ID: 901054936

View in Genome Browser
Species Human (GRCh38)
Location 1:6444685-6444707
Sequence GAGTGTGCCCAGGAGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 3, 1: 1, 2: 4, 3: 41, 4: 527}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901054927_901054936 14 Left 901054927 1:6444648-6444670 CCACTCCAGCATCAAGGGCCAGC 0: 3
1: 0
2: 2
3: 21
4: 198
Right 901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG 0: 3
1: 1
2: 4
3: 41
4: 527
901054931_901054936 -10 Left 901054931 1:6444672-6444694 CCCTCCATGTGGTGAGTGTGCCC 0: 1
1: 2
2: 2
3: 10
4: 137
Right 901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG 0: 3
1: 1
2: 4
3: 41
4: 527
901054922_901054936 27 Left 901054922 1:6444635-6444657 CCTGCTCCTCCAGCCACTCCAGC 0: 3
1: 1
2: 24
3: 160
4: 1021
Right 901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG 0: 3
1: 1
2: 4
3: 41
4: 527
901054930_901054936 -4 Left 901054930 1:6444666-6444688 CCAGCACCCTCCATGTGGTGAGT 0: 1
1: 2
2: 0
3: 15
4: 178
Right 901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG 0: 3
1: 1
2: 4
3: 41
4: 527
901054926_901054936 18 Left 901054926 1:6444644-6444666 CCAGCCACTCCAGCATCAAGGGC 0: 3
1: 0
2: 3
3: 16
4: 201
Right 901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG 0: 3
1: 1
2: 4
3: 41
4: 527
901054923_901054936 21 Left 901054923 1:6444641-6444663 CCTCCAGCCACTCCAGCATCAAG 0: 3
1: 0
2: 3
3: 30
4: 289
Right 901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG 0: 3
1: 1
2: 4
3: 41
4: 527
901054928_901054936 9 Left 901054928 1:6444653-6444675 CCAGCATCAAGGGCCAGCACCCT 0: 3
1: 0
2: 1
3: 15
4: 158
Right 901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG 0: 3
1: 1
2: 4
3: 41
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901054936 Original CRISPR GAGTGTGCCCAGGAGGAAGA CGG Intronic
900984823 1:6067029-6067051 GAATGTGCCCAGGATGGAAAAGG + Intronic
901025305 1:6275982-6276004 CAGTGTGCCCAGGAAGCAGTGGG + Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
902280016 1:15367536-15367558 GAGTGTGCTCAAGGAGAAGATGG + Exonic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902516142 1:16990599-16990621 GCTTGAGCCCAGGAGGAAGGAGG - Intronic
902717298 1:18281624-18281646 GAGTGGGCTGAGGAGGAAGGAGG - Intronic
902725471 1:18333029-18333051 AAGTGTGTCCAGGAGGCTGAAGG + Intronic
902768267 1:18631030-18631052 GAGTGTGGTCCGGAGAAAGAAGG + Exonic
902926241 1:19697679-19697701 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903737165 1:25537366-25537388 GACAGTGCCAAGGAGGACGAGGG + Intergenic
904072431 1:27811794-27811816 GAGAGTGCCCTGGAAGATGATGG + Intronic
904894134 1:33801436-33801458 GAGGAGGCCCTGGAGGAAGAAGG + Intronic
905217737 1:36421321-36421343 GAGTGTTCCCGGGAGGAGGATGG - Intronic
905238639 1:36567879-36567901 GGGTGTGCTCAGGATGGAGATGG - Intergenic
905337592 1:37256164-37256186 GAGAGTGCCAAGGAGAAAGGAGG - Intergenic
905409865 1:37761322-37761344 GAGTGTGCCCTAGAGGAAAGAGG - Intronic
906418688 1:45643953-45643975 CACTGTGCCCAGCAGGAAAATGG + Intronic
907810691 1:57866958-57866980 GAGAGAGCCCAAGAGGAAAAAGG - Intronic
908053108 1:60254480-60254502 GAGTGTCACATGGAGGAAGAAGG + Intergenic
910916589 1:92296243-92296265 GTGTGTACCTAGAAGGAAGATGG + Intronic
911794026 1:102054187-102054209 CATTATGCCCAGGAAGAAGATGG + Intergenic
912474354 1:109926065-109926087 GAGTGTGTCCAGGATGGTGAGGG - Intronic
914797003 1:150928442-150928464 GATAGAGCACAGGAGGAAGAAGG - Intronic
915016536 1:152739225-152739247 GAGATTGCCCAGGAGAAAGAGGG - Intronic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916619912 1:166486032-166486054 GTGGGTGCTCAGGGGGAAGAGGG - Intergenic
917667977 1:177244000-177244022 CTGTGAGCCCAGGAGGAAAATGG + Intronic
917829755 1:178868313-178868335 GCATGTGCCCAGGAGGATGATGG - Intronic
918194820 1:182211457-182211479 GTGTTTGCCCAGGAAGAAGAGGG - Intergenic
918200740 1:182264194-182264216 GAGAGTGCCCAGCAGCAACAAGG + Intergenic
918479587 1:184964210-184964232 GAGTTTGCCTAGGATGCAGATGG + Intronic
919968447 1:202553607-202553629 GAGTGTACAGAGGAGGAGGATGG + Intronic
920349490 1:205328541-205328563 AAGTGTGCCCAGGAGGGAGGTGG + Intergenic
920988079 1:210909308-210909330 GAGTGTGTAAAGGAGGGAGAAGG - Intronic
921260900 1:213384388-213384410 GGATGTGGCCAGGAGGAAGAGGG + Intergenic
921751230 1:218796381-218796403 AAGAGGGCCCTGGAGGAAGAAGG + Intergenic
923015144 1:230120732-230120754 GTGTGTGCGGAGGAGGATGAGGG - Intronic
923544239 1:234912774-234912796 GAGAGTTCCCAGCAGCAAGAAGG + Intergenic
923693027 1:236214977-236214999 GAGTGTGCAGTGGAGGAAGCTGG + Intronic
924028919 1:239867351-239867373 GAGTGTGCCCACTAGGAATAGGG + Intronic
924045960 1:240030826-240030848 GATTGAGCCCAGGGGGAAGGAGG + Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062806481 10:423831-423853 TCGTGTGCCCCGGAGGAAAACGG - Intronic
1063129197 10:3162816-3162838 GAGGGTGCCCAGGAGAAACCCGG + Intronic
1064096040 10:12425164-12425186 GAGGGTGCCCAGGAGCCAGCTGG - Intronic
1065788144 10:29235477-29235499 GAGTGTGGATAGGAGGCAGAAGG + Intergenic
