ID: 901055584

View in Genome Browser
Species Human (GRCh38)
Location 1:6447443-6447465
Sequence CCTGCAACGTGAGCCAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 3, 1: 0, 2: 0, 3: 6, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055579_901055584 7 Left 901055579 1:6447413-6447435 CCAGAAAACAAATCCTGCGGTGT 0: 1
1: 2
2: 0
3: 6
4: 103
Right 901055584 1:6447443-6447465 CCTGCAACGTGAGCCAGGTCGGG 0: 3
1: 0
2: 0
3: 6
4: 108
901055578_901055584 8 Left 901055578 1:6447412-6447434 CCCAGAAAACAAATCCTGCGGTG 0: 1
1: 2
2: 0
3: 16
4: 117
Right 901055584 1:6447443-6447465 CCTGCAACGTGAGCCAGGTCGGG 0: 3
1: 0
2: 0
3: 6
4: 108
901055580_901055584 -6 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055584 1:6447443-6447465 CCTGCAACGTGAGCCAGGTCGGG 0: 3
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055584 Original CRISPR CCTGCAACGTGAGCCAGGTC GGG Intronic
900366437 1:2313706-2313728 CCTGCAAGGTGGGCCTGGCCAGG + Intergenic
901000914 1:6148362-6148384 CTTGGAACAGGAGCCAGGTCTGG + Intronic
901055584 1:6447443-6447465 CCTGCAACGTGAGCCAGGTCGGG + Intronic
901183285 1:7356340-7356362 CCTGCAGCGTGTGACAGGTGTGG - Intronic
902478806 1:16701194-16701216 CCTGCAACGTGAGCCAGGTCGGG - Intergenic
905441860 1:38000950-38000972 CCTTCAGCTTGAGCCAGGGCAGG - Intronic
906219709 1:44069093-44069115 TCTGCAAACTGAGGCAGGTCTGG + Intergenic
906640861 1:47439507-47439529 CCAGCAACGGGAGCCAGGGCCGG - Exonic
916490340 1:165296762-165296784 CTTGCAACATTAGCCAGTTCAGG - Intronic
919944943 1:202312131-202312153 CCTGTAACGGGAGCTAGGGCAGG + Intronic
920840085 1:209546730-209546752 CATGCAACGTGAGCAGGGTTTGG + Intergenic
923093009 1:230753768-230753790 CCTGCAGGGTGAGCCAGAACGGG + Intronic
1067415183 10:46097283-46097305 CCTGCCACCAGAGCCAGTTCTGG - Intergenic
1069719338 10:70539654-70539676 CCTGCATGGTAAGGCAGGTCTGG - Exonic
1069799906 10:71075639-71075661 CCTGGAAGGTGACCCAGGACTGG - Intergenic
1069862256 10:71479137-71479159 CCTGCTGTGTGAGCCCGGTCAGG - Intronic
1073254968 10:102145069-102145091 CCTGCCACGTTGGCCAGTTCTGG - Exonic
1076520178 10:131076409-131076431 CCTGCATCATGAGTCAGGTGAGG + Intergenic
1076685402 10:132196379-132196401 CCTGCACTGTGAGCCAGGCATGG + Intronic
1077142706 11:1031434-1031456 CCAGCAACATGAGCCAGGACTGG - Intronic
1078655457 11:13234775-13234797 CCTGGAACGTGAACAAGTTCAGG - Intergenic
1083780176 11:64913655-64913677 GCTGCATCGTGAGCCCGGACTGG - Intronic
1084496744 11:69509646-69509668 CCTGCAGAGAGAGCCAGGCCTGG - Intergenic
1084915773 11:72428042-72428064 CCTGCGAACAGAGCCAGGTCTGG - Intronic
1089850294 11:121490066-121490088 CCTGAATCATGATCCAGGTCTGG - Exonic
1097035187 12:56119216-56119238 CTTGCAACGTGAGCCAGGCTTGG + Intronic
1103258163 12:119561204-119561226 CCTCCAATGTTAGCCAGCTCTGG - Intergenic
1104720091 12:131040563-131040585 CCTGCCCCTTGAGCCAGGGCAGG + Intronic
1118830073 14:69422563-69422585 CCGGCAAGGAGAGCCAGGCCCGG - Intronic
1123412445 15:20071995-20072017 CCTGGGACATCAGCCAGGTCAGG + Intergenic
