ID: 901055580

View in Genome Browser
Species Human (GRCh38)
Location 1:6447426-6447448
Sequence TGCAGGAAATGCGACACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 2, 2: 0, 3: 5, 4: 54}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055580_901055584 -6 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055584 1:6447443-6447465 CCTGCAACGTGAGCCAGGTCGGG 0: 3
1: 0
2: 0
3: 6
4: 108
901055580_901055591 13 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055591 1:6447462-6447484 CGGGCGGGGTGAAGGGTCTGAGG 0: 3
1: 0
2: 0
3: 25
4: 230
901055580_901055593 24 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055593 1:6447473-6447495 AAGGGTCTGAGGCCACCGCAGGG 0: 3
1: 0
2: 0
3: 12
4: 137
901055580_901055589 6 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055589 1:6447455-6447477 GCCAGGTCGGGCGGGGTGAAGGG 0: 3
1: 0
2: 0
3: 8
4: 138
901055580_901055588 5 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055588 1:6447454-6447476 AGCCAGGTCGGGCGGGGTGAAGG 0: 3
1: 0
2: 0
3: 13
4: 232
901055580_901055585 -3 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055585 1:6447446-6447468 GCAACGTGAGCCAGGTCGGGCGG 0: 3
1: 0
2: 0
3: 6
4: 110
901055580_901055582 -7 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055582 1:6447442-6447464 TCCTGCAACGTGAGCCAGGTCGG 0: 3
1: 0
2: 1
3: 12
4: 103
901055580_901055587 -1 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055587 1:6447448-6447470 AACGTGAGCCAGGTCGGGCGGGG 0: 3
1: 0
2: 1
3: 18
4: 171
901055580_901055586 -2 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055586 1:6447447-6447469 CAACGTGAGCCAGGTCGGGCGGG 0: 3
1: 0
2: 0
3: 5
4: 89
901055580_901055592 23 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055592 1:6447472-6447494 GAAGGGTCTGAGGCCACCGCAGG 0: 3
1: 0
2: 0
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055580 Original CRISPR TGCAGGAAATGCGACACCGC AGG (reversed) Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG + Intergenic
904199897 1:28812703-28812725 TGCAGGAAATGCGGAGGCGCGGG - Intronic
923485954 1:234431714-234431736 TGCAGTAAATGAGACACAGAGGG + Intronic
1062821202 10:535805-535827 TCCAGGAAATACGACACCTTGGG + Intronic
1064949308 10:20829753-20829775 TGCAGGAAATCTGACAGCTCAGG + Intronic
1068745913 10:60530528-60530550 TGCAGCAAATGAGGCACCTCAGG + Intronic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1076297471 10:129397717-129397739 TGCAGGACATGCGACACAGTGGG - Intergenic
1078849043 11:15147352-15147374 TGCAGAAAATGAGATACAGCAGG - Intronic
1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG + Intronic
1083017533 11:59470841-59470863 TGAAGCAAATGCAACACTGCTGG + Intergenic
1091649510 12:2299407-2299429 AGCAGGAAATGGTACACAGCTGG - Intronic
1094093728 12:26679450-26679472 AGCAGGAAATGGGACCCTGCAGG + Intronic
1094406985 12:30126736-30126758 TCCAGGAAATGAAACACGGCAGG - Intergenic
1096423034 12:51476738-51476760 TGCAGGTAAGGCCACACCACTGG - Intronic
1099362133 12:81717403-81717425 TGCAGGAAATCCAACACTGGTGG + Intronic