1066412956 10:35191779-35191801 GAGGGAGCTCAGCAGGAAGAGGG - Intronic
1066426024 10:35308535-35308557 GAGTGAGCCCATGGGGAGGAGGG + Intronic
1066460457 10:35608273-35608295 GAGGGTGGGCGGGAGGAAGAGGG + Exonic
1066562675 10:36687677-36687699 GATTGTAGCCAGGATGAAGAAGG + Intergenic
1067054159 10:43041608-43041630 GAGCATGCCCAGGAGGAGGGAGG - Intergenic
1067172815 10:43922072-43922094 GACTTTGCCCAGGAGGCAAAGGG + Intergenic
1067787358 10:49260255-49260277 GAGGGTGCCGAGAAGAAAGAGGG + Intergenic
1068543329 10:58320390-58320412 GAGTGTCCCCACCAGCAAGAAGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068884381 10:62083500-62083522 GAGTGTGGGAAGGAGGAGGAGGG - Intronic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1069794001 10:71040895-71040917 GCATGTGCCCAGGAGGATGTGGG - Intergenic
1069925998 10:71851192-71851214 GAGGCTGGCCAGGAGGAAGAGGG + Exonic
1070645106 10:78196357-78196379 ACGTGTGCCCTGGAGGAAAACGG + Intergenic
1070720983 10:78756955-78756977 TGCTGTGCCCAGGAGGAGGATGG - Intergenic
1071516812 10:86303453-86303475 GACTGTGCTCAGCAGGAAGGAGG + Intronic
1072642795 10:97225139-97225161 GAGTGTGCCTAGGAGGGGGCTGG - Exonic
1072785020 10:98273474-98273496 GTGTGTGGCCAGGACGGAGAGGG - Intergenic
1072795617 10:98352266-98352288 GTCTGAGCCCAGGAAGAAGAGGG + Intergenic
1073048797 10:100654974-100654996 GAGAAGGCCCAGGAGGAAGACGG - Intergenic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074125243 10:110523974-110523996 GATTCTGCAGAGGAGGAAGAAGG + Intergenic
1074149438 10:110745114-110745136 GGGTTTGCCCAGGAGAAACAGGG - Intronic
1074791163 10:116888981-116889003 GAGTGGGCCCAGGCCCAAGATGG - Intronic
1075845860 10:125544607-125544629 GGCTGCACCCAGGAGGAAGAGGG + Intergenic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1076308631 10:129485353-129485375 GGCTGTGCCAAGGAGGAGGAGGG - Intronic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1076636028 10:131882434-131882456 GAGTGTGCCCTGGAAGGAGGCGG - Intergenic
1076700840 10:132271827-132271849 CAGTGTGCCCAGGAGGCCGCAGG - Intronic
1076837382 10:133028092-133028114 CAGTGTACCCAGGAGTCAGAGGG + Intergenic
1077168314 11:1153542-1153564 GAGGGTTCCCAGGAGGCAGGTGG + Intergenic
1077735552 11:4786848-4786870 AACTGTGCTCAGAAGGAAGAAGG - Intronic
1078139205 11:8679751-8679773 GCATGTGACCAGCAGGAAGAGGG - Intergenic
1078437009 11:11333749-11333771 GATTGTGTCCAGGAGTGAGAAGG + Intronic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1078930835 11:15910983-15911005 GAGAGAGCCAAAGAGGAAGAGGG - Intergenic
1080186316 11:29491357-29491379 GGGTGTGCCCAGGTTGAAGGTGG - Intergenic
1080409500 11:32010253-32010275 GAGGTTGCTCATGAGGAAGATGG - Intronic
1081322543 11:41708747-41708769 GTATGTGCCCAGGAAGAAAAAGG - Intergenic
1081701405 11:45155085-45155107 GAGTGGGCCCAGCAGGCAGGAGG + Intronic
1082872779 11:57958895-57958917 GAGTGTCCCCATCAGCAAGAAGG + Intergenic
1083147077 11:60767730-60767752 GGCTGTGCCCAGGAGGATGGTGG - Intronic
1083664608 11:64267704-64267726 GAGGGGCCCCAGGAGGATGAAGG - Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084497974 11:69516342-69516364 GAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1084565985 11:69929354-69929376 GTGTGTGCCCAAGAGGAAAGAGG - Intergenic
1085300432 11:75455364-75455386 GAGTGAGGGCAGGAGGAAGGTGG + Intronic
1088505634 11:110524371-110524393 TAGTGTTCCCATGAGCAAGAGGG - Intergenic
1088866562 11:113853203-113853225 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1089223331 11:116894107-116894129 GACTGTTCCCAGGAGGAGGGAGG - Intronic
1089256224 11:117195712-117195734 AGGGGTGCCCAGGAGCAAGATGG + Intronic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1089638308 11:119830943-119830965 GAGGGTGACATGGAGGAAGAAGG - Intergenic
1090186815 11:124744747-124744769 GGGTGTGCTTATGAGGAAGAAGG - Intronic
1090283384 11:125477781-125477803 CAGTGTCCCCTGGAGGCAGAAGG - Intronic
1090507006 11:127326496-127326518 GAGTATGCTGAGGAGGAGGAGGG - Intergenic
1090789348 11:130076944-130076966 GCATGTGGCCAGGAGGAGGAGGG + Intronic
1090952330 11:131484624-131484646 GTGTCTACGCAGGAGGAAGAGGG - Intronic
1091311120 11:134575977-134575999 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091311135 11:134576038-134576060 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091887455 12:4027074-4027096 AAGTGTGTGCAGGAGAAAGAAGG - Intergenic
1091916213 12:4273119-4273141 GTGTGTGCAGAGGAAGAAGAGGG - Intergenic
1094322409 12:29199847-29199869 TAGAGTGACCAGGAGTAAGATGG + Intronic
1094427192 12:30328006-30328028 GGGTGTGCCCAGGAGCAGGCAGG + Intergenic
1096256411 12:50064672-50064694 CAGTGTGTCCTGGAGGCAGAAGG + Intronic
1096549479 12:52362762-52362784 CAGTGTGCCCATGAGGAAGCAGG - Intronic
1100460597 12:94795605-94795627 AAGTCTGCTGAGGAGGAAGAGGG - Intergenic
1101536116 12:105618043-105618065 GAGTGTGCTATGGAGGGAGAGGG - Intergenic
1101678023 12:106937304-106937326 GAGGGTACCCATGTGGAAGAAGG + Intergenic
1101717239 12:107321337-107321359 GAGTGTGCGCAGGAACAAGCGGG + Intronic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1102231666 12:111266802-111266824 GCGTGTGGCCTGGATGAAGAGGG + Intronic
