:67817339-67817361 CTGACTGATGTGGCATCCTATGG + Intergenic
1130367233 15:83251736-83251758 CACAGTGCTGGGCGAGCCTATGG - Intergenic
1131057520 15:89384420-89384442 AACACTGCAGAGGCATCCTTTGG - Intergenic
1132094174 15:98969787-98969809 GACACTGGTGGGGGATCCTGGGG - Intronic
1133610864 16:7432098-7432120 CACAGTGTGGGGGCATCCTGTGG - Intronic
1135088283 16:19491823-19491845 CACCGTGCTGGGTCATCTTAGGG + Intronic
1139548902 16:67662675-67662697 CACACTGCTGGGACATGGCAGGG + Exonic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1143336966 17:6178668-6178690 CCCACTGCTGGGGCAGCCAGGGG + Intergenic
1144047437 17:11466495-11466517 CACACTTCAGGGACATCCTCAGG + Intronic
1146263105 17:31434287-31434309 CATTCTGCTGGGGCTTCCCAAGG - Intronic
1146817876 17:35958614-35958636 CACACAGCTGGGGCACCTTAAGG + Intergenic
1150190956 17:63238754-63238776 CACACAGCTGGGGAAGCCTTGGG + Intronic
1150198355 17:63325479-63325501 CACACAGCTGGGGCACCTTAAGG - Intronic
1151236783 17:72726129-72726151 CAGACTCGTGGAGCATCCTAGGG - Intronic
1152625106 17:81384416-81384438 CACACTGCTGGGGAACCCACAGG - Intergenic
1152737389 17:82004217-82004239 GACAGTGCTGGGGCATCCCTGGG - Intronic
1154024094 18:10690470-10690492 GACAGGGCTGAGGCATCCTAGGG - Intronic
1155403972 18:25467616-25467638 CAGGCTGCTGGGTTATCCTATGG + Intergenic
1156178418 18:34574458-34574480 AACACTTCTGGGGCATCATTGGG - Intronic
1158514100 18:58116812-58116834 CACACTGATGGTCCATCCTTTGG + Intronic
1159357914 18:67359837-67359859 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1159436840 18:68429202-68429224 CACATTGCTGGGGAAGCCTCAGG + Intergenic
1160501581 18:79403698-79403720 CCCACTGCTGGGGCATTTAATGG + Intronic
1160775234 19:852456-852478 CACACTGGTGGGGCCCTCTATGG - Intronic
1160977906 19:1802768-1802790 CCCAGTGCTGGGGCACCATAGGG - Intronic
1161722191 19:5909210-5909232 CACCCTGCAGGGGGACCCTACGG + Exonic
1202715712 1_KI270714v1_random:41321-41343 CACGCTGCTGGGGCATCCCAGGG - Intergenic
925310347 2:2877349-2877371 CACAGTGCCAGGGCATCCTCAGG + Intergenic
927517172 2:23678972-23678994 CACACTGTTGGGCAATCCTCTGG - Intronic
928172272 2:29011383-29011405 GACACTGCTGGGGGAGCCCAGGG - Intronic
932757168 2:74416976-74416998 CTCTCTGCTGCAGCATCCTAGGG + Intronic
936151333 2:110023912-110023934 CACTCTGATGGGGCATCCCAGGG + Intergenic
936193342 2:110347457-110347479 CACTCTGATGGGGCATCCCAGGG - Intergenic
937005295 2:118506658-118506680 CACACTGCTGGGGGAAACTGAGG + Intergenic
937089038 2:119193148-119193170 CACACTTCGGGGGCATACAAGGG + Intergenic
938101577 2:128501279-128501301 CACACAGCCGGGGCCTCCTTGGG - Intergenic
941818750 2:169824821-169824843 CGCACTGCTGGAGCAGCCTCAGG + Exonic
944586980 2:201181148-201181170 CACTCTGCTGCAGCATTCTAGGG + Intergenic
945139528 2:206668969-206668991 CACACTGCTGGGGAGGCCTCAGG - Intronic
946475786 2:220005258-220005280 CACACAGATGAGGCACCCTAGGG - Intergenic
946900534 2:224367768-224367790 CACACGGCTGGGGAAGCCTCAGG - Intergenic
948732117 2:239972325-239972347 CACTCTGCTGGGGCAAGCAATGG + Intronic
1169031127 20:2407942-2407964 CACTCTACTGGGGCATCCAGAGG + Intronic
