ID: 901055586

View in Genome Browser
Species Human (GRCh38)
Location 1:6447447-6447469
Sequence CAACGTGAGCCAGGTCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 3, 1: 0, 2: 0, 3: 5, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055578_901055586 12 Left 901055578 1:6447412-6447434 CCCAGAAAACAAATCCTGCGGTG 0: 1
1: 2
2: 0
3: 16
4: 117
Right 901055586 1:6447447-6447469 CAACGTGAGCCAGGTCGGGCGGG 0: 3
1: 0
2: 0
3: 5
4: 89
901055579_901055586 11 Left 901055579 1:6447413-6447435 CCAGAAAACAAATCCTGCGGTGT 0: 1
1: 2
2: 0
3: 6
4: 103
Right 901055586 1:6447447-6447469 CAACGTGAGCCAGGTCGGGCGGG 0: 3
1: 0
2: 0
3: 5
4: 89
901055580_901055586 -2 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055586 1:6447447-6447469 CAACGTGAGCCAGGTCGGGCGGG 0: 3
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055586 Original CRISPR CAACGTGAGCCAGGTCGGGC GGG Intronic
900786734 1:4654538-4654560 TGACGTGAGCCGGGCCGGGCGGG + Intergenic
901055586 1:6447447-6447469 CAACGTGAGCCAGGTCGGGCGGG + Intronic
902478804 1:16701190-16701212 CAACGTGAGCCAGGTCGGGCGGG - Intergenic
904162467 1:28531858-28531880 CGACGTGGGCCAGCTGGGGCTGG + Exonic
910472693 1:87572214-87572236 AAACCTGAGCCTGGACGGGCAGG + Intergenic
913257896 1:116972002-116972024 CATGGTGAGCAAGGGCGGGCAGG - Intronic
916382657 1:164229600-164229622 CAACCAGAGCCAGGGCAGGCAGG + Intergenic
917455486 1:175182394-175182416 GAACGTGAGCCAGGTGGAACTGG - Intronic
921556338 1:216602533-216602555 CAAAGTGTTCCAGGTCAGGCTGG - Intronic
1062856714 10:783494-783516 AGACGGGGGCCAGGTCGGGCCGG - Intergenic
1063367281 10:5499039-5499061 CGACGTGGACCAGGACGGGCGGG - Exonic
1066476562 10:35752676-35752698 CCACGTGGGCCAGCTGGGGCTGG + Intergenic
1068942110 10:62690395-62690417 CAAACTGAGCCAGGTGTGGCTGG - Intergenic
1069604818 10:69732447-69732469 CAAGGTGAGACAGGCCGGGGCGG + Intergenic
1070483091 10:76904353-76904375 CAATGTGAGCCAGTTAAGGCAGG - Intronic
1075922464 10:126224693-126224715 CAAGGTGAGCCAGGGAAGGCAGG - Intronic
1089182841 11:116594932-116594954 CAACCTGAGCCTGGTTGGGTGGG - Intergenic
1096974912 12:55694424-55694446 CCACGTAAGCCAGGCGGGGCCGG - Exonic
1101147846 12:101858131-101858153 CAACGTTAGCCAGGCTGGTCTGG + Intergenic
1101718863 12:107334101-107334123 CACCGTAAGCCAGGTTGGGTAGG + Intronic
1104908851 12:132229996-132230018 CACCGGGACCCAGGTCGGCCTGG - Intronic
1113715374 13:112502312-112502334 CACCGTGAGACAGGCCGTGCTGG + Intronic
1113987997 13:114334526-114334548 CAACATCAACCAGGACGGGCAGG + Intergenic
1118309201 14:64680372-64680394 CACCGTGAGTCAAGCCGGGCAGG - Intergenic
1121232349 14:92366969-92366991 CAACCTGAGCCAGGAGGGCCAGG - Intronic
1122926456 14:104905318-104905340 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926466 14:104905361-104905383 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926476 14:104905404-104905426 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926528 14:104905662-104905684 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926538 14:104905705-104905727 AACCGAGAGCCAGGACGGGCAGG + Intergenic
1122926548 14:104905748-104905770 AACCGTCAGCCAGGACGGGCAGG + Intergenic
1122926566 14:104905834-104905856 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926576 14:104905877-104905899 AACCGTCAGCCAGGACGGGCAGG + Intergenic
1122926604 14:104906006-104906028 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926657 14:104906264-104906286 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926683 14:104906393-104906415 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926734 14:104906613-104906635 AACCATGAGCCAGGACGGGCAGG + Intergenic
1122926744 14:104906656-104906678 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122926796 14:104906876-104906898 AACCATGAGCCAGGACGGGCAGG + Intergenic
1122926806 14:104906919-104906941 AACCGCGAGCCAGGACGGGCAGG + Intergenic
1122972160 14:105156771-105156793 CAACGTGAGCCTGGAGAGGCTGG - Intronic