1102422051 12:112811417-112811439 GAGTGTTCCTAGGAGCAGGAAGG - Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1102777833 12:115536077-115536099 GCCTGAGCCCAGGAGGCAGAGGG + Intergenic
1103008513 12:117439887-117439909 GCGTCTGCCCAGGAGGAGGGTGG + Intronic
1104552967 12:129774315-129774337 GGGTGGGCCCAGGAAGTAGAGGG - Intronic
1104755971 12:131269541-131269563 AAGTGTACCCAGGAGGGAGGTGG + Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1104777742 12:131401140-131401162 AAGTGTACCCAGGAGGGAGGTGG - Intergenic
1104982213 12:132578447-132578469 GAGTGGGCTGAGGAGGAGGAGGG + Intronic
1105280768 13:18961399-18961421 GAGTCTGCCCAGCAGCATGAGGG - Intergenic
1105683267 13:22751917-22751939 GAGGGTGGCCAGGAGGAATGGGG - Intergenic
1106343613 13:28854911-28854933 GAGCATCCCCAGGAGGGAGATGG - Intronic
1106405437 13:29469216-29469238 GAGTGGTCACAGGAGGGAGAAGG - Intronic
1106588320 13:31076299-31076321 GAAAGTGCCTTGGAGGAAGAAGG - Intergenic
1106765904 13:32913731-32913753 GAGTGTCCCCAGGAAGAACCTGG - Intergenic
1106891304 13:34248802-34248824 GCATGTGCCAAGGAGGATGAAGG + Intergenic
1109280573 13:60350597-60350619 GAGAGTGTCCAGGAGGAATGAGG + Intergenic
1112237776 13:97651725-97651747 TAGTGTGCCCAGGGATAAGATGG + Intergenic
1112528897 13:100181503-100181525 GCTTGAGCCCAGGAGGCAGAAGG - Intronic
1112666542 13:101581284-101581306 GAGTTTGGTCAGGAGGAACAGGG - Intronic
1112928063 13:104701717-104701739 GGGTCTGTCCAGGAAGAAGATGG - Intergenic
1113066999 13:106382772-106382794 AAGTGAGCCCAGGGGTAAGACGG + Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1117294060 14:54362787-54362809 GTGTATGACCAGGAGGAAGCAGG + Intergenic
1119188087 14:72658870-72658892 AAGTGTGCCCAGTAGGCACATGG + Intronic
1120167546 14:81217707-81217729 GCTTGAGCCCAGGAGGGAGAGGG + Intronic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121739075 14:96238819-96238841 GAGGGTGCCCTGGAGGGAGCAGG - Intronic
1121874606 14:97439987-97440009 GAGGATGCCAAGGAGCAAGACGG + Intergenic
1122149287 14:99716142-99716164 GAGGGAGCCCAGGACGACGAGGG + Exonic
1122848654 14:104514636-104514658 GAGTGTGGTGAGGTGGAAGATGG + Intronic
1122868915 14:104625127-104625149 GAGGCTGCCCAGGAAGAACAAGG + Intergenic
1126363535 15:47870763-47870785 GGTTGTGCCCAGCAGGAGGAGGG - Intergenic
1126591206 15:50341741-50341763 AATTGTGCCCTAGAGGAAGACGG - Intronic
1127303430 15:57679826-57679848 GAGTGTGCCCAGAAGGCTGTGGG - Intronic
1127899320 15:63329583-63329605 GTGTGTGTCTTGGAGGAAGAAGG + Intronic
1128564887 15:68694668-68694690 GACTGTGCCCTGGGGGAAGCAGG + Intronic
1129333393 15:74838981-74839003 GAGAGTCCCCATGAGGAAGTGGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130141145 15:81227500-81227522 GAGTGTGCCTAGGAGCATCAAGG + Intronic
1130543979 15:84841181-84841203 GACTGTGCCCCGGAGGGAGATGG + Intronic
1130867637 15:87946142-87946164 GAGCTTGCCCAGGAGTAAGCTGG + Intronic
1131330191 15:91490934-91490956 GAGTGTGGGCTAGAGGAAGAGGG + Intergenic
1131387911 15:92022822-92022844 GAGGCTTCCCAGGAAGAAGAAGG + Intronic
1131943118 15:97589125-97589147 GAGTGTGATTATGAGGAAGAGGG + Intergenic
1132019479 15:98348046-98348068 AGGTGTGCCCAGGAGGCAGGTGG + Intergenic
1132065020 15:98723915-98723937 TAGTGTGCCCAGAAGCCAGAAGG + Intronic
1132238514 15:100239737-100239759 TGGTGTGGCCAGGAGGAAGGTGG + Intronic
1132578168 16:673412-673434 GAGGGTGCCCAGCAGCAAGCTGG + Intronic
1133418858 16:5628363-5628385 GAATGTGCCCAGGATACAGAGGG - Intergenic
1135379630 16:21984298-21984320 GATTGTGCCCAAGTTGAAGAGGG - Exonic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137506222 16:49056223-49056245 AAGTGTTGCCAGGTGGAAGAAGG - Intergenic
1137511870 16:49107721-49107743 GTGTGTGCTCAGGAGGAAATGGG - Intergenic
1138099668 16:54242487-54242509 CTGGGTGCCCAGGAGGAAAAGGG + Intergenic
1138179154 16:54930707-54930729 GAGAGAGCCGAGGAGGAAGAGGG + Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139549264 16:67664458-67664480 GAGTGTGTCCAGGAAGCAGATGG - Intronic
1139668037 16:68471944-68471966 GCTTGAGCCCAGGAGGTAGAGGG + Intergenic
1139703729 16:68725970-68725992 GCTTGAGCCCAGGAGGCAGACGG + Intergenic
1139921182 16:70461516-70461538 GAGAGTGCCCTGGAGGAAGATGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141336800 16:83163545-83163567 CTGTGTGCCCAGGAGGAACGGGG - Intronic
1141651570 16:85395779-85395801 GCGGGCGCCCAGGAGGAAGCCGG - Intergenic
1141916460 16:87100601-87100623 GAGGTGGCCCAGCAGGAAGAGGG + Intronic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142969476 17:3601425-3601447 GGGTGTGCCCAGGTGACAGAAGG - Intergenic
1143272682 17:5687477-5687499 TGGTGTGCCCAGCAGGCAGAGGG + Intergenic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1144312737 17:14027886-14027908 GGGTGTGCCAAGGAGAAAAATGG - Intergenic
1144332020 17:14233441-14233463 GGGTGTGCCAAGGAGAAAAATGG + Intergenic
1144498805 17:15768142-15768164 GGGTGTGCCAAGGAGAAAAATGG - Intergenic
1144629089 17:16861308-16861330 GAGTCAGCCTAGGAGGAGGAAGG + Intergenic
1144652326 17:17014806-17014828 GAGTCAGCCTAGGAGGAGGAAGG - Intergenic
