ID: 901055585

View in Genome Browser
Species Human (GRCh38)
Location 1:6447446-6447468
Sequence GCAACGTGAGCCAGGTCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 3, 1: 0, 2: 0, 3: 6, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055580_901055585 -3 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055585 1:6447446-6447468 GCAACGTGAGCCAGGTCGGGCGG 0: 3
1: 0
2: 0
3: 6
4: 110
901055578_901055585 11 Left 901055578 1:6447412-6447434 CCCAGAAAACAAATCCTGCGGTG 0: 1
1: 2
2: 0
3: 16
4: 117
Right 901055585 1:6447446-6447468 GCAACGTGAGCCAGGTCGGGCGG 0: 3
1: 0
2: 0
3: 6
4: 110
901055579_901055585 10 Left 901055579 1:6447413-6447435 CCAGAAAACAAATCCTGCGGTGT 0: 1
1: 2
2: 0
3: 6
4: 103
Right 901055585 1:6447446-6447468 GCAACGTGAGCCAGGTCGGGCGG 0: 3
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055585 Original CRISPR GCAACGTGAGCCAGGTCGGG CGG Intronic
900786733 1:4654537-4654559 GTGACGTGAGCCGGGCCGGGCGG + Intergenic
901055585 1:6447446-6447468 GCAACGTGAGCCAGGTCGGGCGG + Intronic
902478805 1:16701191-16701213 GCAACGTGAGCCAGGTCGGGCGG - Intergenic
908739087 1:67308366-67308388 GCAACGGGAGCCACGTCTGTGGG - Intronic
909365171 1:74812321-74812343 GCAACTTGTGCAAGGTCGTGTGG - Intergenic
914918582 1:151832829-151832851 GCCACGTGCACCAGGTGGGGGGG - Intergenic
920840086 1:209546733-209546755 GCAACGTGAGCAGGGTTTGGTGG + Intergenic
922103175 1:222490803-222490825 GAAACGTTAGCCAGGTGTGGTGG + Intergenic
922188166 1:223294478-223294500 GCATCATAAGCCAGGTGGGGAGG - Intronic
922402669 1:225276608-225276630 GCAACCTGGGCCAGGTGTGGTGG + Intronic
922769275 1:228173405-228173427 GCAGCGTGGGGCATGTCGGGGGG - Intronic
1071718556 10:88120417-88120439 GCATCGCGAGGCAGGTGGGGAGG + Intergenic
1081748443 11:45489385-45489407 GCATCGGGAGCCAGGTGGGAGGG - Intergenic
1083740727 11:64710193-64710215 GAAACGTGAGCCAGGTGCAGTGG - Intronic
1083749824 11:64754853-64754875 GCAGCGTGAGTCAGGGCGGTGGG + Intronic
1084815740 11:71645036-71645058 GCAACGTGTGCCAGGACAGATGG + Intergenic
1088857699 11:113771261-113771283 GCAACCTCAGCCAGGTGCGGTGG - Intronic
1089182842 11:116594933-116594955 CCAACCTGAGCCTGGTTGGGTGG - Intergenic
1089497394 11:118914557-118914579 GGCACGTGGGCCAGGCCGGGAGG + Intronic
1089563977 11:119361145-119361167 GAAACCTGAGCCAGGCAGGGAGG - Intronic
1090735825 11:129611535-129611557 GCAAAGTGGGCCAGGTGCGGTGG - Intergenic
1092366146 12:7878689-7878711 GGAAATTGAGCCAGGTGGGGTGG + Intronic
1092427273 12:8385016-8385038 GCAACGTGTGCCAGGACAGATGG - Intergenic
1094587726 12:31793448-31793470 ACAAAGTGAGCCAGGTGTGGTGG + Intergenic
1096521136 12:52185435-52185457 GCAAAGTGAGCCAGGAGCGGGGG - Exonic
1103640022 12:122343284-122343306 GCAAAATTAGCCAGGTCTGGTGG - Intronic
1103928136 12:124435039-124435061 GCAGCAGGAGCCAGGTCGCGTGG - Intronic
1103940443 12:124498544-124498566 GAAACGTGGCTCAGGTCGGGAGG - Intronic
1110283073 13:73718467-73718489 GAAACGTGGGCCAGGTGTGGTGG + Intronic
1118830072 14:69422560-69422582 GCAAGGAGAGCCAGGCCCGGTGG - Intronic
1121854975 14:97259798-97259820 GCAATGTGAGCCAGGAACGGGGG - Intergenic