1105764664 13:23547203-23547225 TGCAGGAACGGAGGCACCGCAGG + Intergenic
1107332005 13:39311540-39311562 TGCAGGAAGTGGGACAGTGCTGG + Intergenic
1115948241 14:38689387-38689409 TGAAGGAAAGGCAACACAGCAGG + Intergenic
1122977934 14:105178603-105178625 TGCCGGAGATGGGACCCCGCGGG - Intronic
1128809336 15:70559347-70559369 TGCAGGAAATGAGAGGCCACAGG + Intergenic
1131069283 15:89455112-89455134 TGGAGGAAACGCTACACAGCAGG - Intergenic
1134875994 16:17699219-17699241 TGGATGAAATGTGACACAGCTGG - Intergenic
1135910547 16:26556718-26556740 TGCAGGAAATCTGAGACAGCTGG - Intergenic
1136469796 16:30472636-30472658 TGCAGGAGTTGTGAAACCGCAGG - Exonic
1141810175 16:86370888-86370910 TACAGAAAGTGCGACACCACAGG - Intergenic
1161309319 19:3585441-3585463 TCCCGGGAAGGCGACACCGCGGG - Intergenic
1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG + Intergenic
931686160 2:64795975-64795997 TGGATGAAATGCCACACCGCAGG - Intergenic
942672217 2:178388376-178388398 TGCAGGCAATGGGCCACCGCAGG - Intronic
946326917 2:218989362-218989384 TGGAGGAAATGGGACAACGCAGG + Intergenic
1171988711 20:31678962-31678984 AGAAGGAAATGCAACACCGTGGG - Intronic
1173341977 20:42161211-42161233 TGTAGGAAATGCAACATCTCAGG - Intronic
1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG + Intronic
1177863113 21:26478587-26478609 TGCGGGAAATGGGGAACCGCTGG + Intronic
1178774834 21:35539929-35539951 GGCTGGAAATGCCACACAGCAGG - Intronic
1179628113 21:42659971-42659993 TGCAGCAACTGGGACACCTCGGG + Intronic
1181553100 22:23652310-23652332 TGCAGGAAATGCCCCACTCCTGG + Intergenic
967156369 3:186696217-186696239 TGCAGGAAATGCTGCACAGAGGG - Intergenic
986012278 5:3726664-3726686 TGCAGGAATTGCTACAGCTCTGG - Intergenic
986456363 5:7924546-7924568 TGCAGGAAATGGGACAACACCGG + Intergenic
988490361 5:31700541-31700563 TGCAGGGAATGCGGCAACCCTGG - Intronic
989192638 5:38686196-38686218 AGCAAGAATTGCGACACCGATGG - Intergenic
1000383680 5:160652149-160652171 AGCAGGAAAGGAGACACAGCAGG - Intronic
1004370784 6:15050407-15050429 AGAAGGAAACGCGATACCGCAGG + Intergenic
1007251502 6:40498204-40498226 AGCAGGAGATGGGACACAGCTGG + Intronic
1008816935 6:55579336-55579358 TGCGGAAAATGAGACACCCCTGG - Intergenic
1017206436 6:151808255-151808277 TGCAGGAAAGGCGACAGCTGCGG - Exonic
1017556797 6:155580343-155580365 TGCATGAAATGCAACAGTGCCGG + Intergenic
1030688711 7:112511335-112511357 AGCATGAAATGAGACAACGCTGG - Intergenic
1041076468 8:54174558-54174580 TGCAAGAAATGCGGCAGCCCAGG - Intergenic
1043504294 8:80887235-80887257 TGCAAGAAATGCAAAACCTCAGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058746759 9:107999172-107999194 TGGATGTAATGCGACACCGTGGG - Intergenic
1060460953 9:123854050-123854072 TGCAGGAAAAGAGAAACCGTGGG + Intronic
1062217517 9:135397292-135397314 TGCAGGAAGTGGCACACTGCTGG + Intergenic
1062266468 9:135688620-135688642 TGCAGGAACTGTGACCCTGCAGG - Intergenic
1062266481 9:135688686-135688708 TGCAGGAACTGTGACCCTGCAGG - Intergenic
1203781098 EBV:101257-101279 TGCAGGGAATGCGGCCCCGGCGG + Intergenic