1144712271 17:17409629-17409651 AAGAGTACCCTGGAGGAAGAAGG - Intergenic
1144852794 17:18252405-18252427 GGGTGTGCCCTGGAGCAAGGGGG - Intronic
1145162186 17:20583176-20583198 GGGTGTGCCAAGGAGAAAAATGG - Intergenic
1145771652 17:27497525-27497547 GAGTGGGACCAGGAGGAAACAGG + Intronic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147426095 17:40346604-40346626 GGGTGAGGCCAGGAGGCAGAGGG - Intronic
1147857575 17:43493945-43493967 GGGTGTGCCCTGGAGCACGATGG + Intronic
1148000080 17:44382757-44382779 GAGCATGCACAGGAGGAAGTGGG - Intronic
1148208569 17:45794641-45794663 GAGTGTGACAAGGAGGGGGAAGG - Intronic
1148583547 17:48760553-48760575 GAGTGTGCAGTGGAGGAAGGCGG - Intergenic
1148643438 17:49205228-49205250 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1149362779 17:55911633-55911655 GAGTGTGGGAAGGAGGCAGACGG - Intergenic
1152458118 17:80427633-80427655 GAGTGAGCTCAGGAAGAAAATGG - Intronic
1203166366 17_GL000205v2_random:100425-100447 GAGAGTGCCCAAGAATAAGAGGG + Intergenic
1153731184 18:8013545-8013567 GAGTGGGCCCAGGAGTGAGTGGG + Intronic
1153851120 18:9095487-9095509 AAGTGGGCCCCAGAGGAAGAAGG + Intergenic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1154020987 18:10663827-10663849 GAAAATGCCCATGAGGAAGATGG + Intergenic
1154383571 18:13873309-13873331 CAGTGTGCCCAGGAAGGAAAGGG + Intergenic
1155339458 18:24799287-24799309 TAGTGGGCCCAGGAGGCAGCAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155853044 18:30796536-30796558 GAGAGTCCCCACCAGGAAGAAGG - Intergenic
1156495749 18:37524302-37524324 GAGGGTGACAAGGTGGAAGAAGG + Intronic
1156503918 18:37577193-37577215 GAGTGAGCCCAGAAGGGAAAGGG - Intergenic
1156897216 18:42259420-42259442 GAGTGTGAGCAGGATGAAGTTGG - Intergenic
1157265444 18:46215956-46215978 GAGACAGCCAAGGAGGAAGATGG + Exonic
1157323768 18:46654639-46654661 GAGTGTGATGGGGAGGAAGAAGG - Intronic
1157475922 18:48023653-48023675 GGGTGTGCCAAGGAGGAAAAAGG + Intergenic
1157674937 18:49561845-49561867 GAGCGGGCCCGGGAGGAAGCGGG + Intronic
1158850925 18:61495504-61495526 GAGGGAGCCCAGGAGGCAGGAGG + Intronic
1159812384 18:73030961-73030983 GCGTGAACCCAGGAGGCAGAGGG + Intergenic
1160511723 18:79456694-79456716 GAGCGGGCCGAGGAGGAAGGTGG + Intronic
1160556875 18:79731133-79731155 ATGTGTCCCCAGGATGAAGAGGG - Intronic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1161331580 19:3690959-3690981 GAGTGTCCCCACCAGGGAGACGG - Intronic
1161391631 19:4024164-4024186 CAGTGAGCCCAGGAGAAAGTGGG - Intronic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1164156656 19:22601461-22601483 GAGGGAGCCCAGGAGGAAGGGGG + Intergenic
1164203554 19:23039200-23039222 GAGTGTGCCCAGGCCGAGCATGG - Intergenic
1164549931 19:29201437-29201459 GAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1164725769 19:30464771-30464793 ATGAGTGCCCAGGAGGGAGAGGG + Intronic
1165158912 19:33804498-33804520 GAGAGTTCCCAGGAGGCTGAGGG + Intronic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165394133 19:35555113-35555135 GTGTGGGCACAGGAGGGAGAGGG - Intronic
1165418491 19:35710413-35710435 GAGTCAGCCCAGGAAGAGGAAGG + Intronic
1165639547 19:37372553-37372575 GATTGAACCCAGGAGGTAGAGGG - Intronic
1165864074 19:38925407-38925429 AAGTGGGCCCAGGTGGAGGATGG + Intronic
1166231578 19:41428013-41428035 GAAGGTGGCCAGGAGGGAGAGGG + Intronic
1166800786 19:45455858-45455880 GAGTGTCTGCAGGAGGGAGAGGG + Intronic
1166894123 19:46013099-46013121 GCTTGAGCCCAGGAGGCAGAAGG - Intronic
1167121769 19:47521452-47521474 GAGTGTTTCCAGGAGAAAGCTGG + Intronic
1167671609 19:50856816-50856838 GCGTGTGCTCAGTAGGGAGAAGG - Intronic
1168170847 19:54587691-54587713 GAGTGTGACAATGAGGAATAAGG - Intronic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
924985139 2:264015-264037 GAGGCTGCCCAGGAAGAGGAAGG + Exonic
925030464 2:646950-646972 GCTTGAGCCCAGGAGGCAGAGGG + Intergenic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
925665377 2:6249360-6249382 TACTGTGCCCATGAGGAAGTGGG - Intergenic
925909461 2:8564140-8564162 GAGTGTCCCCACCAGGCAGAGGG - Intergenic
926292053 2:11539133-11539155 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
927089842 2:19701940-19701962 GAGTCCCCCCAGGTGGAAGAGGG + Intergenic
927747031 2:25632668-25632690 GAGAGTCCCCAGCAGCAAGATGG + Intronic
927940981 2:27102583-27102605 GAGTCTGGCCTGGAGGAGGAAGG + Exonic
928013091 2:27629040-27629062 GGGTGGGGCCAGGAGGAAGATGG + Exonic
928644371 2:33336217-33336239 GAGTTTGCCCACTATGAAGATGG - Intronic
929031076 2:37650315-37650337 CAGTGAGCCCAGGAAGCAGAAGG - Intronic
929313573 2:40452173-40452195 GAGTGTGCGCGGGAGGGAGGGGG - Intronic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932166610 2:69513610-69513632 CACTGTGCCCAGCAGAAAGATGG + Intronic
932422340 2:71608589-71608611 GAGAAGGCCCTGGAGGAAGAAGG - Intronic
932659741 2:73641791-73641813 GCGTTTGCCCATGAGGAAGCAGG + Intronic
932666309 2:73701469-73701491 GCGTTTGCCCATGAGGAAGCAGG + Intergenic
932668580 2:73717869-73717891 GCGTTTGCCCATGAGGAAGCAGG + Intergenic