1122211438 14:100176615-100176637 GCAAGGAGGGCCAGGTAGGGTGG + Intergenic
1202905733 14_GL000194v1_random:71630-71652 GCCAGGTGAGCAAGGTAGGGGGG - Intergenic
1123693945 15:22863369-22863391 GCAAACTGAGCCAGGTGTGGTGG - Intronic
1124095500 15:26645088-26645110 GTAACGTGAGCCAGGCCTGGTGG + Intronic
1124423988 15:29547373-29547395 TCAATGTGGGCCAGGTCTGGTGG - Intronic
1126049876 15:44675892-44675914 GGAACCTGAGCCAGGTGTGGTGG + Intronic
1131562746 15:93458608-93458630 GCTGTGTGAGCCAGGTAGGGAGG - Intergenic
1132637570 16:959841-959863 ACACCGTGTGCCAGGACGGGAGG + Intronic
1134043691 16:11086276-11086298 GGATCTTGAGCCAGGTGGGGTGG - Intronic
1135914565 16:26594053-26594075 GCAAAGTGAGCTAGGGCTGGGGG + Intergenic
1135914615 16:26594623-26594645 GCAAAGTGAGCTAGGGCTGGGGG - Intergenic
1136356040 16:29745387-29745409 TAAGCGTGAGCCAGGTGGGGTGG + Intronic
1137359273 16:47798028-47798050 GCCACGTGGGCCAGGAGGGGAGG + Intergenic
1138653272 16:58473967-58473989 GCAGAGTGAGCCAGGAGGGGAGG - Intronic
1143499339 17:7329760-7329782 GCAGCGTGAGCCGAGTCTGGAGG + Intergenic
1145892396 17:28426358-28426380 GCAGCCTGGGCCAGGTCTGGAGG - Intergenic
1145964166 17:28905094-28905116 GAAAAGTGAGCCAGGGTGGGTGG - Intergenic
1151476926 17:74349381-74349403 GCAACGTGAGGCTGGCCGGAGGG - Intronic
1151650532 17:75466069-75466091 GCAACTTTAGCCAGGTCTGGTGG - Intronic
1152602612 17:81272317-81272339 GCAACTTGAGCCAGGTGCGGTGG - Intronic
1152743947 17:82030797-82030819 CCAAAGTGAGACAGGCCGGGAGG + Exonic
1157500861 18:48189746-48189768 GCAAGGCGAGCCAGGTCGTTGGG - Intronic
1157904492 18:51557218-51557240 GCATTGTGTGCCAGGTGGGGAGG - Intergenic
1161977745 19:7615651-7615673 GCAACCCGAGCGAGGCCGGGTGG - Exonic
1163334383 19:16661337-16661359 GCCAGGTGAGCCGGGGCGGGGGG + Exonic
1166878854 19:45914634-45914656 TCAACCTGAGCCAGGTGGTGTGG - Exonic
1167285371 19:48596197-48596219 GCAAGGGGAGGCAGGTGGGGAGG + Intronic
1167517121 19:49929900-49929922 GCAACGTGGGGCAGGGAGGGTGG - Intronic
1202712824 1_KI270714v1_random:27022-27044 GCAACGTGAGCCAGGTCGGGCGG - Intergenic
926216053 2:10905959-10905981 GGAAGCTGAGCCAGGTCAGGTGG - Intergenic
927468835 2:23357118-23357140 GCAAGGAGAGCAAGGTGGGGAGG + Intergenic
928991404 2:37235943-37235965 GCAAGGGGAGCCAGGTGTGGTGG - Intronic
932081751 2:68722105-68722127 CCAACTTGAGCCAGCTGGGGAGG - Intronic
935337460 2:102030088-102030110 GCAACATGAGCCAAGTCAGTTGG + Intergenic
936952616 2:117993241-117993263 AAAAAGTGAGCCAGGTCTGGTGG + Intronic
937906702 2:127056018-127056040 GCAAGGTGTGCCAGGCCAGGAGG - Intronic
945169560 2:206981542-206981564 GCCAGGTGAGCCAGGTGTGGTGG + Intergenic
946396310 2:219445361-219445383 GCATGGTGAGCCAGGACAGGTGG - Intronic
1168820864 20:772994-773016 GCAGCGGGAGCCAGGTTGGAGGG + Intergenic
1169772635 20:9218390-9218412 GCAATTTGAGCCAGGTTCGGTGG - Intronic
1176625087 21:9086387-9086409 GCCAGGTGAGCAAGGTAGGGGGG - Intergenic
1180568513 22:16695508-16695530 GCAACGTGGGCCAGGGAGGAGGG + Intergenic
1185074864 22:48677746-48677768 ACAAGGAGAGTCAGGTCGGGCGG + Intronic
950518228 3:13480756-13480778 CCAACCTGAGCCAGGGCGGGGGG - Intronic