1123521787 15:21079108-21079130 CCTGGGACATCAGCCAGGTCAGG + Intergenic
1124095499 15:26645085-26645107 TGTGTAACGTGAGCCAGGCCTGG + Intronic
1125722585 15:41852335-41852357 TGGGCAAGGTGAGCCAGGTCAGG + Intronic
1127585768 15:60376483-60376505 ACTGGAAAGTGAGCCAGGACAGG + Intronic
1129771170 15:78204457-78204479 CCTGCCATGTGGGGCAGGTCTGG - Intronic
1132601568 16:775268-775290 CCTGTAGCCTGAGCCAGGTGCGG - Exonic
1136017288 16:27408805-27408827 TCTGCAATGTGACCCAGGTAGGG - Intronic
1136142558 16:28296829-28296851 CCTGCACCTAGAACCAGGTCAGG - Intronic
1137056218 16:35747806-35747828 CCTGAAAGGTAAGCAAGGTCAGG + Intergenic
1137374771 16:47943221-47943243 CCAGCAACGTGGGTCAGGTGGGG - Intergenic
1140698224 16:77556320-77556342 CCTGCAGCAGGAGCCAGGCCTGG - Intergenic
1145007801 17:19347422-19347444 GCTGCAGCGTGGGCCAAGTCAGG + Intronic
1147323724 17:39660519-39660541 CCTGCCAGGTGAGCCCAGTCTGG + Exonic
1147874311 17:43610193-43610215 CCAGAAACTTGAGCCTGGTCCGG - Intergenic
1151650533 17:75466072-75466094 ACAGCAACTTTAGCCAGGTCTGG - Intronic
1151715081 17:75827179-75827201 CCTGGAATGCGAGCCAGGCCGGG - Intergenic
1151723761 17:75873217-75873239 CCTAGAACCTGAGCCAGGCCTGG - Intergenic
1152602613 17:81272320-81272342 CTGGCAACTTGAGCCAGGTGCGG - Intronic
1152715818 17:81900068-81900090 CCTCCAGCGAGAGCCAGGTCGGG - Exonic
1152822421 17:82444135-82444157 CCGGCAACGGGAGGAAGGTCAGG + Intronic
1155153733 18:23141679-23141701 CCTGCAATGTGGGCGAGCTCAGG + Intronic
1160020935 18:75180711-75180733 ACTGCACCCTGAGCCTGGTCTGG + Intergenic
1160811328 19:1014177-1014199 CCATCAAGGTGAGCCAGGCCTGG - Exonic
1161285763 19:3467514-3467536 CCTGCAGGGGGACCCAGGTCTGG - Intronic
1163148801 19:15399360-15399382 CCTGCAACTTGCGCTTGGTCTGG + Exonic
1163695440 19:18761228-18761250 GCAGCAACGTGGGCCAGGGCAGG - Intronic
1165828493 19:38719027-38719049 CCTGCAGGGGGAGCCAGGCCCGG - Intronic
1167698893 19:51030773-51030795 CCTGCCAGGTGAGCCAGTGCAGG - Exonic
1202712825 1_KI270714v1_random:27025-27047 CCTGCAACGTGAGCCAGGTCGGG - Intergenic
927159328 2:20242773-20242795 CCTGCTGCGTGAGCCAGGCTTGG + Intergenic
927645927 2:24877008-24877030 CCTGCCAAGTGGGCCAGGTTGGG - Intronic
927715241 2:25347617-25347639 GCTGGTAGGTGAGCCAGGTCTGG - Intergenic
928377821 2:30790269-30790291 CCTGCAAAGTGAGACAGATTGGG - Intronic
933770053 2:85737865-85737887 CCTCCAAGGGGAGCCAGTTCAGG + Intergenic
936278972 2:111121951-111121973 CCTGCACCGCGAACCGGGTCGGG - Intronic
937161006 2:119760461-119760483 CCTGGGAGGTGAGCCAGGTGGGG + Intronic
937680256 2:124635827-124635849 CCTGTGACGTGAGCCTGCTCAGG - Intronic
938389414 2:130893261-130893283 CCTCCCAGGTGAGCCAGGGCAGG - Intronic
945056568 2:205874473-205874495 CCAGCAGCGGCAGCCAGGTCGGG - Intergenic
947436986 2:230081237-230081259 CTTGAAACGTGAGCTGGGTCAGG - Intergenic
948917118 2:241039962-241039984 CCTGCAATGTAAGCCAGTTGGGG + Intronic
1169674028 20:8133499-8133521 CCTGCACCGTTTGCCAGGTAGGG + Intronic
1173840673 20:46154725-46154747 TCTGCAAAGTGGGCCAGGGCTGG + Intergenic
1174732888 20:52935501-52935523 CCCCCAAAGTGAGCCAGCTCTGG + Intergenic