932814696 2:74852458-74852480 GAGGCTCCCCAGGAGGAAAAAGG - Intronic
934896834 2:98126887-98126909 GACTGTGCCAAGGAGGTGGAAGG - Intronic
934925249 2:98377623-98377645 GGCTGTGTCCAGGAGGTAGATGG + Intronic
935753664 2:106260857-106260879 GAGCAGGCCCAGGTGGAAGAAGG + Intergenic
936029521 2:109059859-109059881 CACTGTGCCCAGGAGGATAATGG + Intergenic
936523527 2:113227378-113227400 GAGTGGGGGCAGGAGGAAGTGGG - Intronic
936625180 2:114141098-114141120 GAGACTGCCCAGGAAGAAGAGGG - Intergenic
937071829 2:119069655-119069677 GAGTATGTCCAGGAGAAGGAAGG + Intergenic
937234726 2:120423749-120423771 GGATGTGCCCAGGAGACAGATGG - Intergenic
937305583 2:120868567-120868589 AAGTGTCCCCAGGAGGGAGGGGG - Intronic
937353400 2:121183064-121183086 GAGTGTCCCCAGGATGCACAAGG + Intergenic
937876101 2:126826651-126826673 GCATATGCTCAGGAGGAAGATGG - Intergenic
937879694 2:126856259-126856281 GTGTGTGCTCAGGAGGAACCTGG + Intergenic
938015483 2:127863695-127863717 GAGAGTGGCCAGTTGGAAGAAGG - Exonic
938594774 2:132776846-132776868 GAGTTTTCCCGGGAGTAAGAGGG + Intronic
938903982 2:135821561-135821583 GCTTGAGCCCAGGAGGCAGAAGG - Intronic
939078375 2:137630074-137630096 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
939895922 2:147791328-147791350 TAGTGTGCTTAGTAGGAAGAAGG - Intergenic
941493912 2:166177328-166177350 GTGTGTGCCCAGAATGAAAAAGG - Intergenic
941601733 2:167551176-167551198 CTGTGTGCCCAGGAGGAAAGGGG + Intergenic
941956495 2:171210865-171210887 GACTGTTACCAGGAGGGAGAAGG + Intronic
942040944 2:172062214-172062236 GAGTGAGCCCTTTAGGAAGAAGG + Intronic
943018211 2:182540279-182540301 GCTTGAGCCCAGGAGGCAGAGGG + Intergenic
943733709 2:191330736-191330758 GAGTCTGTGGAGGAGGAAGATGG + Intronic
944334242 2:198510651-198510673 GAGTGAGACAAAGAGGAAGATGG - Intronic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944874676 2:203950245-203950267 GAGTGTCCCCACCAGAAAGAAGG - Intronic
945158173 2:206860926-206860948 GAGTGTCCCCACCAGCAAGAAGG + Intergenic
946181312 2:217950783-217950805 AAGAGTGCAGAGGAGGAAGAGGG - Intronic
947593673 2:231398237-231398259 GGCCGTGCCCAGCAGGAAGAGGG - Exonic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948223334 2:236290364-236290386 ATATGTGCTCAGGAGGAAGAGGG + Intergenic
948616543 2:239202836-239202858 GAGTGTGTCCAGGAGGGCGCAGG + Intronic
948635360 2:239331119-239331141 CAGCCTGCCCAGGAGGAAGCGGG + Intronic
948802705 2:240440082-240440104 GAAGGTGGCCAGGAGGGAGAAGG + Intronic
1169513950 20:6296397-6296419 GAGTGAGGCTGGGAGGAAGACGG - Intergenic
1169772978 20:9221518-9221540 GAGTGAGGCAAGGAGGAAGATGG - Intronic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170455299 20:16527311-16527333 GAGGCTGCCCAGTTGGAAGATGG + Intronic
1170519464 20:17169019-17169041 GAGTGTGCCCAGCATGTACAGGG - Intergenic
1170606095 20:17876021-17876043 GTCTGTGCCCAGGGGGAAGCAGG + Intergenic
1170620255 20:17989854-17989876 GAGTTTGCCCTGGAGTAAGAAGG + Intronic
1173317699 20:41959887-41959909 GAGTGGGGCCAGGAGGGAGCTGG - Intergenic
1173897202 20:46560103-46560125 GAAGGTGCCCAGCTGGAAGATGG + Exonic
1174753542 20:53136073-53136095 GAGTGTCCCCACCAGCAAGAAGG - Intronic
1175295316 20:57904287-57904309 GAGTAGGCTCAGGAGGAGGAGGG - Intergenic
1175393665 20:58643949-58643971 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393671 20:58643975-58643997 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393677 20:58644001-58644023 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393683 20:58644027-58644049 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393689 20:58644053-58644075 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393695 20:58644079-58644101 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393701 20:58644105-58644127 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393707 20:58644131-58644153 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175920980 20:62450589-62450611 GACTGTGCCCAGGGGGCAGGCGG + Intergenic
1176107623 20:63396806-63396828 GACCCAGCCCAGGAGGAAGAGGG + Intergenic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176405389 21:6358671-6358693 GAGAGTGCCCAAGAATAAGAGGG - Intergenic
1176431768 21:6630432-6630454 GAGAGTGCCCAAGAATAAGAGGG + Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1178019648 21:28394383-28394405 GAAAATGCCCAAGAGGAAGAAGG + Intergenic
1179153773 21:38832016-38832038 GACTGTGGCCCGGAGGAAGGTGG + Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180611531 22:17101329-17101351 GGGTGGTCCCAGGATGAAGAAGG - Intronic
1180857830 22:19059440-19059462 GGGGGTGTCCAGGAGGAAGTGGG - Intronic
1180885713 22:19241789-19241811 GACTGTGCCCAGGAGCCAGTGGG - Intronic
1181087581 22:20449141-20449163 GTGTGAACCCAGGAGGCAGAGGG - Intronic
1182118551 22:27772415-27772437 GAGTGTGGGGAGGAGGGAGACGG + Intronic
1182489694 22:30663162-30663184 GATGGTGCCCAGAAGAAAGAGGG - Exonic
1182748869 22:32626112-32626134 GGGTGTTCCCAGTAGGCAGAGGG + Intronic
1182963108 22:34495030-34495052 GAGTGTGCCCAAGATGGAAAGGG - Intergenic
1183475223 22:38032497-38032519 GAGTGTGCCCAGGAGAGACCGGG + Intronic