1170438116 20:16350836-16350858 CACACTGCTGGGTGATCCACTGG + Intronic
1173169756 20:40714373-40714395 CACCCTGATGGGCCATCCTCGGG + Intergenic
1175275668 20:57768905-57768927 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1175503699 20:59467584-59467606 CAGACGGCTGGGCCATCCTGGGG + Intergenic
1175678831 20:60969475-60969497 CACAGTGCTGGGGCCTCAGACGG - Intergenic
1175898813 20:62351944-62351966 CACGCTGCTGGGCCATCTCATGG - Exonic
1177270978 21:18849342-18849364 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1181685205 22:24523306-24523328 CACACTCTGGGGGCTTCCTATGG - Intronic
1181932107 22:26410086-26410108 CACAGTTCTGGGGCTTTCTACGG - Intergenic
1183406638 22:37633440-37633462 GCCTCTGCTGGGGCCTCCTATGG + Exonic
951284288 3:20790502-20790524 CACACTGCTGGGTCACCAAATGG - Intergenic
953140197 3:40222363-40222385 CACACTGGTGGGGTGTCTTATGG + Intronic
953299132 3:41753855-41753877 CACACTGCTGGGGAGGCCTCAGG + Intronic
954293663 3:49662635-49662657 GACCCTGCTGGGACATCTTAGGG - Intronic
954757396 3:52848807-52848829 CACACAGCTTGTGCCTCCTATGG - Intronic
960594178 3:119392865-119392887 CACACTGCTGGGACATCCACAGG - Intronic
961453462 3:127013051-127013073 CACACTGCTGGGACAGACCAGGG - Intronic
962908421 3:139825832-139825854 GACACTGCTGGGGCAGCTTGAGG + Intergenic
963087951 3:141455767-141455789 CACACCCCTGGGGCAGCCAAAGG + Intergenic
969129467 4:4981020-4981042 CACACAGCTGGGGCATCCAAGGG + Intergenic
969415114 4:7052942-7052964 CCCACAGCTGGGGCTTCCTCTGG - Intronic
969629622 4:8328771-8328793 CACAGTGCTGGGGAGTCCTGGGG - Intergenic
973884386 4:55305967-55305989 CACACTGCTAGGGCATAGTGAGG - Intergenic
975329848 4:73100303-73100325 CACTCTGCTGCAGCATCCTAGGG - Intronic
977299632 4:95253507-95253529 AACACTGCTGGGGCTTCTCAGGG - Intronic
978879311 4:113681456-113681478 CACATTGCTGGGGAAGCCTCAGG - Intronic
980574118 4:134663584-134663606 CAAACTTCTGGGGTATCCTTAGG + Intergenic
982882787 4:160741396-160741418 CACACTGCTGGGGAGGCCTCAGG + Intergenic
983580746 4:169307403-169307425 CAACCTGCTGGGCCAGCCTAAGG - Intergenic
993120326 5:83766483-83766505 AACACTGCTCTGGCATCCCAAGG - Intergenic
999115020 5:149155264-149155286 AATAGTGCTGGGGCATCCAACGG - Intronic
999953418 5:156674424-156674446 CTCACTCCTGAGCCATCCTAAGG - Intronic
1000099137 5:157998057-157998079 CACATTGCTGGGGAAGCCTCGGG - Intergenic
1000199153 5:158990232-158990254 CACACTGTGGGGACATCCCAGGG + Intronic
1001536147 5:172499307-172499329 CAGCCTGCTGGGCCACCCTACGG + Intergenic
1001693069 5:173647109-173647131 ACCTCAGCTGGGGCATCCTATGG + Intergenic
1006474597 6:34246055-34246077 CACTCTGCTGCAGCATCCTAGGG - Exonic
1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG + Intergenic
1007633923 6:43286939-43286961 CAGACTGCTGGGGCACACTAAGG - Exonic
1011018208 6:82782092-82782114 CACAGGGATGGGGCTTCCTAAGG + Intergenic
1012733654 6:102911499-102911521 CACTTTGCTGGGGCAGCCTCAGG - Intergenic
1014987695 6:128032152-128032174 CAGACTCCTGAGGCATCCTCGGG + Intronic
1016078443 6:139826170-139826192 CTCACTGTTGGCGCTTCCTATGG + Intergenic
1016997064 6:149968201-149968223 CACTGTGCTGGAGCATCCCAGGG + Intronic