952639532 3:35577021-35577043 GCAAAATGAGCCAGGTGTGGTGG - Intergenic
959220643 3:103514432-103514454 GCAACATGGGCCAGGTGTGGTGG - Intergenic
961219995 3:125192248-125192270 GCCCCGTGAGGCAGGCCGGGAGG + Intronic
961282163 3:125772376-125772398 GCAACGTGTGCCAGGACAGATGG + Intergenic
962701141 3:138000682-138000704 GGAACGTGAGCCAGATGGGTGGG + Intronic
968127671 3:196171728-196171750 GCAATGTGGGCCAGGTGCGGTGG - Intergenic
968233000 3:197015325-197015347 GCAGCGTGGGCCAGGTGGGCGGG - Intronic
969015574 4:4102033-4102055 GCAACGTGTGCCAGGACAGATGG - Intergenic
969437596 4:7197604-7197626 CCAACTTGAGCAAGGTCTGGGGG + Intronic
986298047 5:6455822-6455844 GGAGTGTGAGCCAGGTGGGGTGG - Intronic
989612974 5:43313184-43313206 GCACCGTGAGCGGGGCCGGGCGG - Intronic
997964776 5:138348304-138348326 GCAACTTGAGCCAGGACAGCTGG + Exonic
997985964 5:138501869-138501891 GCAACATGAGCCAGCTGGGGTGG - Intergenic
999124013 5:149233170-149233192 GCAACCTGAGCTTGGTGGGGAGG - Intronic
999857725 5:155613453-155613475 GCAGAGTGAGCCAGGGAGGGAGG + Intergenic
1002016987 5:176332441-176332463 GCAAAGTTAGCCGGGTCTGGTGG - Intronic
1002288018 5:178178241-178178263 AGAAAGTGAGCAAGGTCGGGGGG + Intergenic
1003197462 6:3927678-3927700 GCAACTTTAGCCAGGTGTGGTGG - Intergenic
1006681724 6:35801960-35801982 ACAACCTGAGCCAGGTGCGGTGG + Intergenic
1009952435 6:70413253-70413275 GGAACGGGAGCCTGGTAGGGAGG + Intronic
1013249032 6:108315892-108315914 GAAACGTGAGCCAGGAATGGTGG + Intronic
1019095568 6:169576612-169576634 AAAACATGAGCCAGGTGGGGTGG + Intronic
1021451997 7:20791236-20791258 GCGAGCTGAGCCAGGTTGGGTGG + Intergenic
1021887078 7:25149938-25149960 GCAAAGAGAACCAGGTCAGGAGG - Intronic
1023864515 7:44232444-44232466 GCCACGTGAGGGAGGTGGGGTGG + Intronic
1029074237 7:97923666-97923688 GCAACGTGTGCCAGGACAGATGG - Intergenic
1029705953 7:102275719-102275741 GCAGGGTGAGCCAGGTGCGGTGG + Intronic
1030004542 7:105104398-105104420 GTATCGTGAGCCAGGTGTGGTGG + Intronic
1034523830 7:151641695-151641717 GCAACATTAGCCAGGTATGGTGG - Intronic
1047371354 8:124258444-124258466 ACAAAGTCAGCCAGGTGGGGTGG - Intergenic
1048889212 8:138932944-138932966 GCAAGGGGAGCCAGGTGTGGTGG + Intergenic
1049664894 8:143838638-143838660 GCACGGTGAGCCAGCTGGGGAGG + Intronic
1051906139 9:22096880-22096902 GCAAGGTGAGCGGGGTGGGGAGG - Intergenic
1056197613 9:84243618-84243640 GCAATGTGAGACAGATCTGGTGG - Intergenic
1059932360 9:119273487-119273509 GCAACGTGAGCAAGGCAGGGAGG + Intronic
1060773015 9:126346466-126346488 GCAGAGACAGCCAGGTCGGGTGG + Intronic
1060848215 9:126854061-126854083 GCAAGGTCAGCCAGGTGTGGTGG + Intergenic
1203748260 Un_GL000218v1:56843-56865 GCCAGGTGAGCAAGGTAGGGGGG - Intergenic
1203561461 Un_KI270744v1:61165-61187 GCCAGGTGAGCAAGGTAGGGGGG + Intergenic
1189107542 X:38253226-38253248 GAAACATGAGCCAGGTGCGGTGG + Intronic
1199717897 X:150519423-150519445 ACAACGTGGGCCAGGTGTGGTGG + Intergenic
1200254947 X:154575619-154575641 GGAACGTGTGCCAAGTTGGGTGG + Intergenic
1200262822 X:154628789-154628811 GGAACGTGTGCCAAGTTGGGTGG - Intergenic
1201161610 Y:11171817-11171839 GCCAGGTGAGCAAGGTAGGGGGG - Intergenic