1183717007 22:39539252-39539274 GCTTGAGCCCAGGAGGCAGAAGG - Intergenic
1183862660 22:40681012-40681034 GATGATGCCCAGGAGGCAGATGG - Exonic
1184022226 22:41828456-41828478 GAAAGAGCCCAGGAGGAAGGAGG - Intergenic
1184091927 22:42297479-42297501 GAGGGTGCTCAGGAGGCAGTGGG - Intronic
1184400570 22:44271438-44271460 GAGGGTGCTTAGGAGGAACAGGG + Intronic
1184693599 22:46128245-46128267 GCATGTGCTCAGGAGGAGGATGG - Intergenic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
950024776 3:9812587-9812609 GCTTGAACCCAGGAGGAAGAGGG + Intronic
950622063 3:14213762-14213784 GAGAGTTCCCAGGAAGGAGAGGG - Intergenic
950655533 3:14434010-14434032 GAGTGTGGCAGAGAGGAAGAGGG - Intronic
951663309 3:25094632-25094654 GCTTGAGCCCAGGAGGCAGAGGG + Intergenic
952827129 3:37533343-37533365 GATGGAGCCCGGGAGGAAGATGG - Exonic
953514361 3:43575511-43575533 GAGTGACCCTGGGAGGAAGATGG - Intronic
953878682 3:46680585-46680607 CAGAGTGCCCAGGAGGTACATGG - Intronic
954370733 3:50168501-50168523 GGGTGTGCCAAGCAGGAGGAAGG + Intronic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
955266197 3:57447754-57447776 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
956368471 3:68532226-68532248 GGGTCTTCCCAGGAGGAGGAGGG + Intronic
957421507 3:79977529-79977551 GAGTGTGGGGAGGAAGAAGATGG + Intergenic
958977252 3:100682267-100682289 GAGGGTCCCCAGGAGGAACTGGG + Intronic
959083184 3:101824006-101824028 GCTTGAGCCCAGGAGGCAGAAGG + Exonic
959398258 3:105868645-105868667 GCGCGGGCCAAGGAGGAAGAGGG - Intronic
960302506 3:116021044-116021066 GAGTGTCACAAGGAGGAAGCAGG + Intronic
960632168 3:119743198-119743220 GCCTGCGCCCAGGAGGCAGAGGG - Intronic
961647847 3:128401909-128401931 GAGTCTGCCCAGGAAGGACAGGG - Intronic
962047768 3:131778633-131778655 GAGTGTGCCAAAGAGCAAGCTGG + Intronic
962179686 3:133192754-133192776 GAGTATGCACAGGAGGAAGCGGG + Intronic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962696121 3:137948981-137949003 GTGTGTCCCTAGGAGGGAGATGG + Intergenic
963127386 3:141827958-141827980 GAGGGTGCCCAAGAGGGCGAGGG + Intergenic
963323781 3:143838396-143838418 GAGAGTGTTCAGGAGGGAGAGGG + Intronic
963834715 3:150046542-150046564 GTGAGTGCCCAGCAGGAATATGG - Intronic
964720586 3:159764650-159764672 GAGTGGGCGCCGGAGGAGGACGG + Exonic
965024071 3:163275847-163275869 GAATGGGGACAGGAGGAAGAAGG + Intergenic
965148087 3:164932280-164932302 GCTTGTACCCAGGAGGCAGAGGG + Intergenic
965585511 3:170314372-170314394 CAGTGTGCACAGGAGAAAGGAGG - Intergenic
965614000 3:170574520-170574542 CAGTGTGCTCAGGAAGAAAAAGG - Intronic
965715600 3:171599252-171599274 GTGTGAGCACAGGAGGCAGAGGG - Intergenic
968284494 3:197500131-197500153 GAGTGAGGAGAGGAGGAAGAGGG + Intergenic
968790990 4:2661740-2661762 CTGTGTGCCCAGGCTGAAGATGG + Intronic
969350972 4:6597681-6597703 GAGCTTGCCCAGGAGGACGGTGG + Intronic
969619480 4:8271920-8271942 GAGACTGCCCAGGAGGCTGAGGG + Intronic
969827152 4:9766716-9766738 CAGTTTGCCCAGGATGAAGCCGG + Intergenic
971081463 4:23217099-23217121 TAATGTGCCTAGGAAGAAGATGG - Intergenic
972642581 4:40939065-40939087 GAGAGTCCCCACCAGGAAGAAGG + Intronic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
974487777 4:62526469-62526491 GCTTGAGCCCAGGAGGCAGAGGG - Intergenic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
976271378 4:83234072-83234094 GCTTGTGCCCAGGAGGTCGAGGG - Intergenic
977518919 4:98056383-98056405 GTGAATGCCCACGAGGAAGAAGG + Intronic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
979601728 4:122592800-122592822 GAGAGTCCCCACCAGGAAGAAGG + Intergenic
980979670 4:139643473-139643495 CAGGGTGCTGAGGAGGAAGAAGG - Intergenic
981550768 4:145938389-145938411 GAAAATGCCCAGGAGGAAGCAGG - Exonic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
985375587 4:189334047-189334069 GAGTGTTCCCACCAGCAAGAAGG - Intergenic
985565416 5:612780-612802 GAGTGGGCCCAGGAGAACCAGGG - Intronic
985793779 5:1947119-1947141 GAGTGTGCCCAGGAGCCACCGGG - Intergenic
985886737 5:2686059-2686081 GAGTCTGTCCAGGAGGGAGTGGG + Intergenic
986192032 5:5506278-5506300 GAGTATGCTGAGGAGGAGGAGGG - Intergenic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
987951994 5:24687519-24687541 GAGGGGGCCTAGGAGGCAGAGGG + Intergenic
991261978 5:64677386-64677408 GAGGCTGCCCAGAAGCAAGAGGG - Intergenic
993509271 5:88751499-88751521 TAGCTTGGCCAGGAGGAAGAGGG + Intronic
993530004 5:89012658-89012680 GCCTCTGCCCAGGAGTAAGAGGG + Intergenic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
994380238 5:99061792-99061814 GAGAGAGCCTATGAGGAAGAGGG + Intergenic
994613445 5:102074983-102075005 CTGTGTGCCCAAGAGGAAAAGGG - Intergenic
995686796 5:114780598-114780620 GAGGGTGTACAGGAGAAAGAGGG - Intergenic
996029526 5:118689492-118689514 GAGTAAGCCAAGGAGAAAGAAGG + Intergenic
996412649 5:123175303-123175325 TGGTGTGCCCAGGAGGCTGAAGG - Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
997594005 5:135094419-135094441 GAGGATGCCCAGGAGGTAGCTGG - Intronic
997632464 5:135379197-135379219 GAGTGTCCCCTGTAGGCAGATGG + Intronic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