1016998368 6:149977064-149977086 CACTGTGCTGGAGCATCCTAGGG + Intergenic
1017001738 6:150002052-150002074 CACTGTGCTGGAGCATCCCAGGG - Intergenic
1017283580 6:152649348-152649370 CACACTGCTCCTGCATCCTCAGG - Intergenic
1017364777 6:153622421-153622443 CACACTCCTTGGGCCTCCTTGGG - Intergenic
1017812677 6:157995422-157995444 CACTCTGCTGGGCCCTCCTAGGG + Intronic
1018493549 6:164323450-164323472 CACATTTCTGGGGCATCTTGTGG - Intergenic
1019576186 7:1738769-1738791 GTCACTGCTGTGGCATCCCAGGG - Intronic
1020574889 7:9913674-9913696 GACACAGCTGGGGCAGCCAAGGG - Intergenic
1021823321 7:24519624-24519646 CACATTGCTGGGGAAGCCTCAGG + Intergenic
1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG + Intergenic
1024318897 7:48045804-48045826 CACACAGGAGGGGCATCCAAAGG - Intronic
1024819850 7:53315530-53315552 CACACTGCAGCGGCATTCTCTGG + Intergenic
1024828436 7:53420007-53420029 CACAGTGCTGGGGAAGCCTCAGG - Intergenic
1029188484 7:98755721-98755743 CACATGGCTGGGGCATTCCAGGG + Intergenic
1030756002 7:113288824-113288846 CACACGGCTGGGGAAGCCTCAGG - Intergenic
1032321138 7:130887704-130887726 CACGCTGCTGGGGAATACTGAGG + Intergenic
1033361847 7:140643556-140643578 CCCATTGCTGGGTCATCCTGTGG + Intronic
1033852787 7:145517572-145517594 CACATTGCTGGGGCAACCTCAGG + Intergenic
1034109500 7:148522558-148522580 AACACTGCTGTGGCAGCCTTGGG + Intergenic
1036574198 8:10010454-10010476 AAGACAGATGGGGCATCCTAGGG - Intergenic
1038578049 8:28722269-28722291 CACCCTCCAAGGGCATCCTAAGG - Intronic
1038951601 8:32421030-32421052 CACACTGCTGGGGAGGCCTTAGG - Intronic
1041037936 8:53814224-53814246 CACAATCCTGGGGCAGCCAAGGG + Intronic
1043306797 8:78805157-78805179 TACACTGCTGGCGGATCCTACGG - Exonic
1043525744 8:81094881-81094903 CACACAGCTGGTGCATGTTATGG - Intronic
1044220563 8:89664368-89664390 CACACGGCTGGGGAAGCCTCAGG + Intergenic
1045292194 8:100843147-100843169 CACCCTACTTGGGCATCTTATGG + Intergenic
1047178784 8:122567582-122567604 CACATGGCTGGGGAATCCTCAGG + Intergenic
1048781422 8:138006305-138006327 CACAGGGCTGGGGAACCCTAAGG - Intergenic
1052599631 9:30608431-30608453 CACATGGCTGGGGAAGCCTAAGG - Intergenic
1055176928 9:73330885-73330907 CACACTCCTGGGACAACCAATGG - Intergenic
1055527709 9:77151982-77152004 CACATTGCTGGGGCAGAATATGG + Intergenic
1055747583 9:79467185-79467207 CAAACTGCTTGGGCATCCGGGGG - Intergenic
1055767124 9:79675382-79675404 CAAATTGTTGGGGCAGCCTAAGG + Intronic
1055767207 9:79676413-79676435 CAAATTGTTGGGGCAGCCTAAGG - Intronic
1058718463 9:107742494-107742516 CCCACTGCTGGAGCTCCCTAAGG - Intergenic
1060867090 9:127009220-127009242 CACAATGATGAGGCATCCAATGG - Intronic
1062021051 9:134319596-134319618 CACCCTGCTGGGGCCTCCCATGG - Intronic
1186994707 X:15107621-15107643 CACACAGCTGGGGTATCCTTTGG - Intergenic
1194540161 X:95159771-95159793 CACATTGCTGGGGAAGCCTCAGG - Intergenic
1194781119 X:98026936-98026958 CACATTGCTGGGGCAGCATCAGG + Intergenic
1199327870 X:146522689-146522711 CACATTGCTGGGGAGGCCTATGG + Intergenic
1200971502 Y:9157518-9157540 CACAGTGCTGAGTCATCCCATGG - Intergenic
1202139517 Y:21706779-21706801 CACAGTGCTGAGTCATCCCATGG + Intergenic