1125184492 15:36914920-36914942 CAACGTGAGCCAGGATGTTCAGG + Intronic
1128778404 15:70341628-70341650 CAAGGAGAGCCAGATTGGGCCGG - Intergenic
1130229738 15:82087509-82087531 CAACATGAGCCTGGGAGGGCAGG - Intergenic
1132543571 16:522731-522753 CAAGGTGGGGCAGGTGGGGCGGG + Exonic
1134100165 16:11446495-11446517 CAACTTGAACCAGGGCTGGCTGG + Intronic
1136356041 16:29745388-29745410 AAGCGTGAGCCAGGTGGGGTGGG + Intronic
1137374770 16:47943217-47943239 CAACGTGGGTCAGGTGGGGAAGG - Intergenic
1141501501 16:84447946-84447968 CCACGTGAGCCAGGTATGTCCGG + Intronic
1142253741 16:89003899-89003921 CAACGGCAGCCAGGAAGGGCTGG + Intergenic
1143492554 17:7292857-7292879 CCAGGAGAGCCAGGCCGGGCAGG + Intronic
1144949971 17:18988865-18988887 CACCCTGAGCCAGGTCCAGCAGG - Intronic
1145207537 17:20992592-20992614 CAACGTGGGCACGGGCGGGCAGG - Intergenic
1147675074 17:42199746-42199768 CAAAGTGAGCCAGGACGGCCTGG + Exonic
1148496997 17:48059014-48059036 CCACGTGCTCCAGGTAGGGCAGG - Exonic
1158191059 18:54828903-54828925 CAAGGAGAGCCAGGTCGAGTTGG - Intronic
1161348510 19:3779523-3779545 GCACGTGAGCAAGGTGGGGCGGG - Exonic
1161483717 19:4523734-4523756 CCAGGTCCGCCAGGTCGGGCAGG + Exonic
1162354926 19:10176966-10176988 CAAAGTAATCCAGGTGGGGCAGG + Intronic
1165871422 19:38975820-38975842 CAGCGGGAGCGAGGGCGGGCGGG + Exonic
1166878853 19:45914633-45914655 CAACCTGAGCCAGGTGGTGTGGG - Exonic
1167590711 19:50402929-50402951 CAGGGTGAGCCACGTAGGGCCGG + Intronic
1167978911 19:53255957-53255979 CCACGTTAGCCAGGTTGGTCTGG + Intergenic
1202712823 1_KI270714v1_random:27021-27043 CAACGTGAGCCAGGTCGGGCGGG - Intergenic
932081750 2:68722104-68722126 CAACTTGAGCCAGCTGGGGAGGG - Intronic
935434404 2:103013725-103013747 CAAGATGAGCCAGGTCTGGGAGG + Intergenic
938389411 2:130893257-130893279 CCAGGTGAGCCAGGGCAGGCAGG - Intronic
945188149 2:207160551-207160573 CAACTTGAGCCAGATGGGACTGG + Intronic
1172773120 20:37392979-37393001 GAATGTGAACCAGGTCTGGCTGG - Intronic
1176075617 20:63247056-63247078 CCACGTGACCCAGGTCTGACCGG - Intronic
1179457274 21:41508162-41508184 AAGCGAGAGCCAGGGCGGGCCGG - Intronic
1181014013 22:20058003-20058025 CAATGTGGACCAGGTGGGGCAGG - Intronic
1182122972 22:27798809-27798831 CTAGCTGAGCCAGGTTGGGCTGG + Exonic
1183824023 22:40370843-40370865 CGACGCGAGCAAGGTCGGCCCGG - Intronic
1185074865 22:48677747-48677769 CAAGGAGAGTCAGGTCGGGCGGG + Intronic
951112371 3:18819363-18819385 CAACTGGAGTCAGGTGGGGCTGG + Intergenic
954454829 3:50592174-50592196 CAAGGTGAGGCAGGTCTGGGAGG + Intergenic
969437597 4:7197605-7197627 CAACTTGAGCAAGGTCTGGGGGG + Intronic
969971901 4:11056446-11056468 CAAGGGGAGCCAGGGCGAGCAGG - Intergenic
974103647 4:57443735-57443757 CACCGTGGGCCAGGCCTGGCGGG - Intergenic
976272926 4:83248570-83248592 CAAGGTGAGGCAGGTTGGGCAGG - Intergenic
985647865 5:1093574-1093596 CAACCTGAGCCAGGGCGTGGTGG - Exonic
989612973 5:43313183-43313205 CACCGTGAGCGGGGCCGGGCGGG - Intronic
997985963 5:138501868-138501890 CAACATGAGCCAGCTGGGGTGGG - Intergenic
1001405706 5:171475548-171475570 CAGGGTGAGCCAGGTCTGGAAGG - Intergenic
1007790880 6:44307423-44307445 CCACCTGGGCCAGGTCAGGCAGG - Exonic
1019363181 7:616400-616422 CAAAGTGAGCCAGGCAGGCCTGG - Intronic
1019780503 7:2937027-2937049 CAACCTGGACCAGGTGGGGCGGG - Exonic
1027172032 7:75879257-75879279 CAAGGTGAGCAGGGGCGGGCCGG + Exonic
1037313348 8:17578280-17578302 AAATGTGAGCCAGGTCGAGCTGG - Intronic
1047319834 8:123768762-123768784 CAACGTGAGACAGGTACGGCCGG + Exonic
1053284814 9:36843310-36843332 CACCGTGGGGCAGGGCGGGCCGG + Intronic
1061346906 9:130033694-130033716 AAAAGTTAGCCAGGCCGGGCTGG + Intronic
1186666338 X:11720994-11721016 CAACGTTAGCCAGGCTGGTCTGG - Intergenic
1190064189 X:47229209-47229231 CAATATGAGGCAGGTGGGGCAGG - Exonic
1190089841 X:47428066-47428088 AAACATTAGCCAGGTCGTGCTGG - Intergenic
1199717898 X:150519424-150519446 CAACGTGGGCCAGGTGTGGTGGG + Intergenic