998497647 5:142604663-142604685 AAGTGTTCCCTGGAGGAAGGTGG + Intronic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
998593144 5:143499285-143499307 GGATGTGCACTGGAGGAAGAAGG - Intergenic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1001428065 5:171637550-171637572 GAGTGTCTCCAGTAGGGAGAGGG + Intergenic
1001834119 5:174816531-174816553 GCTTGAACCCAGGAGGAAGAGGG - Intergenic
1001884580 5:175277832-175277854 GTGTGTACCCAGCAGGCAGAAGG - Intergenic
1002087996 5:176787746-176787768 GAATGGTCCCAGAAGGAAGAGGG - Intergenic
1002353382 5:178602004-178602026 GCTTGAACCCAGGAGGAAGAAGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002933049 6:1647417-1647439 GAGTGTCCCCAGCAGGCTGAAGG + Intronic
1003460920 6:6327405-6327427 GAGTGTTCCCAAGAGTAATATGG + Intergenic
1004284537 6:14308571-14308593 GAGGGTGCCCAGGAGAAGGTGGG - Intergenic
1004740207 6:18452865-18452887 GCTTGAGCCCAGGAGGCAGAAGG - Intronic
1004746413 6:18513122-18513144 GCCTGTGCCCAGGAGGAAAGGGG - Intergenic
1005116354 6:22342317-22342339 GAGGGTGGCGAGTAGGAAGAAGG - Intergenic
1005750464 6:28877273-28877295 GAGCGTGCCCAGGAAAAAGCTGG - Intergenic
1005809070 6:29502535-29502557 CTTTGTGCCCAGGAGGGAGAGGG + Intergenic
1006207646 6:32362380-32362402 GAGAGTCCCCAGTAGCAAGAAGG + Intronic
1006385536 6:33728765-33728787 AAGGGTGCTCAGGAGGCAGAGGG - Intronic
1007198266 6:40082438-40082460 GAGTGGTCCCAGGTGGAGGAGGG - Intergenic
1007775755 6:44223565-44223587 GAATGTGCCCCGGCGGGAGAGGG + Intronic
1009810438 6:68656054-68656076 GACTCTGCTCAGGAGGAAAAAGG - Intronic
1009956456 6:70460722-70460744 TAGTGTGACCAAGAGCAAGAAGG + Intronic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011131283 6:84054014-84054036 GATTGTGCCCTGGAGGCAGTGGG + Intronic
1012390234 6:98729800-98729822 TTGTGTGCTCAGGAGAAAGAAGG + Intergenic
1013178915 6:107701443-107701465 GGGTGTGCCCTGGAGGCAGCTGG - Intergenic
1014256475 6:119164850-119164872 GATTGTACCCAGTAGGAAAAAGG + Intergenic
1016384194 6:143515071-143515093 CAGGGTGCCCAGGCGGGAGATGG + Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017678269 6:156837716-156837738 GAGGGTGCAGAGGAAGAAGATGG + Intronic
1017875398 6:158520084-158520106 GAGAGTGGCCTGGGGGAAGAGGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018379612 6:163246332-163246354 GAGAGTGTCCAGGCAGAAGAAGG - Intronic
1019313457 7:373946-373968 GAGGGTGGGCAGGAGGGAGAGGG + Intergenic
1019441931 7:1051893-1051915 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1019472270 7:1227363-1227385 GAATGTGGCCAGGAGGAGAAGGG - Intergenic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1020460561 7:8425393-8425415 GTGTGTGCCGAGGAGTAACAGGG + Intergenic
1021287085 7:18793643-18793665 GAGTGTTCTCAGGCAGAAGAAGG - Intronic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1022090194 7:27103038-27103060 GAGTGTGCGGGGGAGGCAGAGGG - Intergenic
1023593117 7:41799758-41799780 TTGTGTGCCCATGATGAAGAGGG - Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023688742 7:42764173-42764195 AAGTGTGCCAAAGAGGAAAAGGG + Intergenic
1023775441 7:43601695-43601717 GAGGATGACCAAGAGGAAGAGGG - Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878757 7:44307002-44307024 GGGTGTGAGCAGGAAGAAGAGGG + Intronic
1024485244 7:49910213-49910235 GAGTTCGCCCAGGAGGTGGAGGG - Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1025003723 7:55339454-55339476 GGGTGTGCCCAAGAGCAGGAGGG + Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025261558 7:57423413-57423435 GAGCGTGCTCAGGAGGCAGGTGG + Intergenic
1026183489 7:68062691-68062713 GAGTGGGGGCAAGAGGAAGAGGG + Intergenic
1027804141 7:82794552-82794574 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
1027875553 7:83763434-83763456 GAGTTTTCCCAGGTGGATGAAGG + Intergenic
1028382288 7:90212295-90212317 GGTTGGGCCCAGGAGAAAGAAGG + Intronic
1029497390 7:100903385-100903407 AAGTGCGCCCAGGACGAGGATGG - Intergenic
1030243742 7:107359326-107359348 GAGTGGGCCAAGGTGGCAGAGGG - Intronic
1031405530 7:121381176-121381198 GTCTGTGACTAGGAGGAAGAGGG - Intronic
1031539505 7:122976614-122976636 AAGTGTGCCAAAGAGGCAGAAGG - Intergenic
1032463173 7:132126634-132126656 GACTGTTCCCAGGAAGAAGCAGG - Exonic
1032540692 7:132700470-132700492 GACTGTGCCCAGGTGCAGGAGGG + Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033004768 7:137549471-137549493 GTGTGTTCCCAGTAAGAAGAAGG - Intronic
1034262030 7:149763257-149763279 GTGTGTGCCCAGCAGGAAGGAGG - Intergenic
1034487369 7:151374317-151374339 GAGTGAGCCCGGGAGGATGCTGG - Intronic
1034907756 7:154965563-154965585 GAGTGGGCCTAGGAGGAGGAGGG - Intronic
1034932499 7:155173695-155173717 GGGTCTGCACAGCAGGAAGAAGG + Intergenic
1035005864 7:155660154-155660176 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
1035186703 7:157131845-157131867 GCTTGGGCCCAGGAGGCAGAGGG + Intergenic
1035469268 7:159099408-159099430 GGGTGTGCCCAGGAGGAGACAGG + Intronic
1036079613 8:5540665-5540687 GAGTGTGCCCAAGATCAAGGAGG - Intergenic
1036516706 8:9450989-9451011 AACCGTGTCCAGGAGGAAGAGGG + Intergenic