1179506981 21:41847724-41847746 CCTGGAACATGAGCCACATCTGG - Intronic
1181638520 22:24185252-24185274 CCTGCACCCTGACCCAGGCCCGG + Exonic
1183341582 22:37284640-37284662 GCTGGAACCTGAGCGAGGTCCGG - Intronic
1183498256 22:38162849-38162871 CCTTCAAGGAGAGCCAGGTGTGG + Intronic
951710812 3:25583653-25583675 CCTGGAAGGTGAGCAAGGGCAGG - Intronic
954442010 3:50527122-50527144 CCTCCAGCAGGAGCCAGGTCAGG - Intergenic
954454827 3:50592170-50592192 ACAGCAAGGTGAGGCAGGTCTGG + Intergenic
955932132 3:64067706-64067728 GCTGCAACGAGTGCCAGTTCTGG + Intergenic
956058083 3:65321860-65321882 CCTGTAATGTGAGCCACGTTTGG - Intergenic
961650926 3:128416314-128416336 CCTGCAGGGTGGGCCAGGCCGGG - Intergenic
968127672 3:196171731-196171753 ACTGCAATGTGGGCCAGGTGCGG - Intergenic
969556115 4:7911369-7911391 CCTGCAACATGGGCGAGGCCCGG - Intronic
972039875 4:34579645-34579667 CCTGCAAAGTCAGCAATGTCAGG - Intergenic
975361605 4:73477248-73477270 CCTGCAATGTGATGCAGGTGGGG + Intergenic
982197440 4:152930520-152930542 CCTTCAATTTTAGCCAGGTCAGG + Intergenic
984560788 4:181266921-181266943 TCTGAAATGTGACCCAGGTCTGG - Intergenic
998057805 5:139093956-139093978 CCTGAAACATGATCCAGGACTGG - Intronic
1001542260 5:172547823-172547845 CCTGCAAAGGGAGCCAGGCTTGG + Intergenic
1002601072 5:180354087-180354109 CCTGCAGCGCGAGGCAGATCTGG - Intergenic
1007596798 6:43055921-43055943 CGTGGAAAGTGAGCCAGGCCGGG - Exonic
1007667461 6:43523735-43523757 CCTGGAAAGAGATCCAGGTCTGG - Exonic
1016985912 6:149895770-149895792 CCTGCTACCTTAGCCAGTTCAGG + Intronic
1019514453 7:1433603-1433625 CCTGGAACGTGAGCTGGGTGTGG - Intronic
1019941107 7:4291937-4291959 ACAGCAAAGTGAGGCAGGTCAGG + Intergenic
1030100023 7:105937645-105937667 TCTGCTGCCTGAGCCAGGTCAGG - Intronic
1032089574 7:128904487-128904509 CCTGCAGAGTAAGCCAGCTCTGG - Intronic
1032516105 7:132507526-132507548 CCTTCACCTTGAGCCAGGCCAGG + Exonic
1034442263 7:151091861-151091883 CCTCAAACGTGTGCCAGGCCTGG + Intronic
1035022072 7:155805945-155805967 CCTGCGCGGTTAGCCAGGTCTGG - Intronic
1035221286 7:157407888-157407910 CCTGCAACTGGGGCCTGGTCGGG + Intronic
1035570087 8:666993-667015 CCTGCAGCGTGGACCAGGTGGGG - Intronic
1035699430 8:1626871-1626893 CCAGCTGCGTGAGCCAGGTCAGG + Exonic
1037505459 8:19525145-19525167 CCTGGAAGGAGAGCCAGGCCTGG - Intronic
1045871632 8:106934171-106934193 CCTGCACCCTGAGCCTGGTAAGG + Intergenic
1046785153 8:118257913-118257935 CCTGAATGGTGAGCAAGGTCAGG - Intronic
1048787076 8:138062025-138062047 CCTGCAACGTTTTCCAGGGCTGG + Intergenic
1053129178 9:35605582-35605604 CCTGCCATGTGAGGCAGGCCCGG + Exonic
1057228033 9:93302714-93302736 CCTGCACCTTGAGTCAGCTCGGG - Intronic
1057415661 9:94860148-94860170 AGTGGAACGTGAGCCAGGCCAGG + Intronic
1059114093 9:111585347-111585369 TCTGCACTGTGAGCCAGGTGTGG - Intronic
1062563992 9:137155828-137155850 CCTGCAAGGTGAGGCCTGTCTGG + Intronic
1198213605 X:134536993-134537015 CCAGGCACGTGACCCAGGTCAGG - Intergenic
1199544553 X:148994182-148994204 CCTGCAACTTGACCCAGGTAGGG + Exonic