1036645201 8:10608243-10608265 GAGGCGGCCCAGGAGGCAGAAGG - Exonic
1036687904 8:10924095-10924117 GAGAGGGCCCAGGAGGAGGAGGG - Intronic
1036806924 8:11841407-11841429 GGGTGTGTATAGGAGGAAGAGGG + Intergenic
1037834587 8:22208579-22208601 GAGTGTGCCCAGGTGACAGCAGG + Intronic
1037928521 8:22864061-22864083 CTGTGTGCCCAGGAGCAAGGCGG - Intronic
1039047255 8:33461375-33461397 GAGTGTGACAAGCAGAAAGACGG + Exonic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039254225 8:35701381-35701403 GAGTAGGCCCTGGGGGAAGATGG - Intronic
1039298965 8:36188808-36188830 GTGGTTGCCCAGGAGGAAAATGG - Intergenic
1039355991 8:36816245-36816267 ATGTGTTCCCAGGAGGAAAATGG + Intronic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1040572533 8:48623392-48623414 GAGTGTGGGCTGGAGGAATAGGG + Intergenic
1041356686 8:57007904-57007926 GAGTGTCCCCACCAGCAAGAAGG + Intergenic
1041373926 8:57193364-57193386 GCGCTTGTCCAGGAGGAAGAAGG + Intergenic
1041509078 8:58634379-58634401 GAGTGTCCCTAGGAGGCAGATGG - Intronic
1041793448 8:61721973-61721995 GAGTGGGGACAGGAGGAAGGAGG - Intergenic
1042537083 8:69870000-69870022 GAGGGAGGGCAGGAGGAAGATGG - Intergenic
1042810956 8:72824558-72824580 GAGTGTGCCTAGGGTGAAGCAGG - Intronic
1045965975 8:108024935-108024957 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1046529765 8:115428482-115428504 GAGTCTGCTCAGCAGAAAGATGG + Intronic
1047953185 8:129952627-129952649 GAGTGTGAACAGGAGAAATATGG + Intronic
1048302636 8:133262691-133262713 CTGAGTGCCCAGGAGGAAAAGGG - Intronic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1049314764 8:141958610-141958632 GAGTCCGCACAGGAGGAAGGCGG - Intergenic
1049316622 8:141972585-141972607 GAGTGTGGCCATTTGGAAGATGG + Intergenic
1049408160 8:142460803-142460825 GAGAGTGCTCAGGAGGTGGAAGG - Intronic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049575380 8:143387408-143387430 GCTTGAGCCCAGGAGGCAGAGGG - Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1050776043 9:9261668-9261690 GTGTGTGTTCAGGAGGGAGAGGG + Intronic
1051457741 9:17280005-17280027 TAGAGTCCCCATGAGGAAGAAGG + Intronic
1051878056 9:21811625-21811647 GAGTGAGCCAAGGAGGAGGTAGG - Intronic
1052203620 9:25811540-25811562 GAGTGTTTTCAGGAGGAAGCAGG + Intergenic
1052513167 9:29447471-29447493 GAGTGAGAACAGGAAGAAGAGGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1055026537 9:71728397-71728419 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1055873371 9:80913256-80913278 GAGTTTGTCCAGGAGGTAGCAGG - Intergenic
1056297329 9:85206003-85206025 CACTGGTCCCAGGAGGAAGATGG + Intergenic
1057481649 9:95449360-95449382 GAGTGTGGCCAGCAGGTAAATGG - Intronic
1058195572 9:101970891-101970913 GTGTGTGTCCAGGAGGAAAAGGG + Intergenic
1058381173 9:104378732-104378754 GAGTGTGCACTGCAGGAAGTGGG - Intergenic
1058714246 9:107709263-107709285 GAGGATGCTCAGGAGGAAGGTGG + Intergenic
1058907753 9:109495510-109495532 GAGTGGGGCCAGGAGCAAGAGGG - Intronic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1061224910 9:129275812-129275834 GAATGTGCCCTGGGGGCAGATGG - Intergenic
1061800990 9:133113349-133113371 GAGGGTGCGCAGGAGGCAGGAGG - Intronic
1062541808 9:137044875-137044897 CACTGAGCCCAGGAGGAAGCCGG + Intronic
1203439771 Un_GL000195v1:178276-178298 GAGAGTGCCCAAGAATAAGAGGG - Intergenic
1185953099 X:4458174-4458196 GAGGGTGGCAAGGAGGAAAATGG - Intergenic
1186368177 X:8917922-8917944 GAGAGTCCCCACCAGGAAGAAGG + Intergenic
1186469095 X:9807363-9807385 GAGTGTCCCCAGGAGCAAGCAGG + Intronic
1186896433 X:14008863-14008885 GCGTGTACCCAAAAGGAAGAAGG + Exonic
1186900768 X:14053115-14053137 GAGTAAGCTGAGGAGGAAGAGGG + Intergenic
1187342772 X:18436220-18436242 GAGTAGGCTGAGGAGGAAGAGGG + Intronic
1187679235 X:21750077-21750099 GGGTGTGTTCAGGAGAAAGAAGG + Intronic
1188201575 X:27299053-27299075 GTGTGTTCCTAGGAGGAAGCAGG - Intergenic
1188422511 X:30007410-30007432 AAGTGTGCCCAGGAGAAGAAAGG - Intergenic
1189142895 X:38625336-38625358 CTGTGTGCCTAGGAAGAAGATGG - Intronic
1189229516 X:39441346-39441368 TAGGGTGCCCAAGAGGATGATGG + Intergenic
1189391941 X:40583720-40583742 GAGTGTGCCCTGGACATAGAGGG + Intronic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1191225543 X:58039031-58039053 GAACGTTCCCAGCAGGAAGAAGG + Intergenic
1191778361 X:64842988-64843010 GAGTGAGCCCAGGAGGAGTGAGG - Intergenic
1195004519 X:100672740-100672762 GAGTGGGCTCAGGAGGAAAGAGG + Intergenic
1195371392 X:104178247-104178269 GCATGAGCCCAGGAGGCAGAGGG - Intronic
1196665300 X:118309644-118309666 GAGGGTGCCTAGGAAGAAGAAGG - Intergenic
1197290372 X:124649037-124649059 GAGGGACTCCAGGAGGAAGATGG + Intronic
1198180297 X:134201397-134201419 GCTTGAGCCCAGGAGGCAGAGGG - Intergenic
1198393809 X:136202970-136202992 CAGTGTGCTCAGGATGAAGTTGG - Intronic
1199718501 X:150525042-150525064 CAGTCTGCCCATCAGGAAGAGGG + Intergenic
1200061739 X:153486820-153486842 GAGTGTGTGCTGGAGGAAGGCGG - Exonic
1201645531 Y:16225815-16225837 GAGTGGACTGAGGAGGAAGAAGG + Intergenic
1201657282 Y:16359499-16359521 GAGTGGACTGAGGAGGAAGAAGG - Intergenic